The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017775	Bacillus velezensis strain 9912D chromosome, complete genome	4206167	532381	636609	4206167	capsid,integrase,protease,terminase,portal,transposase,tail,coat,holin,head,tRNA	uncultured_Caudovirales_phage(37.04%)	122	591660:591678	634143:634161
WP_014417026.1|532381_532681_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_014417027.1|532688_532895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014417028.1|532913_534050_-	glutathione-dependent formaldehyde dehydrogenase	NA	E3SJ82	Synechococcus_phage	26.7	1.0e-14
WP_014417029.1|534068_534437_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_007409324.1|534454_534700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050586614.1|535169_536330_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_014417035.1|536322_536958_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	29.3	3.2e-10
WP_071181559.1|537056_539210_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_025650282.1|539243_539966_-	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_017419179.1|540092_541721_-	ABC-F type ribosomal protection protein	NA	Q6DMX7	Streptococcus_phage	28.3	1.1e-49
WP_017419178.1|541997_542525_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003156057.1|542640_543498_-	YitT family protein	NA	NA	NA	NA	NA
WP_065180736.1|543780_544914_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_017419177.1|545058_546270_+	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_065180737.1|546298_547534_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_014417044.1|547642_548482_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017419175.1|548524_549268_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_021495023.1|549425_549884_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003156048.1|550015_550837_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071181560.1|551052_551925_+	DMT family transporter	NA	NA	NA	NA	NA
WP_071181561.1|552088_552706_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_017419171.1|552741_553524_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_017419170.1|553571_554630_-	tartrate dehydrogenase	NA	NA	NA	NA	NA
WP_025650286.1|554812_555499_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012116955.1|555641_556835_+	UDP-glucosyltransferase	NA	O89808	Epiphyas_postvittana_nucleopolyhedrovirus	27.1	5.1e-09
WP_071181562.1|556892_557147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015388621.1|557380_557650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071181563.1|557783_559142_+	serine hydrolase	NA	G1DUA7	Mycobacterium_virus	23.8	8.9e-10
WP_007409301.1|559194_559368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017419166.1|559564_560131_+	YdhK family protein	NA	NA	NA	NA	NA
WP_007409299.1|560182_561343_-	MFS transporter	NA	NA	NA	NA	NA
WP_017419165.1|561674_562391_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014417058.1|562511_563198_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017419164.1|563187_564402_+	MFS transporter	NA	NA	NA	NA	NA
WP_003156024.1|564461_564776_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_003156023.1|564775_565105_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_007409294.1|565181_565763_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017419163.1|565879_567442_-	APC family permease	NA	NA	NA	NA	NA
WP_014417059.1|567679_568534_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_017419162.1|568645_569113_-	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_025650290.1|569240_570242_+	acryloyl-CoA reductase	NA	NA	NA	NA	NA
WP_094246999.1|570357_571507_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.9	2.7e-39
WP_022552683.1|571963_573382_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_025649874.1|579190_580168_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_014417064.1|580183_580660_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_007408854.1|580640_581330_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_003155993.1|581340_581796_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_017418986.1|581788_582829_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	42.0	1.2e-62
WP_017418987.1|583051_584980_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	32.1	3.3e-58
WP_003155986.1|585119_585632_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_087614160.1|586061_587211_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
WP_003155981.1|587584_587755_+	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
WP_007609791.1|587761_588520_+	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_003155975.1|588558_588750_-	YdiK family protein	NA	NA	NA	NA	NA
WP_003155972.1|588746_589481_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003155970.1|589717_590002_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	51.6	2.2e-19
WP_003155941.1|590043_591678_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	57.5	3.7e-159
591660:591678	attL	TATGGGCGGCATGATGTAA	NA	NA	NA	NA
WP_071181564.1|591756_592968_-|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	42.0	2.4e-78
WP_071181565.1|592979_593453_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	33.8	8.7e-21
WP_071181566.1|593636_594197_-	DUF4352 domain-containing protein	NA	A0A2H4PQN2	Staphylococcus_phage	46.7	2.1e-29
WP_071181568.1|594486_594864_-	helix-turn-helix domain-containing protein	NA	A0A0A7RTK4	Clostridium_phage	55.9	3.5e-12
WP_071181569.1|595029_595281_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_071181570.1|595293_595599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071181571.1|595595_596324_+	phage regulatory protein/antirepressor Ant	NA	A0A2H4J4N4	uncultured_Caudovirales_phage	63.3	2.4e-86
WP_071181572.1|596381_596954_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J884	uncultured_Caudovirales_phage	55.0	7.5e-59
WP_044803182.1|596950_597208_+	hypothetical protein	NA	A0A2H4J4M9	uncultured_Caudovirales_phage	41.8	1.1e-09
WP_044803181.1|597204_597423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044803180.1|597382_597580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071181573.1|597681_597867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071181574.1|597866_598817_+	YqaJ viral recombinase family protein	NA	A0A2H4JA52	uncultured_Caudovirales_phage	71.4	2.1e-130
WP_053574365.1|598819_599662_+	recombinase RecT	NA	A0A2H4JCY8	uncultured_Caudovirales_phage	83.7	2.7e-126
WP_071181575.1|599826_600546_+	DnaD domain protein	NA	A0A2H4J6G9	uncultured_Caudovirales_phage	45.2	1.6e-42
WP_013351199.1|600430_601402_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	51.2	4.1e-57
WP_013351200.1|601398_601542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351202.1|602126_602585_+	DUF1064 domain-containing protein	NA	A0A2H4J891	uncultured_Caudovirales_phage	79.3	6.0e-59
WP_013351203.1|602704_602857_+	hypothetical protein	NA	A0A2H4J4N7	uncultured_Caudovirales_phage	65.9	1.2e-08
WP_003155894.1|602938_603142_+	XtrA/YqaO family protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	75.4	3.4e-22
WP_013351204.1|603173_603515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351205.1|603511_603766_+	hypothetical protein	NA	A0A2H4JA61	uncultured_Caudovirales_phage	39.8	1.1e-06
WP_013351206.1|603770_605147_+	DNA cytosine methyltransferase	NA	A0A1I9KFD6	Aeromonas_phage	49.3	1.2e-142
WP_071181576.1|605158_605482_+	hypothetical protein	NA	M5ABU9	Bacillus_phage	33.7	6.0e-05
WP_063636454.1|605478_606156_+	dUTP diphosphatase	NA	R9TQ23	Paenibacillus_phage	46.7	4.3e-37
WP_139850287.1|606085_606460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063636452.1|606456_606684_+	hypothetical protein	NA	A0A217EQZ3	Bacillus_phage	63.5	2.0e-23
WP_071181577.1|606699_606882_+	hypothetical protein	NA	A0A1P8CWX9	Bacillus_phage	52.2	5.0e-09
WP_071181578.1|606886_607198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071181579.1|607197_607632_+	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	71.4	1.1e-49
WP_164461502.1|607642_607819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071181581.1|608563_609079_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	42.6	1.2e-26
WP_014304494.1|609183_609321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003155868.1|609619_609832_+	helix-turn-helix domain-containing protein	NA	A0A1Z1LZP5	Bacillus_phage	52.9	9.6e-12
WP_071181582.1|609928_610276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071181583.1|610452_611208_+	hypothetical protein	NA	A0A2H4J4R0	uncultured_Caudovirales_phage	53.8	1.6e-61
WP_071182109.1|611194_612403_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2H4J8B0	uncultured_Caudovirales_phage	85.0	4.7e-204
WP_071181584.1|612402_613818_+|portal	phage portal protein	portal	A0A2H4J4Q7	uncultured_Caudovirales_phage	59.1	2.4e-151
WP_071181585.1|613804_614728_+|head	phage head morphogenesis protein	head	A0A1Q1PVS0	Bacillus_phage	51.8	6.0e-82
WP_014304499.1|614731_615013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014304500.1|615103_615685_+	DUF4355 domain-containing protein	NA	A0A2H4J4P4	uncultured_Caudovirales_phage	53.7	1.8e-52
WP_014304501.1|615699_616617_+|capsid	phage major capsid protein	capsid	A0A2H4JCG0	uncultured_Caudovirales_phage	68.9	9.0e-115
WP_071181586.1|616621_616957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071181587.1|616958_617231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071181588.1|617239_617548_+|head,tail	phage head-tail connector protein	head,tail	Q4ZC67	Staphylococcus_virus	40.2	1.3e-12
WP_071181589.1|617544_617883_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_071181590.1|617875_618292_+	HK97 gp10 family phage protein	NA	O48447	Bacillus_phage	54.2	1.6e-31
WP_015239630.1|618310_618709_+	DUF3168 domain-containing protein	NA	W8EK61	Geobacillus_phage	44.6	4.9e-25
WP_071181591.1|618722_619235_+|tail	phage major tail protein, TP901-1 family	tail	Q0PDK9	Bacillus_phage	45.3	5.0e-30
WP_079979749.1|619176_619491_+	fibronectin type III domain-containing protein	NA	Q0PDK9	Bacillus_phage	75.3	1.3e-25
WP_076983423.1|619504_619747_+	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
WP_053574170.1|619804_620311_+	hypothetical protein	NA	I6T7F0	Staphylococcus_virus	32.7	1.5e-10
WP_041481949.1|620358_620667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071181593.1|620671_625813_+	hypothetical protein	NA	M9NRJ5	Staphylococcus_phage	26.5	1.9e-36
WP_071181594.1|625809_626574_+|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_071181595.1|626586_629970_+|tail	phage tail protein	tail	Q5YA57	Bacillus_phage	46.1	1.3e-131
WP_071181596.1|629983_630373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003155837.1|630511_630679_+	XkdX family protein	NA	NA	NA	NA	NA
WP_017417520.1|630691_630913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351240.1|630975_631254_+	hemolysin XhlA family protein	NA	A0A2H4JD40	uncultured_Caudovirales_phage	71.7	1.1e-28
WP_014470539.1|631269_631533_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	69.0	2.0e-27
WP_071181597.1|631587_632748_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1P8CWN6	Bacillus_phage	65.1	3.3e-69
WP_053574165.1|632774_633644_-	Abi family protein	NA	A3QSC6	Clostridium_virus	36.4	5.5e-45
WP_053574164.1|633766_633955_-	hypothetical protein	NA	A0A2H4J4T3	uncultured_Caudovirales_phage	71.0	4.7e-18
WP_017418988.1|635379_636609_+	5-aminolevulinate synthase	NA	G9E4Q1	Emiliania_huxleyi_virus	30.1	1.2e-40
634143:634161	attR	TATGGGCGGCATGATGTAA	NA	NA	NA	NA
>prophage 2
NZ_CP017775	Bacillus velezensis strain 9912D chromosome, complete genome	4206167	695332	705223	4206167		Synechococcus_phage(50.0%)	9	NA	NA
WP_014417100.1|695332_696625_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.3	4.5e-19
WP_007609852.1|696700_697420_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FUQ7	Synechococcus_phage	44.7	1.3e-47
WP_017419024.1|697419_697674_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	M4QPE7	Synechococcus_phage	34.6	2.1e-05
WP_017419025.1|697670_698354_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_071181616.1|698337_700566_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.7	4.2e-158
WP_007609856.1|700541_701972_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	6.2e-54
WP_007609857.1|702063_703104_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.4	6.3e-64
WP_007408902.1|703100_703688_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.8	1.3e-26
WP_017419028.1|703684_705223_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	50.5	1.9e-77
>prophage 3
NZ_CP017775	Bacillus velezensis strain 9912D chromosome, complete genome	4206167	895053	992447	4206167	capsid,integrase,protease,terminase,portal,transposase,tail,coat,holin,head,tRNA,plate	Bacillus_phage(53.49%)	107	921076:921096	962376:962396
WP_025650228.1|895053_895965_-|protease	serine protease	protease	NA	NA	NA	NA
WP_003155495.1|896109_896262_-	small, acid-soluble spore protein K	NA	NA	NA	NA	NA
WP_003155492.1|896385_896655_+	YfhJ family protein	NA	NA	NA	NA	NA
WP_017419151.1|896786_897314_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_017419152.1|897399_897735_+	SdpI family protein	NA	NA	NA	NA	NA
WP_017419153.1|897727_898588_+	alpha/beta hydrolase	NA	A0A0S2MV32	Mycobacterium_phage	25.6	6.5e-06
WP_003155484.1|898798_899779_+	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	39.3	1.5e-59
WP_063636896.1|899815_902401_+	YfhO family protein	NA	NA	NA	NA	NA
WP_071181649.1|902397_903381_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_071181650.1|903606_904704_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_017419157.1|904710_904935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017419158.1|905016_905769_+	enoyl-[acyl-carrier-protein] reductase FabL	NA	NA	NA	NA	NA
WP_007408564.1|905834_906005_+	gamma-type small acid-soluble spore protein	NA	NA	NA	NA	NA
WP_003155476.1|906165_906432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003155475.1|906567_907098_+	DUF402 domain-containing protein	NA	NA	NA	NA	NA
WP_017419159.1|907180_908923_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.3	7.4e-49
WP_017419160.1|909002_910067_-	aromatic acid exporter family protein	NA	NA	NA	NA	NA
WP_007408567.1|910276_911566_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_003155466.1|911723_912197_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_003155465.1|912321_912759_+	peroxide-responsive transcriptional repressor PerR	NA	NA	NA	NA	NA
WP_007408568.1|912793_913147_-	YgzB family protein	NA	NA	NA	NA	NA
WP_014417244.1|913349_914234_+	hypothetical protein	NA	NA	NA	NA	NA
921076:921096	attL	TTCGACCCCGGCCACCGGTAT	NA	NA	NA	NA
WP_017417250.1|921231_922347_-|integrase	site-specific integrase	integrase	Q5YAA6	Bacillus_phage	59.5	1.6e-121
WP_101287896.1|924066_924483_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_032864202.1|924666_924855_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017417255.1|924897_925221_+	DUF771 domain-containing protein	NA	Q9MBW7	Lactococcus_phage	39.8	2.0e-13
WP_017417257.1|925461_926328_+	hypothetical protein	NA	D2XR43	Bacillus_phage	62.4	1.1e-50
WP_017417258.1|926311_927145_+	ATP-binding protein	NA	Q2I8C8	Bacillus_phage	34.8	3.5e-33
WP_017417259.1|927159_927309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017417260.1|927305_927464_+	hypothetical protein	NA	A8ATM6	Listeria_phage	57.8	2.9e-05
WP_017417261.1|927460_928009_+	hypothetical protein	NA	A0A0K2CYJ0	Paenibacillus_phage	34.9	7.8e-05
WP_015387918.1|928117_928258_+	BH0509 family protein	NA	NA	NA	NA	NA
WP_015387919.1|928270_928426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014721584.1|928505_928709_+	XtrA/YqaO family protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	56.9	9.8e-14
WP_017417264.1|928849_929230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017417265.1|929226_929634_+	hypothetical protein	NA	W8CYU3	Bacillus_phage	45.0	2.5e-24
WP_015387923.1|929630_929888_+	hypothetical protein	NA	F8WQ54	Bacillus_phage	42.3	9.6e-06
WP_014471503.1|929892_931269_+	DNA cytosine methyltransferase	NA	A0A1I9KFD6	Aeromonas_phage	48.9	4.5e-142
WP_017417266.1|931280_931604_+	hypothetical protein	NA	M5ABU9	Bacillus_phage	34.7	2.1e-05
WP_017417267.1|931600_932284_+	dUTP diphosphatase	NA	R9TQ23	Paenibacillus_phage	43.3	4.8e-36
WP_017417268.1|932285_932546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017417269.1|932542_933001_+	hypothetical protein	NA	M4ZRL6	Bacillus_phage	64.3	3.5e-51
WP_017417270.1|933000_933219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017417271.1|933206_933392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017417272.1|933388_933592_+	hypothetical protein	NA	A0A1P8CWX9	Bacillus_phage	44.8	2.1e-08
WP_017417274.1|933781_934090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026092239.1|934086_934332_+	hypothetical protein	NA	A0A217ERB6	Bacillus_phage	46.2	9.4e-11
WP_017417276.1|934334_934769_+	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	70.7	4.1e-49
WP_017417277.1|934874_935051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017417278.1|935069_935522_+	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	55.9	3.7e-37
WP_017417279.1|935518_936061_+|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	59.4	1.8e-54
WP_017417280.1|936537_936852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017417281.1|936853_937135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017417282.1|937131_937446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017417283.1|937493_937862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017417284.1|937851_938217_+	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	55.0	2.1e-30
WP_017417285.1|938445_938961_+|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	44.6	7.5e-34
WP_014418487.1|938957_940667_+|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	62.6	2.1e-205
WP_017417287.1|940855_942136_+|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	63.3	2.0e-152
WP_017417288.1|942098_942728_+|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	76.3	6.3e-83
WP_071181651.1|942766_944059_+|capsid	phage major capsid protein	capsid	A0A0A7RTL2	Clostridium_phage	46.9	3.7e-90
WP_071181652.1|944086_944485_+	collagen-like protein	NA	D6R3Z0	Bacillus_phage	44.2	8.1e-12
WP_071181653.1|944502_944805_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	45.2	3.6e-12
WP_071181654.1|944794_945112_+|head	phage head closure protein	head	A0A2H4JCB1	uncultured_Caudovirales_phage	36.3	1.1e-11
WP_014418479.1|945108_945507_+	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_015387944.1|945503_945887_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_014305137.1|945901_946516_+|tail	tail protein	tail	A0A2H4J8F3	uncultured_Caudovirales_phage	34.4	2.9e-24
WP_014305136.1|946574_946943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017417292.1|951630_952470_+|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	57.9	1.1e-93
WP_046559937.1|952484_954188_+|tail	phage tail protein	tail	D6R400	Bacillus_phage	56.7	4.6e-181
WP_071181655.1|954238_956803_+	peptidase G2	NA	D6R401	Bacillus_phage	57.5	1.2e-289
WP_071181656.1|956815_958093_+|plate	BppU family phage baseplate upper protein	plate	D6R402	Bacillus_phage	82.8	3.2e-142
WP_061574015.1|958089_958473_+	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	55.8	2.0e-28
WP_017417296.1|958474_958630_+	XkdX family protein	NA	A0A1W6JQ64	Staphylococcus_phage	53.5	7.5e-06
WP_015239640.1|958665_959088_+|holin	phage holin family protein	holin	D6R405	Bacillus_phage	89.5	3.8e-60
WP_017417297.1|959135_960299_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1P8CWN6	Bacillus_phage	50.2	6.6e-70
WP_017417298.1|960312_960528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017417299.1|960609_961110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017417300.1|961252_961915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_186230137.1|962709_963588_+	hypothetical protein	NA	NA	NA	NA	NA
962376:962396	attR	TTCGACCCCGGCCACCGGTAT	NA	NA	NA	NA
WP_017417304.1|963668_964376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017417305.1|964356_967572_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_017417306.1|968309_968507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079891342.1|968460_968715_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_025650301.1|968818_969511_+	Type 1 glutamine amidotransferase-like domain-containing protein	NA	NA	NA	NA	NA
WP_065180684.1|969812_971585_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_003155431.1|973240_973420_+	FbpB family small basic protein	NA	NA	NA	NA	NA
WP_071181657.1|973422_975144_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_007610211.1|975212_976169_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_014417251.1|976181_977087_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_025650305.1|977083_978070_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.0e-15
WP_014417253.1|978062_979028_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_087614160.1|979175_980325_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
WP_071181658.1|980389_981835_-	catalase	NA	A0A2K9L0T1	Tupanvirus	41.5	1.8e-109
WP_025650306.1|982093_983029_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_014417255.1|983251_984019_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.8	3.6e-32
WP_025650307.1|984034_985024_+	aliphatic sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017417314.1|985023_985857_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_071181659.1|985881_987018_+	FMNH2-dependent alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
WP_050556568.1|987359_987668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007610245.1|987759_988029_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_071181660.1|988049_988517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003155407.1|988513_988717_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_071181661.1|989071_989695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029973233.1|989779_990940_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_071182114.1|991016_991928_+	amidase domain-containing protein	NA	NA	NA	NA	NA
WP_104843201.1|991964_992447_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP017775	Bacillus velezensis strain 9912D chromosome, complete genome	4206167	1215832	1249423	4206167	coat,tRNA,protease	Planktothrix_phage(16.67%)	38	NA	NA
WP_014417415.1|1215832_1216825_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_014417416.1|1217568_1219203_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014417417.1|1219309_1220245_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_007409113.1|1220248_1221166_+	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_003155039.1|1221178_1222255_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.9	1.7e-16
WP_017417453.1|1222247_1223165_+	oligopeptide ABC transporter ATP-binding protein OppF	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	24.6	1.5e-05
WP_079979752.1|1223271_1224450_+	putative glycoside hydrolase	NA	NA	NA	NA	NA
WP_003155035.1|1224567_1225146_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003155034.1|1225324_1225720_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_014417421.1|1225775_1226432_-	TerC family protein	NA	W8EBD0	Pseudomonas_phage	41.9	2.2e-30
WP_003155032.1|1226707_1227364_+	adaptor protein MecA	NA	NA	NA	NA	NA
WP_071181701.1|1227514_1228675_+	competence protein CoiA	NA	NA	NA	NA	NA
WP_106067880.1|1228902_1230732_+	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_003155026.1|1230769_1230937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003155024.1|1231222_1232125_-|protease	protease adaptor protein SpxH	protease	NA	NA	NA	NA
WP_025649585.1|1232121_1232520_-	thiol management oxidoreductase	NA	NA	NA	NA	NA
WP_025649586.1|1232748_1233435_-	lytic transglycosylase domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	70.3	1.8e-38
WP_014417426.1|1233439_1234012_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_012117290.1|1234136_1234502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003155019.1|1234529_1235165_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_003155018.1|1235182_1235983_+	NAD kinase	NA	NA	NA	NA	NA
WP_025649587.1|1235997_1236891_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.3	1.4e-06
WP_017417460.1|1236923_1237673_-	bis(5'-nucleosyl)-tetraphosphatase PrpE	NA	A0A1V0SJW2	Klosneuvirus	26.7	3.4e-11
WP_007610641.1|1237900_1239745_+	monovalent cation:proton antiporter family protein	NA	NA	NA	NA	NA
WP_015417218.1|1239994_1240702_+	thiaminase II	NA	NA	NA	NA	NA
WP_025649590.1|1240679_1241297_+	thiazole tautomerase TenI	NA	NA	NA	NA	NA
WP_071181702.1|1241280_1242390_+	glycine oxidase ThiO	NA	NA	NA	NA	NA
WP_007409096.1|1242386_1242590_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_007610655.1|1242586_1243357_+	thiazole synthase	NA	NA	NA	NA	NA
WP_025649592.1|1243353_1244364_+	thiazole biosynthesis adenylyltransferase ThiF	NA	NA	NA	NA	NA
WP_015417222.1|1244386_1245199_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003155001.1|1245329_1246106_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_164461505.1|1246197_1246812_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003154997.1|1246869_1247313_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003154995.1|1247458_1247941_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_015239583.1|1248091_1248592_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_015239584.1|1248684_1248999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003154992.1|1249036_1249423_-|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 5
NZ_CP017775	Bacillus velezensis strain 9912D chromosome, complete genome	4206167	1261180	1298075	4206167	integrase,portal,transposase,tail,head	Bacillus_phage(50.0%)	37	1261069:1261113	1305092:1305136
1261069:1261113	attL	CCTTGACAGGGTAGAGGTCGCTGGTTCGAGCCCAGTCGGAATCAT	NA	NA	NA	NA
WP_071181703.1|1261180_1262311_-|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	36.8	4.5e-55
WP_017417528.1|1262332_1262995_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017417529.1|1263198_1263423_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017417530.1|1263612_1264575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017417531.1|1264611_1264746_+	lysogeny pheromone AimP family peptide	NA	NA	NA	NA	NA
WP_017417532.1|1264846_1265764_+	hypothetical protein	NA	A0A1P8CWU6	Bacillus_phage	89.9	6.6e-142
WP_017417533.1|1265765_1265948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017417534.1|1265944_1266490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017417535.1|1266486_1266999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017417536.1|1267008_1268064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079979753.1|1268296_1271284_+	hypothetical protein	NA	O64076	Bacillus_phage	47.0	8.6e-223
WP_014417453.1|1271611_1271830_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014417454.1|1272243_1272390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017417539.1|1272417_1272894_+	hypothetical protein	NA	O64060	Bacillus_phage	45.5	1.7e-32
WP_017417540.1|1272893_1273607_+	hypothetical protein	NA	A0A1P8CWQ7	Bacillus_phage	42.4	7.4e-48
WP_071181704.1|1273630_1274416_+	hypothetical protein	NA	A0A1P8CWR0	Bacillus_phage	49.0	5.0e-37
WP_017417542.1|1274424_1275012_+	hypothetical protein	NA	A0A1P8CWQ5	Bacillus_phage	47.8	1.3e-37
WP_014417458.1|1275011_1275239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014417459.1|1275273_1275747_+	hypothetical protein	NA	A0A1P8CWQ6	Bacillus_phage	38.7	6.5e-24
WP_017417543.1|1275950_1276100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014721012.1|1276339_1276552_+	helix-turn-helix domain-containing protein	NA	A0A1Z1LZP5	Bacillus_phage	51.6	4.5e-09
WP_071181705.1|1276635_1277049_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_031600262.1|1277135_1278383_+|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
WP_014417461.1|1278436_1279000_-	recombinase family protein	NA	A0A0A8WIK3	Clostridium_phage	50.5	3.7e-42
WP_014417462.1|1279352_1281110_+	hypothetical protein	NA	A0A1V0DZW7	Clostridioides_phage	46.5	3.5e-147
WP_014417463.1|1281124_1282459_+|portal	phage portal protein	portal	I1TJV4	Clostridium_phage	31.1	2.3e-42
WP_014417464.1|1282566_1283166_+	DUF4355 domain-containing protein	NA	A0A2H4J4P4	uncultured_Caudovirales_phage	44.5	4.0e-31
WP_014417465.1|1283194_1284013_+	hypothetical protein	NA	E5DV53	Deep-sea_thermophilic_phage	43.3	3.8e-56
WP_014417466.1|1284074_1284221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025649600.1|1284220_1284538_+|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_025649601.1|1284548_1284887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031600262.1|1289260_1290508_+|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
WP_031600262.1|1293011_1294259_-|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
WP_154019386.1|1295044_1295191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025649603.1|1295180_1295633_+	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_014417468.1|1295948_1296680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031600262.1|1296827_1298075_-|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
1305092:1305136	attR	CCTTGACAGGGTAGAGGTCGCTGGTTCGAGCCCAGTCGGAATCAT	NA	NA	NA	NA
>prophage 6
NZ_CP017775	Bacillus velezensis strain 9912D chromosome, complete genome	4206167	1366069	1380909	4206167	terminase,portal,holin,transposase	uncultured_Caudovirales_phage(37.5%)	24	NA	NA
WP_094246999.1|1366069_1367219_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.9	2.7e-39
WP_025649636.1|1367276_1368041_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_017417598.1|1368189_1368657_-	DinB family protein	NA	NA	NA	NA	NA
WP_087920760.1|1368861_1369998_+	S9 family peptidase	NA	A0A1P8CWN8	Bacillus_phage	47.9	1.3e-94
WP_003154881.1|1369987_1370122_+	PhrA family phosphatase inhibitor	NA	NA	NA	NA	NA
WP_017417599.1|1370264_1371218_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A218KC88	Bacillus_phage	69.3	2.4e-62
WP_017417600.1|1371255_1371633_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	38.5	1.1e-15
WP_017417601.1|1371742_1372348_+	poly-gamma-glutamate hydrolase family protein	NA	A0A0Y0AJU6	Bacillus_phage	48.3	6.1e-43
WP_003154873.1|1372502_1373093_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	3.0e-39
WP_013351934.1|1373241_1373580_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	49.2	9.9e-19
WP_013351935.1|1373770_1373950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071181721.1|1373939_1374767_+|portal	phage portal protein	portal	S6BFM4	Thermus_phage	47.1	1.6e-17
WP_017417604.1|1374666_1375467_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	44.9	2.3e-58
WP_003154863.1|1375466_1375634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039251797.1|1375731_1376073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154859.1|1376062_1376266_+	XtrA/YqaO family protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	48.5	5.4e-12
WP_007407279.1|1376371_1376884_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CNQ1	Brevibacillus_phage	44.6	3.8e-22
WP_071181722.1|1376996_1377656_+|terminase	terminase	terminase	A0A1B1P867	Bacillus_phage	34.2	1.2e-07
WP_038457736.1|1378033_1378405_+	YomQ/XkdW protein, phage-like element PBSX	NA	NA	NA	NA	NA
WP_007610833.1|1378409_1378607_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	61.8	7.3e-14
WP_063636818.1|1378663_1379425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021493821.1|1379476_1379740_+	hemolysin XhlA family protein	NA	A0A2H4JD40	uncultured_Caudovirales_phage	65.5	2.1e-24
WP_003154813.1|1379753_1380017_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	65.5	2.3e-23
WP_007407257.1|1380030_1380909_+	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	60.5	3.7e-81
>prophage 7
NZ_CP017775	Bacillus velezensis strain 9912D chromosome, complete genome	4206167	1864996	1958354	4206167	integrase,transposase,coat,holin,tRNA	Bacillus_phage(52.17%)	53	1860330:1860345	1954564:1954579
1860330:1860345	attL	CATTGAAGAAATGGTT	NA	NA	NA	NA
WP_025649446.1|1864996_1866526_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_003154113.1|1866528_1866960_+	RicAFT regulatory complex protein RicA family protein	NA	NA	NA	NA	NA
WP_003154111.1|1867212_1867758_+|coat	outer spore coat protein CotE	coat	NA	NA	NA	NA
WP_025649445.1|1867876_1870462_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	24.2	5.1e-38
WP_017417802.1|1870477_1872355_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	31.5	2.4e-69
WP_025649444.1|1873397_1874129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021493661.1|1874552_1874762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014721196.1|1875251_1875464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154103.1|1875447_1876125_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	26.3	1.4e-11
WP_017417808.1|1877444_1878419_+	acyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_025649443.1|1878420_1880661_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_014417817.1|1880726_1880975_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_017417811.1|1881026_1882289_+	hydroxymethylglutaryl-CoA synthase family protein	NA	NA	NA	NA	NA
WP_025649442.1|1882285_1883059_+	enoyl-CoA hydratase/isomerase	NA	NA	NA	NA	NA
WP_087614160.1|1885812_1886962_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
WP_071181772.1|1903335_1919637_+	non-ribosomal peptide synthetase	NA	D0R7J2	Paenibacillus_phage	58.5	7.2e-122
WP_071181773.1|1919650_1927108_+	polyketide synthase dehydratase domain-containing protein	NA	D0R7J2	Paenibacillus_phage	30.1	5.0e-38
WP_025649439.1|1927243_1928455_-	cytochrome P450	NA	NA	NA	NA	NA
WP_007611576.1|1928743_1929178_+	sporulation protein	NA	F8WPS9	Bacillus_phage	55.7	5.5e-38
WP_003154084.1|1929237_1929993_+	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_007410383.1|1930026_1930389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065180799.1|1930580_1931909_-	S8 family peptidase	NA	A0A1B0T6A2	Bacillus_phage	34.2	8.4e-29
WP_021493648.1|1932087_1932321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014417828.1|1932577_1933285_+	poly-gamma-glutamate hydrolase family protein	NA	F8WQ53	Bacillus_phage	54.6	5.4e-51
WP_014305039.1|1933344_1933797_+	OsmC family protein	NA	NA	NA	NA	NA
WP_032865393.1|1933834_1934164_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_003154071.1|1934180_1934495_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_017417820.1|1934632_1934923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014417831.1|1935024_1935429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017417822.1|1935527_1936472_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_003154064.1|1936511_1936733_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_017417823.1|1936829_1937105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154062.1|1937187_1937403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071181774.1|1937662_1938055_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	59.1	1.1e-29
WP_007611605.1|1938014_1940117_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	85.7	0.0e+00
WP_012117608.1|1940134_1941124_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.0	1.1e-155
WP_017417824.1|1941172_1941790_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	47.9	2.1e-46
WP_087614160.1|1941853_1943004_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
WP_017417825.1|1943132_1943891_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	50.0	3.1e-52
WP_017417826.1|1944197_1945166_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.9	8.0e-53
WP_071181775.1|1945295_1946558_+	GTPase HflX	NA	NA	NA	NA	NA
WP_017417828.1|1946574_1947840_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_007611631.1|1947949_1948354_+	transcriptional repressor GlnR	NA	NA	NA	NA	NA
WP_025649426.1|1948411_1949746_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_013352364.1|1949865_1951011_-|integrase	site-specific integrase	integrase	A0A0M5M609	Bacillus_phage	38.7	8.8e-67
WP_071182120.1|1951267_1952023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031600262.1|1952095_1953343_+|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
WP_071181776.1|1953602_1954577_-	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	77.7	2.5e-78
WP_071181777.1|1954751_1956467_+	ribonuclease YeeF family protein	NA	O64023	Bacillus_phage	76.2	1.7e-252
1954564:1954579	attR	AACCATTTCTTCAATG	NA	NA	NA	NA
WP_071181778.1|1956475_1956973_+	SMI1/KNR4 family protein	NA	O64024	Bacillus_phage	87.9	1.3e-86
WP_076982784.1|1957207_1957297_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_063636675.1|1957521_1957989_+	DUF4879 domain-containing protein	NA	O64027	Bacillus_phage	56.5	8.0e-43
WP_021493945.1|1957994_1958354_+	hypothetical protein	NA	O64028	Bacillus_phage	61.4	7.5e-33
>prophage 8
NZ_CP017775	Bacillus velezensis strain 9912D chromosome, complete genome	4206167	1961698	1970702	4206167	holin	Bacillus_phage(100.0%)	9	NA	NA
WP_065180792.1|1961698_1962031_+	YolD-like family protein	NA	A0A1P8CWP2	Bacillus_phage	72.7	3.4e-40
WP_062623501.1|1962023_1963274_+	UV damage repair protein UvrX	NA	O64031	Bacillus_phage	91.1	1.5e-221
WP_079891309.1|1963437_1964598_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	26.3	3.8e-33
WP_041482578.1|1964749_1965010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014417851.1|1965365_1965617_-|holin	phage holin	holin	A0A1P8CWN5	Bacillus_phage	86.7	5.2e-33
WP_045208155.1|1965629_1966001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045207998.1|1966107_1967151_-	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A1J0MS59	Bacillus_phage	56.1	6.1e-91
WP_079979758.1|1967323_1969873_-	hypothetical protein	NA	D6R401	Bacillus_phage	36.0	1.8e-141
WP_071181779.1|1969886_1970702_-	hypothetical protein	NA	A0A1P8CWP7	Bacillus_phage	62.8	4.6e-94
>prophage 9
NZ_CP017775	Bacillus velezensis strain 9912D chromosome, complete genome	4206167	1974839	1991939	4206167	integrase,tail	Bacillus_phage(90.91%)	18	1981997:1982014	2001768:2001785
WP_071181780.1|1974839_1981739_-|tail	phage tail tape measure protein	tail	A0A1P8CWQ1	Bacillus_phage	74.5	0.0e+00
WP_071181781.1|1981802_1982429_-	hypothetical protein	NA	A0A0H3UZD5	Geobacillus_virus	31.9	4.7e-22
1981997:1982014	attL	TTAAATCAATTCTTTTGA	NA	NA	NA	NA
WP_071181782.1|1982585_1983017_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_071181783.1|1983018_1983285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071181784.1|1983241_1983832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046560223.1|1984059_1984275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014472041.1|1984319_1985321_-|integrase	site-specific integrase	integrase	A0A1P8CWP6	Bacillus_phage	86.7	2.2e-170
WP_014472040.1|1985334_1985751_-	hypothetical protein	NA	A0A1P8CWQ4	Bacillus_phage	68.3	1.4e-46
WP_014472039.1|1985750_1986236_-	hypothetical protein	NA	A0A1P8CWQ6	Bacillus_phage	72.3	8.3e-59
WP_071181785.1|1986318_1987167_-	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_014470095.1|1987185_1987338_-	XkdX family protein	NA	NA	NA	NA	NA
WP_057080548.1|1987338_1987614_-	hypothetical protein	NA	M4ZR44	Bacillus_phage	37.2	4.0e-10
WP_071181787.1|1987627_1988959_-	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	41.4	3.1e-23
WP_022553073.1|1988958_1989315_-	hypothetical protein	NA	O64055	Bacillus_phage	79.7	8.2e-48
WP_071181788.1|1989386_1989854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071181789.1|1989874_1990672_-	hypothetical protein	NA	A0A1P8CWR0	Bacillus_phage	35.5	4.4e-17
WP_071181790.1|1990710_1991436_-	hypothetical protein	NA	A0A1P8CWQ7	Bacillus_phage	32.7	7.3e-27
WP_071181791.1|1991432_1991939_-	hypothetical protein	NA	O64060	Bacillus_phage	67.3	2.6e-63
2001768:2001785	attR	TTAAATCAATTCTTTTGA	NA	NA	NA	NA
>prophage 10
NZ_CP017775	Bacillus velezensis strain 9912D chromosome, complete genome	4206167	2427621	2433874	4206167		Staphylococcus_phage(66.67%)	9	NA	NA
WP_007409428.1|2427621_2428215_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.6	2.6e-14
WP_007409427.1|2428204_2428960_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.7	2.9e-10
WP_003153376.1|2429167_2429257_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_025649807.1|2429344_2429866_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003153373.1|2429931_2430306_-	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_003153372.1|2430422_2430887_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	59.3	1.2e-43
WP_003153371.1|2430919_2432116_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	2.1e-116
WP_029973636.1|2432130_2432778_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.3	8.8e-40
WP_029973635.1|2432758_2433874_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.3	5.7e-55
>prophage 11
NZ_CP017775	Bacillus velezensis strain 9912D chromosome, complete genome	4206167	2796116	2904237	4206167	capsid,protease,terminase,portal,tail,coat,holin,head,tRNA,plate	Bacillus_phage(64.15%)	113	NA	NA
WP_071181868.1|2796116_2796881_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	A0A291ATS8	Pandoravirus	33.0	1.4e-20
WP_071181869.1|2797206_2798985_-|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SIS0	Klosneuvirus	29.1	8.7e-13
WP_017418229.1|2798999_2800274_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_094247699.1|2800630_2800801_-	YrzK family protein	NA	NA	NA	NA	NA
WP_071181870.1|2800931_2802494_+	SH3 domain-containing protein	NA	E5DV68	Deep-sea_thermophilic_phage	33.3	1.2e-13
WP_007408194.1|2802521_2802965_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_071181871.1|2802977_2805182_-	GTP diphosphokinase	NA	A0A2I2L310	Orpheovirus	34.8	1.5e-09
WP_003152714.1|2805339_2805852_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.2	5.5e-29
WP_025649678.1|2805857_2808218_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	34.6	1.5e-89
WP_003152709.1|2808273_2808600_-	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_012118088.1|2808663_2809161_-	cation:proton antiporter regulatory subunit	NA	NA	NA	NA	NA
WP_071181872.1|2809291_2811514_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	31.7	2.0e-27
WP_007408189.1|2811550_2811847_-	post-transcriptional regulator	NA	NA	NA	NA	NA
WP_025649680.1|2811962_2813519_+	stage V sporulation protein B	NA	NA	NA	NA	NA
WP_003152699.1|2813526_2814183_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_003152697.1|2814349_2814736_+	TIGR04086 family membrane protein	NA	NA	NA	NA	NA
WP_007408187.1|2814787_2815048_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	46.9	1.9e-06
WP_071181873.1|2815078_2816224_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.1	1.6e-89
WP_003152692.1|2816251_2817280_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_003152687.1|2817305_2817506_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_003152685.1|2817498_2818503_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	30.0	4.0e-07
WP_003152683.1|2818513_2819119_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_012118093.1|2819253_2819763_-	intercompartmental signaling factor BofC	NA	NA	NA	NA	NA
WP_071181874.1|2819895_2820135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014721606.1|2820147_2820741_-	YhcN/YlaJ family sporulation lipoprotein	NA	NA	NA	NA	NA
WP_071181875.1|2820888_2822094_-|coat	SafA/ExsA family spore coat assembly protein	coat	NA	NA	NA	NA
WP_071181876.1|2822220_2823324_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_071181877.1|2823325_2824174_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_071181878.1|2824155_2825721_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_017418243.1|2825827_2826979_+	IscS subfamily cysteine desulfurase	NA	A0A141ZJV0	Faustovirus	29.6	2.3e-30
WP_014418541.1|2827028_2827571_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_003152668.1|2827596_2828454_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_007408173.1|2828467_2828911_-	transcriptional regulator ThrR	NA	NA	NA	NA	NA
WP_017418244.1|2828964_2830251_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_014418543.1|2830282_2830861_-	sporulation initiation phosphotransferase B	NA	NA	NA	NA	NA
WP_003152662.1|2831178_2831463_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_012118103.1|2831475_2831817_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003152660.1|2831819_2832128_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_017418245.1|2832273_2833140_-	M50 family metallopeptidase	NA	NA	NA	NA	NA
WP_017418246.1|2833132_2833936_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_003152655.1|2834063_2834867_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_003152653.1|2834869_2835550_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_007408167.1|2835603_2836122_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_016938781.1|2836118_2836982_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_003152647.1|2837012_2838026_-	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_164967575.1|2838702_2838852_-	PhrK family phosphatase-inhibitory pheromone	NA	Q9ZXD2	Bacillus_phage	91.9	1.8e-09
WP_071181879.1|2838852_2839965_-	tetratricopeptide repeat protein	NA	D6R410	Bacillus_phage	96.5	6.3e-203
WP_071181880.1|2840264_2841845_+	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	54.8	1.4e-67
WP_071181881.1|2841859_2842249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071181882.1|2842487_2843321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071181883.1|2843353_2844325_-	peptidoglycan-binding protein	NA	A0A218KC88	Bacillus_phage	69.7	1.2e-64
WP_013353490.1|2844372_2844795_-|holin	phage holin family protein	holin	D6R405	Bacillus_phage	87.9	2.7e-58
WP_071181884.1|2844845_2845034_-	XkdX family protein	NA	Q9ZXD9	Bacillus_phage	95.2	2.6e-29
WP_071181885.1|2845030_2845393_-	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	91.6	1.6e-54
WP_071181886.1|2845389_2846622_-|plate	phage baseplate upper protein	plate	D6R402	Bacillus_phage	84.6	9.9e-141
WP_071181887.1|2846634_2849199_-	peptidase G2	NA	D6R401	Bacillus_phage	57.1	5.9e-289
WP_071181888.1|2849249_2850953_-|tail	phage tail protein	tail	D6R400	Bacillus_phage	56.5	8.7e-180
WP_071181889.1|2850967_2851807_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	57.6	4.0e-93
WP_071181890.1|2851800_2856288_-|tail	phage tail tape measure protein	tail	A0A1Q1PVX7	Staphylococcus_phage	42.5	1.1e-64
WP_049627390.1|2856493_2856862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014418477.1|2856920_2857535_-|tail	tail protein	tail	A0A2H4J8F3	uncultured_Caudovirales_phage	33.9	1.1e-23
WP_049627391.1|2857549_2857933_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_014305139.1|2857929_2858328_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_071181891.1|2858324_2858642_-|head	phage head closure protein	head	A0A2H4JCB1	uncultured_Caudovirales_phage	34.3	4.2e-11
WP_071181892.1|2858631_2858934_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	40.5	6.8e-11
WP_046559943.1|2858951_2859359_-	phage protein	NA	D6R3Z0	Bacillus_phage	48.2	9.8e-13
WP_046559944.1|2859386_2860679_-|capsid	phage major capsid protein	capsid	A0A0A7RTL2	Clostridium_phage	47.8	1.7e-90
WP_071181893.1|2860717_2861344_-|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	77.2	1.1e-82
WP_015387940.1|2861306_2862587_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	63.3	3.4e-152
WP_071181894.1|2862775_2864485_-|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	62.6	2.1e-205
WP_071181895.1|2864481_2864997_-|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	45.2	2.0e-34
WP_015387938.1|2865223_2865589_-	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	54.2	7.9e-30
WP_015387937.1|2865578_2865947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071181896.1|2865994_2866309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071181897.1|2866305_2866587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071181898.1|2866733_2867177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071181899.1|2867193_2868069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046559952.1|2868209_2868422_-	helix-turn-helix domain-containing protein	NA	A0A1Z1LZP5	Bacillus_phage	45.0	8.4e-08
WP_164967576.1|2868677_2868827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019260088.1|2869250_2869628_-	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	99.2	9.0e-61
WP_071181901.1|2870141_2870657_-	hypothetical protein	NA	D6R425	Bacillus_phage	98.2	5.3e-96
WP_071181902.1|2870686_2871226_-	ERCC4 domain-containing protein	NA	Q9ZXC2	Bacillus_phage	99.4	3.8e-97
WP_071181903.1|2871222_2871660_-	hypothetical protein	NA	Q9ZXC3	Bacillus_phage	93.1	6.3e-74
WP_071181904.1|2871859_2874277_-	DNA primase	NA	D6R422	Bacillus_phage	93.1	0.0e+00
WP_046559959.1|2874338_2874776_-	DUF669 domain-containing protein	NA	Q9ZXC5	Bacillus_phage	96.6	1.1e-78
WP_071181905.1|2874796_2875108_-	hypothetical protein	NA	Q9ZXC6	Bacillus_phage	73.1	3.5e-34
WP_071181906.1|2875097_2876033_-	AAA family ATPase	NA	Q9ZXC7	Bacillus_phage	99.0	1.5e-173
WP_071181907.1|2876036_2876591_-	host-nuclease inhibitor Gam family protein	NA	Q9ZXC8	Bacillus_phage	95.7	2.6e-93
WP_071181908.1|2876792_2877062_-	hypothetical protein	NA	Q9ZXC9	Bacillus_phage	96.6	1.2e-43
WP_164967577.1|2877048_2877219_-	hypothetical protein	NA	Q9ZXD0	Bacillus_phage	96.4	3.0e-24
WP_046559963.1|2877287_2877560_-	helix-turn-helix transcriptional regulator	NA	D6R414	Bacillus_phage	100.0	2.3e-42
WP_046559964.1|2877821_2878256_+	helix-turn-helix transcriptional regulator	NA	Q786F1	Bacillus_phage	99.3	3.0e-68
WP_015968241.1|2878269_2878716_+	ImmA/IrrE family metallo-endopeptidase	NA	Q9T201	Bacillus_phage	100.0	2.4e-81
WP_015968240.1|2878761_2880186_+	recombinase family protein	NA	Q9T200	Bacillus_phage	100.0	1.5e-270
WP_071181909.1|2880637_2881207_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_071181910.1|2881347_2882349_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_071181911.1|2882475_2883228_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_025649688.1|2883368_2884661_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_017418286.1|2884719_2887362_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.3	2.8e-161
WP_003152639.1|2887814_2888006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025649689.1|2888020_2889043_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_025649690.1|2889076_2890960_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014418553.1|2891092_2892382_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_025649692.1|2892410_2893385_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_017418290.1|2893390_2894170_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_012118114.1|2894159_2895101_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_007408154.1|2895135_2895966_-	cytochrome c biogenesis protein	NA	NA	NA	NA	NA
WP_003152628.1|2895973_2897341_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_017418292.1|2897534_2898026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003152626.1|2898058_2898646_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_007612896.1|2898642_2900967_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	44.2	1.4e-183
WP_014418557.1|2901165_2902824_-|protease	ATP-dependent protease LonB	protease	A0A167RA83	Powai_lake_megavirus	32.7	1.9e-14
WP_007408149.1|2902974_2904237_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	65.3	4.2e-147
>prophage 12
NZ_CP017775	Bacillus velezensis strain 9912D chromosome, complete genome	4206167	3315341	3408329	4206167	capsid,integrase,protease,terminase,portal,transposase,tail,coat,holin,head,plate	Bacillus_phage(35.56%)	103	3349350:3349367	3386165:3386182
WP_087634931.1|3315341_3316358_-|coat	spore coat protein YutH	coat	NA	NA	NA	NA
WP_003151934.1|3316512_3317013_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	58.4	6.8e-40
WP_017419456.1|3317039_3317810_-	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_017419457.1|3317843_3318278_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_003151928.1|3318303_3318579_-	YutD family protein	NA	NA	NA	NA	NA
WP_003151923.1|3318796_3319693_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_071181957.1|3319894_3320872_+	M23 family metallopeptidase	NA	A0A1J0MFP9	Staphylococcus_phage	36.9	3.5e-08
WP_017419459.1|3320909_3321668_-	sporulation protein YunB	NA	NA	NA	NA	NA
WP_025650194.1|3321800_3323189_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_007613562.1|3323206_3324028_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_071181958.1|3324047_3324899_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_007408736.1|3324925_3325279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071181959.1|3325351_3326716_-	allantoinase	NA	NA	NA	NA	NA
WP_071181960.1|3326895_3328491_+	PucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071181961.1|3328628_3329546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071181962.1|3329662_3329857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071181963.1|3329889_3331086_-	MFS transporter	NA	A0A2H4UVM2	Bodo_saltans_virus	20.5	4.5e-05
WP_061862543.1|3331207_3332461_-	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_017418979.1|3332479_3333721_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_025650316.1|3333920_3334790_+	endonuclease	NA	NA	NA	NA	NA
WP_025650317.1|3334839_3335946_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	Q6GZ03	Mycoplasma_phage	46.1	7.3e-18
WP_014418812.1|3336101_3336830_+	transcriptional regulator PhoB	NA	NA	NA	NA	NA
WP_063637106.1|3336854_3337709_-	fructoselysine 6-kinase	NA	NA	NA	NA	NA
WP_063637105.1|3337722_3338607_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_023357120.1|3338610_3339489_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_025650319.1|3339525_3340791_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_025650320.1|3340864_3341851_-	SIS domain-containing protein	NA	A0A2L2DN46	Acanthamoeba_polyphaga_mimivirus	24.8	7.7e-11
WP_071181964.1|3342047_3342974_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071181965.1|3343007_3343598_-	sporulation delaying protein family toxin	NA	NA	NA	NA	NA
WP_017418970.1|3343590_3344535_-	membrane protein	NA	NA	NA	NA	NA
WP_017418969.1|3344531_3345062_-	SdpA family antimicrobial peptide system protein	NA	NA	NA	NA	NA
WP_007410095.1|3345187_3345460_+	DUF1648 domain-containing protein	NA	NA	NA	NA	NA
WP_007410094.1|3345498_3345873_-	nucleotide excision repair endonuclease	NA	NA	NA	NA	NA
WP_071181966.1|3345939_3347055_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_025650321.1|3347092_3347794_-	class I SAM-dependent methyltransferase	NA	A0A097BYE1	Leuconostoc_phage	28.0	1.6e-10
WP_071181967.1|3347867_3348329_+	DUF2691 family protein	NA	NA	NA	NA	NA
WP_029325847.1|3348465_3349302_+	chitosanase	NA	A0A223LHY0	Streptomyces_phage	31.4	3.4e-20
3349350:3349367	attL	ACCTTCCATTTCGAATTT	NA	NA	NA	NA
WP_071181968.1|3349745_3349988_-	helix-turn-helix domain-containing protein	NA	A0A2H4JDR0	uncultured_Caudovirales_phage	62.0	1.4e-19
WP_071181969.1|3350424_3351396_-	peptidoglycan-binding protein	NA	A0A218KC88	Bacillus_phage	65.3	1.3e-63
WP_071181970.1|3351441_3351864_-|holin	holin family protein	holin	D6R405	Bacillus_phage	98.5	2.3e-65
WP_064115584.1|3351915_3352104_-	XkdX family protein	NA	Q9ZXD9	Bacillus_phage	95.2	1.2e-29
WP_013353492.1|3352100_3352463_-	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	89.1	5.1e-53
WP_071181971.1|3352459_3353641_-|plate	phage baseplate upper protein	plate	D6R402	Bacillus_phage	73.4	4.5e-143
WP_071181972.1|3353653_3356218_-	peptidase G2	NA	D6R401	Bacillus_phage	56.9	4.7e-286
WP_017418250.1|3356250_3357969_-|tail	phage tail protein	tail	D6R400	Bacillus_phage	69.2	7.6e-224
WP_017418251.1|3357981_3358818_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	69.0	3.0e-109
WP_017418252.1|3358832_3362579_-|tail	phage tail tape measure protein	tail	A0A2H4JA91	uncultured_Caudovirales_phage	64.2	4.4e-107
WP_017418253.1|3362641_3362824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017418254.1|3362835_3363198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017418255.1|3363255_3363834_-	UDP-N-acetylmuramoylalanine--D-glutamate ligase	NA	J7KKC8	Streptococcus_phage	41.0	1.8e-31
WP_017418256.1|3363852_3364242_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_017418257.1|3364238_3364628_-	HK97 gp10 family phage protein	NA	I7A9A4	Enterococcus_phage	36.7	2.6e-10
WP_013353503.1|3364627_3364954_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_014472232.1|3364943_3365237_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JB77	uncultured_Caudovirales_phage	39.6	8.6e-11
WP_014472233.1|3365287_3365737_-	hypothetical protein	NA	D6R3Z0	Bacillus_phage	62.0	1.6e-11
WP_014472234.1|3365764_3366961_-|capsid	phage major capsid protein	capsid	A0A2H4J312	uncultured_Caudovirales_phage	49.7	2.2e-76
WP_047936177.1|3367009_3367606_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1J0MFL1	Staphylococcus_phage	53.6	4.7e-48
WP_047936178.1|3367598_3368825_-|portal	phage portal protein	portal	A0A2H4J331	uncultured_Caudovirales_phage	38.0	5.5e-67
WP_071181973.1|3368829_3369036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014472237.1|3369052_3370759_-|terminase	terminase large subunit	terminase	A0A2H4JC16	uncultured_Caudovirales_phage	42.4	2.4e-121
WP_014472238.1|3370751_3371246_-|terminase	phage terminase small subunit P27 family	terminase	A0A1Q1PVW3	Staphylococcus_phage	35.5	2.6e-20
WP_013353512.1|3372330_3372711_-	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	75.6	1.0e-43
WP_041915583.1|3372707_3374063_-	DEAD/DEAH box helicase	NA	S5MA26	Brevibacillus_phage	66.3	1.4e-180
WP_071181974.1|3374022_3374337_-	VRR-NUC domain-containing protein	NA	A0A2K5B272	Erysipelothrix_phage	57.8	2.4e-19
WP_079979764.1|3374619_3377034_-	hypothetical protein	NA	A0A0A7RTG3	Clostridium_phage	56.0	5.8e-278
WP_167555497.1|3377056_3377221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071181975.1|3377589_3379536_-	DNA polymerase	NA	S5M5X4	Brevibacillus_phage	67.2	7.5e-252
WP_071181976.1|3379532_3380084_-	hypothetical protein	NA	Q38587	Bacillus_phage	62.8	4.0e-25
WP_071181977.1|3380143_3380713_-	DUF2815 family protein	NA	S5MC21	Brevibacillus_phage	75.4	6.1e-77
WP_013353518.1|3380743_3381922_-	DUF2800 domain-containing protein	NA	S5MUB5	Brevibacillus_phage	61.4	1.5e-133
WP_013353519.1|3381918_3382314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353520.1|3382326_3382728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041481670.1|3382918_3383188_-	hypothetical protein	NA	Q9ZXC9	Bacillus_phage	47.7	1.3e-18
WP_164848962.1|3383184_3383331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353523.1|3383574_3383760_-	helix-turn-helix transcriptional regulator	NA	A0A0M3ULF9	Bacillus_phage	68.9	6.8e-14
WP_013353524.1|3384028_3384457_+	helix-turn-helix transcriptional regulator	NA	Q5YAA4	Bacillus_phage	58.9	6.9e-41
WP_041481672.1|3384465_3384888_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0S2SXM3	Bacillus_phage	60.9	8.0e-42
WP_013353525.1|3384932_3386090_+|integrase	site-specific integrase	integrase	S5MBZ0	Brevibacillus_phage	67.8	2.6e-151
WP_007410090.1|3386152_3387550_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
3386165:3386182	attR	ACCTTCCATTTCGAATTT	NA	NA	NA	NA
WP_003151877.1|3387569_3388013_-	iron-sulfur cluster assembly scaffold protein SufU	NA	A0A2P1CJL8	Mycobacterium_phage	39.4	1.8e-15
WP_014418823.1|3388002_3389223_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	48.6	4.0e-118
WP_017418965.1|3389222_3390536_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_003151872.1|3390553_3391339_-	Fe-S cluster assembly ATPase SufC	NA	W8CYL7	Bacillus_phage	23.6	6.5e-05
WP_003151857.1|3391515_3391668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017418963.1|3392331_3393147_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014418826.1|3393160_3393829_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_071181978.1|3393821_3394847_-	methionine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.0	2.2e-32
WP_007410085.1|3395170_3395521_-	SCP2 sterol-binding domain-containing protein	NA	NA	NA	NA	NA
WP_071181979.1|3395617_3395938_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_017418962.1|3395940_3396306_-	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_003151845.1|3396375_3396612_-	YusG family protein	NA	NA	NA	NA	NA
WP_003151844.1|3396666_3397050_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_003151843.1|3397109_3397466_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	51.9	2.9e-21
WP_017418961.1|3397579_3399364_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_017418960.1|3399383_3400559_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_071181980.1|3400569_3402939_-	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_003151836.1|3403129_3403270_+	YuzL family protein	NA	NA	NA	NA	NA
WP_017418958.1|3403299_3404208_-	proline dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003151832.1|3404297_3404555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017418957.1|3404566_3404899_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003151828.1|3405037_3405499_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_063637101.1|3405519_3407115_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_094246999.1|3407178_3408329_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.9	2.7e-39
>prophage 13
NZ_CP017775	Bacillus velezensis strain 9912D chromosome, complete genome	4206167	3889151	3941166	4206167	lysis,coat,holin,transposase	Bacillus_phage(36.36%)	58	NA	NA
WP_017418677.1|3889151_3890087_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	28.9	3.4e-24
WP_014419158.1|3890088_3890787_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.8	3.2e-35
WP_017418676.1|3890978_3891845_-	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_017418675.1|3891865_3892570_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_025649399.1|3892634_3893561_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	45.9	1.1e-43
WP_003150986.1|3893919_3894375_-	dTDP-4-dehydrorhamnose 3,5-epimerase family protein	NA	NA	NA	NA	NA
WP_025649400.1|3894371_3895220_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	37.3	7.0e-37
WP_025649401.1|3895240_3896188_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	42.6	2.3e-68
WP_025649402.1|3896190_3896928_-	NTP transferase domain-containing protein	NA	G3MA50	Bacillus_virus	42.7	5.0e-47
WP_071182051.1|3896955_3897960_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_014472356.1|3897961_3898702_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_013354002.1|3898694_3899816_-	N-acetylneuraminate synthase family protein	NA	NA	NA	NA	NA
WP_013354003.1|3899815_3900679_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013354004.1|3900679_3901849_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	NA	NA	NA	NA
WP_013354005.1|3901871_3903296_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_013354006.1|3903300_3904071_-	glycosyltransferase family 2 protein	NA	A0A0F7L2F7	uncultured_marine_virus	30.7	7.6e-06
WP_013354007.1|3904351_3904903_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
WP_013354008.1|3904949_3905321_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_013354009.1|3905384_3906704_-	purine/pyrimidine permease	NA	NA	NA	NA	NA
WP_013354010.1|3906722_3907145_-	YwdI family protein	NA	NA	NA	NA	NA
WP_013354011.1|3907203_3907887_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	44.7	3.2e-48
WP_071182052.1|3907901_3908708_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_017418661.1|3908793_3909321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017418660.1|3909365_3910001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003150960.1|3909993_3910332_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003150959.1|3910481_3911294_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_007407702.1|3911324_3911564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025649407.1|3911663_3913103_-	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	25.0	8.3e-22
WP_014419178.1|3913099_3914482_-	PTS sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_025649408.1|3914701_3915532_-	transcription antiterminator	NA	NA	NA	NA	NA
WP_017418658.1|3915555_3915870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025649409.1|3916395_3918807_+	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	36.8	3.8e-19
WP_017418656.1|3918848_3919850_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_099721935.1|3920091_3921241_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	59.7	1.1e-37
WP_017418655.1|3921302_3922052_-	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
WP_017418654.1|3922154_3923342_-	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_071182053.1|3923543_3924041_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_007614574.1|3924296_3924557_+	spore morphogenesis/germination protein YwcE	NA	NA	NA	NA	NA
WP_014419185.1|3924600_3924969_-	cytochrome aa3 quinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_003150930.1|3924970_3925585_-	cytochrome aa3 quinol oxidase subunit III	NA	NA	NA	NA	NA
WP_007614578.1|3925599_3927549_-	cytochrome aa3 quinol oxidase subunit I	NA	NA	NA	NA	NA
WP_012118744.1|3927576_3928542_-	cytochrome aa3 quinol oxidase subunit II	NA	NA	NA	NA	NA
WP_003150926.1|3929044_3929290_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_071182054.1|3929306_3930848_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_071182055.1|3930837_3932022_-	galactokinase	NA	NA	NA	NA	NA
WP_042635745.1|3932073_3932460_-	GtrA family protein	NA	NA	NA	NA	NA
WP_014419191.1|3932539_3933163_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003150917.1|3933498_3933660_+	anti-repressor SinI family protein	NA	NA	NA	NA	NA
WP_014306063.1|3933877_3934558_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_025649415.1|3934557_3935232_+	streptomycin biosynthesis protein StrF	NA	NA	NA	NA	NA
WP_025649416.1|3935252_3935855_-	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_021494738.1|3935942_3937199_-	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_003150911.1|3937217_3937412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063636529.1|3937613_3938288_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_071182056.1|3938284_3939103_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_003150908.1|3939105_3940014_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_007407725.1|3940120_3940507_+|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
WP_017418642.1|3940488_3941166_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
>prophage 1
NZ_CP017776	Bacillus velezensis strain 9912D plasmid p9912D, complete sequence	35409	7385	33325	35409	tail,capsid,portal,terminase	Bacillus_phage(66.67%)	41	NA	NA
WP_061046993.1|7385_10025_-|tail	phage tail protein	tail	Q5YA57	Bacillus_phage	45.8	2.9e-113
WP_071182138.1|10040_10766_-|tail	phage tail family protein	tail	A0A1B1P894	Bacillus_phage	37.9	1.7e-28
WP_061046970.1|10762_13411_-|tail	phage tail tape measure protein	tail	A0A0S2SXL7	Bacillus_phage	58.8	3.2e-104
WP_061046971.1|13412_14057_-	hypothetical protein	NA	A0A1B1P868	Bacillus_phage	41.4	2.0e-23
WP_061046972.1|14064_14454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061046973.1|14511_14799_-	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
WP_076983588.1|15007_15304_-	fibronectin type III domain-containing protein	NA	Q0PDK9	Bacillus_phage	61.7	7.1e-21
WP_061046974.1|15263_15725_-	hypothetical protein	NA	I1TLE8	Bacillus_phage	39.0	6.1e-19
WP_061046975.1|15737_16127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048367517.1|16136_16484_-	hypothetical protein	NA	B5LPR8	Bacillus_virus	47.0	8.6e-26
WP_061046976.1|16480_16819_-	hypothetical protein	NA	I1TLE5	Bacillus_phage	39.8	1.8e-15
WP_061046977.1|16811_17213_-	hypothetical protein	NA	A0A1B1P889	Bacillus_phage	41.8	4.1e-19
WP_061046978.1|17228_17492_-	hypothetical protein	NA	A0A1B1P891	Bacillus_phage	54.7	1.7e-10
WP_071182139.1|17504_17828_-	fibronectin type III domain-containing protein	NA	Q0PDK9	Bacillus_phage	72.6	9.5e-27
WP_061046979.1|17760_18663_-	hypothetical protein	NA	A0A1B1P885	Bacillus_phage	61.0	5.1e-102
WP_061046980.1|18676_19315_-	hypothetical protein	NA	B3GW02	Streptococcus_phage	43.2	1.6e-17
WP_155641728.1|19393_19534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071182140.1|19548_20664_-|capsid	phage minor capsid protein	capsid	A0A1B1P858	Bacillus_phage	43.4	3.9e-80
WP_061046981.1|20663_22175_-|portal	phage portal protein	portal	A0A1B1P863	Bacillus_phage	54.3	3.5e-140
WP_061046982.1|22187_23465_-|terminase	PBSX family phage terminase large subunit	terminase	D2XPX9	Bacillus_virus	70.8	1.6e-181
WP_061046983.1|23445_24093_-|terminase	terminase small subunit	terminase	A0A2K9V3C4	Faecalibacterium_phage	38.6	3.6e-17
WP_061046984.1|24285_24798_-	hypothetical protein	NA	A0A0A7AQW8	Bacillus_phage	35.8	2.3e-14
WP_061046985.1|25162_25507_-	hypothetical protein	NA	Q38579	Bacillus_phage	59.6	1.3e-29
WP_061046986.1|25774_26230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061046987.1|26253_26466_-	hypothetical protein	NA	A0A2H4JDM6	uncultured_Caudovirales_phage	52.9	8.7e-13
WP_053075460.1|26462_26915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061046988.1|26929_27370_-	hypothetical protein	NA	M1HNE7	Bacillus_virus	51.4	7.6e-27
WP_048367579.1|27375_27594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048367577.1|27639_28044_-	hypothetical protein	NA	W8CYU3	Bacillus_phage	40.5	2.6e-18
WP_048367575.1|28040_28226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048367618.1|28714_28990_-	hypothetical protein	NA	F8WQ59	Bacillus_phage	47.3	1.7e-16
WP_048367569.1|29022_29328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048367567.1|29327_29663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155641729.1|29941_30115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_175365358.1|30101_30278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048367565.1|30296_30746_-	single-stranded DNA-binding protein	NA	M5ABV5	Bacillus_phage	71.3	1.4e-52
WP_048367563.1|30739_31276_-	Holliday junction resolvase RecU	NA	Q0H273	Geobacillus_phage	53.4	6.2e-39
WP_048367561.1|31369_31606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048367559.1|31602_31821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048367555.1|32059_32722_-	ERF family protein	NA	A0A1J0MF78	Staphylococcus_phage	36.8	7.6e-31
WP_048367554.1|32725_33325_-	host-nuclease inhibitor Gam family protein	NA	D7RWM7	Brochothrix_phage	37.4	1.3e-24
