The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013483	Escherichia coli strain Y5 chromosome, complete genome	4839266	107178	197240	4839266	head,lysis,tRNA,plate,terminase,portal,capsid,integrase,holin,tail,protease	Escherichia_phage(44.68%)	95	116878:116914	206492:206528
WP_000187022.1|107178_108279_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_000806411.1|108318_108678_-	YijD family membrane protein	NA	NA	NA	NA	NA
WP_001309117.1|108677_109328_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_001120810.1|109658_111059_+	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
WP_001025939.1|111041_111959_-	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
WP_001230087.1|112225_113599_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_001352356.1|113659_114436_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_000935370.1|114443_115448_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_001298964.1|115601_116753_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
116878:116914	attL	CCGTAGGCCGGATAAGGCGCTCGCGCCGCATCCGGCA	NA	NA	NA	NA
WP_001005586.1|117350_120002_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_000556306.1|120183_121917_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_000274643.1|122131_122983_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000323841.1|122969_123311_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_000204105.1|123312_124191_-	[formate-C-acetyltransferase]-activating enzyme	NA	NA	NA	NA	NA
WP_000184811.1|124156_126454_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
WP_000161265.1|126504_126825_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_001004446.1|126839_127919_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001174079.1|128227_130729_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	7.9e-12
WP_000424840.1|130740_131403_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
WP_000374004.1|131413_132517_+	bifunctional L-1,2-propanediol dehydrogenase/glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_000647894.1|132791_133409_+	DUF1287 domain-containing protein	NA	NA	NA	NA	NA
WP_001271242.1|133435_134341_-	cystine transporter YijE	NA	NA	NA	NA	NA
WP_001295695.1|134433_136614_-	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_000007529.1|136942_137833_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_000110772.1|138181_140614_-	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_001295694.1|140616_141777_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_000852812.1|142053_142371_+	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_000797353.1|142554_143163_+	YiiX family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000710769.1|143223_143436_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001333520.1|143638_145837_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_000644904.1|145992_147018_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_000068828.1|147109_148069_+	cell division protein FtsN	NA	NA	NA	NA	NA
WP_000208242.1|148161_148692_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293341.1|148701_150033_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000139496.1|150099_151026_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|151118_151604_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|151688_151934_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|152358_153204_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_000136788.1|153226_154735_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250644.1|154869_155880_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796332.1|155976_156723_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000323547.1|156727_157156_-	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000655989.1|157182_157482_-	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000155257.1|157693_158134_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802214.1|158234_158834_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216327.1|158941_159709_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_001326656.1|159763_160519_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001045683.1|160625_161615_-	sulfate/thiosulfate ABC transporter substrate-binding protein Sbp	NA	NA	NA	NA	NA
WP_000591795.1|161934_162897_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001076742.1|163077_163980_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_000468308.1|164216_164435_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_047149168.1|164516_165680_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.7	6.3e-206
WP_000978897.1|165679_166159_-|tail	phage tail protein	tail	O64315	Escherichia_phage	100.0	5.1e-85
WP_047149169.1|166173_168621_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	96.3	0.0e+00
WP_000785970.1|168613_168733_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|168765_169041_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251405.1|169097_169616_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	99.4	5.5e-93
WP_001286716.1|169628_170819_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	100.0	1.6e-225
WP_016237189.1|170878_171061_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	96.9	1.6e-10
WP_141031840.1|171091_171598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047149170.1|171600_172011_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	47.6	2.5e-24
WP_071208494.1|172038_173151_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	86.4	8.0e-150
WP_001285340.1|173147_173759_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	100.0	1.7e-117
WP_047149171.1|173751_174660_-|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.3	3.4e-162
WP_000127163.1|174664_175012_-	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_047149172.1|175008_175644_-|plate	phage baseplate assembly protein V	plate	A0A0F7LBP2	Escherichia_phage	97.2	7.9e-110
WP_047149173.1|175710_176163_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	99.3	1.8e-76
WP_047149174.1|176155_176623_-|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.7	3.3e-81
WP_074153732.1|176585_176759_-|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	94.7	4.0e-24
WP_047149176.1|176730_177156_-|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	97.9	9.4e-67
WP_047149177.1|177143_177569_-	hypothetical protein	NA	A0A0F7LDU9	Escherichia_phage	96.5	4.2e-59
WP_001144101.1|177583_178081_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123123.1|178080_178362_-|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846399.1|178365_178569_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000988633.1|178568_179078_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_047149178.1|179177_179921_-|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	96.4	6.8e-121
WP_001719219.1|179924_180998_-|capsid	phage major capsid protein, P2 family	capsid	Q94MK7	Enterobacteria_phage	99.4	2.5e-201
WP_016237183.1|181056_181911_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MK3	Enterobacteria_phage	99.6	5.6e-135
WP_071208495.1|182084_183857_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	99.7	0.0e+00
WP_047149179.1|183856_184891_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.7	2.7e-200
WP_000559725.1|185306_186428_+	ParB N-terminal domain-containing protein	NA	Q858T2	Yersinia_virus	62.2	1.2e-97
WP_000142509.1|186417_187407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001143636.1|187414_188359_-	DNA cytosine methyltransferase	NA	Q7Y4B5	Escherichia_virus	76.1	2.5e-144
WP_047149180.1|188560_190837_-	replication endonuclease	NA	Q858T4	Yersinia_virus	97.9	0.0e+00
WP_000027664.1|190826_191102_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_001113264.1|191098_191323_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_001277900.1|191325_191625_-	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	98.0	7.1e-45
WP_000557698.1|191624_191849_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	97.3	5.2e-32
WP_000217670.1|191912_192413_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_001308179.1|192582_192855_-	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000777029.1|192991_193285_+	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_000985246.1|193354_194335_+|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
WP_001223800.1|194521_195022_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
WP_001033722.1|195171_195870_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|195866_197240_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
206492:206528	attR	TGCCGGATGCGGCGCGAGCGCCTTATCCGGCCTACGG	NA	NA	NA	NA
>prophage 2
NZ_CP013483	Escherichia coli strain Y5 chromosome, complete genome	4839266	468719	478733	4839266	integrase	Enterobacteria_phage(100.0%)	11	468214:468236	478894:478916
468214:468236	attL	TTTGGCGGAAGATCACAGGAGTC	NA	NA	NA	NA
WP_069905111.1|468719_471053_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	98.7	0.0e+00
WP_000856729.1|471067_471388_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000459298.1|471523_471979_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_001244664.1|471971_472259_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	98.9	5.1e-48
WP_032196530.1|472251_472806_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	80.2	4.0e-41
WP_001149160.1|472802_473069_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_032286762.1|473621_474356_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.0	1.5e-128
WP_000638635.1|474352_474853_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000446136.1|474926_475499_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.2	1.9e-94
WP_021570265.1|475760_477524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021570264.1|477557_478733_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	92.7	7.3e-210
478894:478916	attR	TTTGGCGGAAGATCACAGGAGTC	NA	NA	NA	NA
>prophage 3
NZ_CP013483	Escherichia coli strain Y5 chromosome, complete genome	4839266	878485	949242	4839266	protease,transposase,tRNA	uncultured_Mediterranean_phage(16.67%)	59	NA	NA
WP_000004473.1|878485_879433_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
WP_000114983.1|879447_879957_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.0e-19
WP_000228551.1|880086_881211_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_000460680.1|881182_881656_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_001129722.1|881684_882227_+	topoisomerase DNA-binding C4 zinc finger domain-containing protein	NA	NA	NA	NA	NA
WP_001301412.1|882231_882804_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_000451243.1|882808_883627_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_001070563.1|883623_883881_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_001286216.1|883856_884411_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_000343717.1|890598_891807_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	3.7e-47
WP_001300681.1|892540_893644_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000019655.1|893653_894835_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000738568.1|894902_895928_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	1.8e-71
WP_000825639.1|896358_896580_-	membrane protein	NA	NA	NA	NA	NA
WP_001273238.1|896832_899937_-	multidrug efflux RND transporter permease subunit AcrF	NA	NA	NA	NA	NA
WP_000654804.1|900967_901936_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.4	1.0e-185
WP_001129518.1|902570_903233_+	multidrug efflux transporter transcriptional repressor AcrS	NA	NA	NA	NA	NA
WP_001295275.1|903235_903415_-	DUF2556 family protein	NA	NA	NA	NA	NA
WP_001258895.1|903498_904383_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	1.9e-24
WP_000462905.1|904468_904765_-	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_001219652.1|904790_905756_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_001145827.1|906084_906966_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_001175728.1|906977_908429_-	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_000381173.1|908418_908661_-	YhdT family protein	NA	NA	NA	NA	NA
WP_000884639.1|908769_910119_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_000354622.1|910129_910600_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_001148481.1|911577_912552_-	oxidoreductase	NA	NA	NA	NA	NA
WP_001241469.1|912703_914644_+	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_000913396.1|914948_915992_+	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_000802511.1|916057_917161_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_000179409.1|917160_917649_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_000203105.1|917657_918251_+	nucleoside triphosphate pyrophosphatase YhdE	NA	NA	NA	NA	NA
WP_000123197.1|918240_919710_+	ribonuclease G	NA	NA	NA	NA	NA
WP_001253618.1|919777_923578_+	AsmA2 domain-containing protein YhdP	NA	NA	NA	NA	NA
WP_000055909.1|924007_925453_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_000440317.1|925586_926516_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_000051841.1|926698_926902_+	AaeX family protein	NA	NA	NA	NA	NA
WP_000854021.1|926909_927842_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_000510965.1|927847_929815_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_001029013.1|929906_930179_+	barstar family protein	NA	NA	NA	NA	NA
WP_000695690.1|930234_930498_-	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_001257846.1|930862_931333_-	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_001295272.1|931767_932706_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_000497723.1|932768_933836_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
WP_001295271.1|933925_935293_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
WP_001295270.1|935446_935845_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_001192332.1|936038_937166_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_000847559.1|937384_937813_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_000829818.1|937828_938221_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_000257293.1|938615_939254_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_000366129.1|939259_939757_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
WP_000467018.1|939799_941167_-	anaerobic C4-dicarboxylate transporter DcuC	NA	NA	NA	NA	NA
WP_000523845.1|941546_942338_+	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_000224714.1|942459_943353_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_000054239.1|944999_945689_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000209011.1|945685_946561_+	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000979882.1|946557_947022_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_072146727.1|947081_947942_-	YhcG family protein	NA	A0A0U2BZN7	Salmonella_phage	88.5	3.6e-73
WP_139371347.1|948029_949242_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
>prophage 4
NZ_CP013483	Escherichia coli strain Y5 chromosome, complete genome	4839266	1532642	1545825	4839266		Escherichia_phage(50.0%)	12	NA	NA
WP_001295182.1|1532642_1533404_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|1533397_1534024_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272592.1|1534163_1535303_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|1535365_1536358_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104441.1|1536451_1537816_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136934.1|1537904_1538681_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|1538685_1539324_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590403.1|1539320_1540583_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_000847984.1|1540579_1541488_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	5.1e-118
WP_001300386.1|1541683_1542451_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_001141322.1|1542501_1543158_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_001272928.1|1543263_1545825_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 5
NZ_CP013483	Escherichia coli strain Y5 chromosome, complete genome	4839266	2246568	2252997	4839266		Enterobacteria_phage(33.33%)	6	NA	NA
WP_029487813.1|2246568_2247975_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	1.1e-37
WP_029487815.1|2248198_2249263_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.1	1.2e-102
WP_023297950.1|2249289_2250159_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	5.7e-111
WP_029487820.1|2250190_2251081_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	32.9	1.8e-27
WP_023297948.1|2251095_2251650_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	5.0e-52
WP_029487822.1|2251830_2252997_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.5	9.1e-112
>prophage 6
NZ_CP013483	Escherichia coli strain Y5 chromosome, complete genome	4839266	3129340	3206168	4839266	head,tRNA,transposase,terminase,portal,capsid,integrase,holin,tail,protease	Escherichia_phage(42.0%)	92	3160587:3160601	3206270:3206284
WP_000343760.1|3129340_3130561_-|transposase	ISL3-like element ISKox3 family transposase	transposase	NA	NA	NA	NA
WP_001336523.1|3130975_3131887_+	hemolysin HlyE	NA	NA	NA	NA	NA
WP_000807626.1|3132093_3132555_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284280.1|3132631_3133291_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001295992.1|3133362_3133656_-	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_000695215.1|3133897_3134299_+	inhibitor of g-type lysozyme	NA	NA	NA	NA	NA
WP_001056840.1|3134401_3134770_-	YcgJ family protein	NA	NA	NA	NA	NA
WP_001301105.1|3135289_3135985_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|3136008_3136821_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|3136824_3137091_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_001131446.1|3137840_3137960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001325005.1|3137920_3138106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000122462.1|3138206_3138380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001304448.1|3138441_3138726_+	glycine zipper family protein	NA	NA	NA	NA	NA
WP_001065861.1|3142168_3142387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001246498.1|3142518_3144042_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_001065752.1|3144373_3144622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000888772.1|3144734_3145001_-	biofilm/acid-resistance regulator AriR	NA	NA	NA	NA	NA
WP_000858002.1|3145029_3145302_-	two-component-system connector protein YmgA	NA	NA	NA	NA	NA
WP_000554140.1|3145344_3145581_-	two-component-system connector protein YcgZ	NA	NA	NA	NA	NA
WP_001299269.1|3145894_3147106_+	blue light-responsive regulator BluF	NA	NA	NA	NA	NA
WP_000332303.1|3147310_3148042_+	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
WP_000373101.1|3148262_3148667_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_032082692.1|3148719_3148830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795380.1|3149065_3149110_+	protein YmgK	NA	NA	NA	NA	NA
WP_001295666.1|3149369_3149693_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
WP_000444488.1|3149795_3151046_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	3.2e-22
WP_001248681.1|3151217_3151871_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|3151880_3152342_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001297484.1|3152395_3153502_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|3153537_3154179_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423742.1|3154182_3155553_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001265471.1|3155721_3156393_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735412.1|3156392_3157853_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000456506.1|3157928_3159050_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359434.1|3159098_3160325_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|3160574_3161711_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
3160587:3160601	attL	AAAAAATTGAATAAA	NA	NA	NA	NA
WP_000799406.1|3161694_3162558_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000241001.1|3163112_3163781_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_042047081.1|3164018_3164549_-|tail	tail fiber domain-containing protein	tail	A0A2D1UII2	Escherichia_phage	85.2	2.5e-69
WP_139371347.1|3164550_3165763_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_001233546.1|3169154_3169754_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.0	1.6e-107
WP_000515345.1|3169821_3173301_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.9	0.0e+00
WP_000090843.1|3173361_3173970_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	1.9e-100
WP_001333568.1|3173906_3174650_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	4.5e-149
WP_001152457.1|3174655_3175354_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.0	3.4e-130
WP_001330090.1|3175353_3175710_-|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_000224003.1|3175687_3178915_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.0	0.0e+00
WP_000978926.1|3178961_3179240_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	95.7	5.3e-42
WP_000164661.1|3179263_3179635_-|tail	phage tail assembly chaperone	tail	A0A1B5FP91	Escherichia_phage	100.0	6.5e-64
WP_000097535.1|3179649_3180354_-	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	92.7	1.4e-112
WP_001206700.1|3180414_3180759_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	96.5	5.1e-55
WP_000968644.1|3180755_3181205_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	81.2	6.1e-64
WP_001147814.1|3181201_3181540_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
WP_000719064.1|3181548_3181866_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	49.5	5.3e-22
WP_000766109.1|3181942_3183160_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	5.9e-162
WP_000999828.1|3183174_3183774_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
WP_000923134.1|3183766_3184993_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	83.3	3.7e-204
WP_000811487.1|3184982_3185144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001140892.1|3185140_3186898_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
WP_001333563.1|3186897_3187380_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	98.1	8.7e-85
WP_001135104.1|3187527_3187878_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	96.6	8.0e-64
WP_000738421.1|3188403_3188697_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_075202333.1|3188787_3188970_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	77.0	2.2e-17
WP_000992097.1|3189186_3189720_-	lysozyme	NA	Q08J98	Stx2-converting_phage	93.2	1.5e-98
WP_000193264.1|3189783_3190134_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
WP_000372595.1|3190138_3190354_-|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_001333561.1|3190503_3190665_-	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	87.0	5.9e-14
WP_000874243.1|3190661_3190850_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
WP_001333560.1|3191110_3191446_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	1.4e-44
WP_001333559.1|3191516_3191729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106104550.1|3192217_3192304_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000762879.1|3192698_3193520_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.2	5.1e-77
WP_000139999.1|3193516_3193897_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	1.3e-35
WP_001221526.1|3193897_3194956_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.0	7.5e-89
WP_032155008.1|3194957_3195236_-	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
WP_000813254.1|3195403_3195559_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000753060.1|3196481_3196658_-	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	94.8	6.7e-27
WP_001224662.1|3196650_3196833_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_000403785.1|3196926_3197283_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
WP_001151150.1|3197340_3197763_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.6e-64
WP_001262390.1|3197803_3198874_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	56.6	2.6e-52
WP_000693850.1|3198945_3199371_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747951.1|3199354_3199597_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001420344.1|3199988_3200327_+	peptidase S24	NA	H9C160	Pectobacterium_phage	32.0	2.5e-06
WP_042046576.1|3200680_3200980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171946.1|3201051_3201270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854558.1|3201838_3202027_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001070255.1|3202023_3202215_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102136.1|3202308_3204750_+	exonuclease	NA	V5UQJ3	Shigella_phage	46.9	3.1e-114
WP_000003742.1|3204811_3205081_+	excisionase	NA	NA	NA	NA	NA
WP_000074971.1|3205049_3206168_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	44.4	1.6e-84
3206270:3206284	attR	AAAAAATTGAATAAA	NA	NA	NA	NA
>prophage 7
NZ_CP013483	Escherichia coli strain Y5 chromosome, complete genome	4839266	3779269	3807340	4839266	transposase,integrase	Escherichia_phage(50.0%)	29	3782255:3782314	3809916:3810738
WP_001300563.1|3779269_3780382_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000956455.1|3780458_3780611_-	type I toxin-antitoxin system toxin HokE	NA	NA	NA	NA	NA
WP_001130654.1|3781063_3782182_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
3782255:3782314	attL	ACGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGC	NA	NA	NA	NA
WP_001067855.1|3782319_3783024_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000219391.1|3783145_3784051_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|3784047_3785286_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|3785285_3785870_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|3786362_3787127_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000130000.1|3787353_3787659_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000184001.1|3787669_3788875_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000376616.1|3789030_3789234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|3789361_3790201_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|3790194_3790542_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001749986.1|3790764_3791217_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_004201164.1|3791957_3792770_+	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
WP_004201167.1|3792773_3793139_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_000050481.1|3793815_3795357_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|3795761_3796601_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|3796594_3796942_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001749986.1|3797164_3797617_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_004201164.1|3798357_3799170_+	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
WP_004201167.1|3799173_3799539_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_000050481.1|3800215_3801757_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|3802161_3803001_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|3802994_3803342_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001749985.1|3804325_3804799_-	trimethoprim-resistant dihydrofolate reductase DfrA27	NA	J9Q7T1	Salmonella_phage	33.3	2.4e-10
WP_001749986.1|3804931_3805384_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_063840321.1|3805480_3806035_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_000845048.1|3806326_3807340_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
3809916:3810738	attR	ACGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCG	NA	NA	NA	NA
>prophage 8
NZ_CP013483	Escherichia coli strain Y5 chromosome, complete genome	4839266	4076831	4219747	4839266	plate,transposase,integrase,holin,protease	Enterobacteria_phage(16.0%)	118	4092295:4092309	4128006:4128020
WP_088895425.1|4076831_4078060_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_120795374.1|4078309_4078384_-	protein YahV	NA	NA	NA	NA	NA
WP_000131044.1|4078689_4080723_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001335745.1|4080851_4081439_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089110.1|4081452_4082925_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159094.1|4082938_4084609_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_001209100.1|4084821_4085490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370307.1|4085732_4086428_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023927.1|4086420_4087848_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102108.1|4087858_4088578_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339594.1|4089104_4089959_-	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_071208564.1|4090184_4091510_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.4	3.6e-112
WP_000474084.1|4091618_4091855_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|4091866_4092460_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
4092295:4092309	attL	GGGTGACGCTCATCA	NA	NA	NA	NA
WP_000621009.1|4093049_4093901_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000662258.1|4098746_4098848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803998.1|4099211_4099475_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|4099474_4099615_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147279.1|4099649_4099877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301257.1|4100700_4101243_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|4101317_4101905_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|4101962_4102631_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131096.1|4102656_4105182_+	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_001360105.1|4106783_4107494_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|4107806_4108136_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|4108383_4108998_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070700.1|4109415_4110105_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643333.1|4110101_4111058_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000667026.1|4111054_4113253_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
WP_000121359.1|4113262_4114219_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111348.1|4114197_4114608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071208565.1|4114974_4117419_-	S8 family peptidase	NA	NA	NA	NA	NA
WP_045325788.1|4117437_4118421_-	ATP-binding protein	NA	A0A125SJ49	Acidianus_tailed_spindle_virus	28.4	2.7e-16
WP_001185343.1|4118767_4119040_-	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	41.1	8.3e-08
WP_045325784.1|4119045_4119597_-	phage polarity suppression protein	NA	NA	NA	NA	NA
WP_077889378.1|4119867_4120044_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	55.6	3.2e-05
WP_001605077.1|4120175_4120349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001567459.1|4120381_4120672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001023347.1|4120797_4121622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071208567.1|4121618_4122809_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	55.9	1.2e-122
WP_071208569.1|4124164_4125280_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_042047262.1|4125372_4126221_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000839267.1|4126305_4126503_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_042047259.1|4126514_4127003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042047257.1|4126999_4127377_-	toxin	NA	NA	NA	NA	NA
WP_001295723.1|4127466_4127835_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000692311.1|4127997_4128219_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	44.4	3.2e-10
4128006:4128020	attR	GGGTGACGCTCATCA	NA	NA	NA	NA
WP_001186774.1|4128281_4128758_-	RadC family protein	NA	NA	NA	NA	NA
WP_000849588.1|4128773_4129259_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	3.4e-12
WP_001234620.1|4129313_4130132_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	2.0e-44
WP_001119729.1|4130231_4130465_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_000581504.1|4130543_4130999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001315618.1|4131074_4133591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000820497.1|4133711_4136831_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_001407301.1|4137202_4138075_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000200813.1|4138338_4139895_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.9	2.2e-105
WP_020233939.1|4139891_4141118_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_020233940.1|4141239_4144356_+	HsdR family type I site-specific deoxyribonuclease	NA	NA	NA	NA	NA
WP_020233941.1|4144503_4145484_-|transposase	IS5 family transposase	transposase	A0A077SK28	Escherichia_phage	97.5	2.4e-182
WP_042047045.1|4145763_4146120_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_042047046.1|4146430_4147396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042047048.1|4147503_4149738_-	exopolygalacturonate lyase	NA	NA	NA	NA	NA
WP_000134162.1|4149739_4151254_-	MFS transporter	NA	NA	NA	NA	NA
WP_000497518.1|4151619_4151943_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000345753.1|4151997_4152798_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_001051733.1|4152830_4154000_-	oligogalacturonate lyase	NA	NA	NA	NA	NA
WP_000684813.1|4154240_4154879_+	RpiB/LacA/LacB family sugar-phosphate isomerase	NA	NA	NA	NA	NA
WP_000837747.1|4156004_4157075_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	42.2	5.1e-69
WP_001098396.1|4157345_4158617_+	maltoporin	NA	NA	NA	NA	NA
WP_000254058.1|4158753_4159068_-	PTS transporter subunit EIIB	NA	NA	NA	NA	NA
WP_042047120.1|4159131_4161189_-	beta-galactosidase	NA	NA	NA	NA	NA
WP_000819837.1|4161220_4162423_-	glycosyl hydrolase 53 family protein	NA	NA	NA	NA	NA
WP_000079398.1|4162427_4163279_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_000022200.1|4163289_4164597_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_000742442.1|4164659_4165892_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_016243364.1|4166248_4167358_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	35.0	3.3e-26
WP_000282099.1|4170083_4170647_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_042047126.1|4171505_4172939_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000270169.1|4173512_4173740_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001310566.1|4174432_4176064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310565.1|4176150_4176732_-	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	88.1	2.7e-96
WP_000893278.1|4177247_4178501_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
WP_001285288.1|4178512_4179616_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749863.1|4179903_4180959_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_000174677.1|4180997_4181399_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189532.1|4181456_4182701_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|4182792_4183251_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001292994.1|4183511_4184969_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001059892.1|4186066_4186519_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263489.1|4186528_4186927_-	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_000554758.1|4186929_4187223_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226164.1|4187274_4188330_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000207552.1|4188400_4189186_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001334802.1|4189130_4190870_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_000006255.1|4191093_4191591_-|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_000056849.1|4191766_4192516_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.5	9.0e-20
WP_000729703.1|4192725_4192986_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000615983.1|4192988_4193267_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|4193422_4194163_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333380.1|4194133_4194901_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|4195106_4195685_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973083.1|4195924_4198369_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_072262443.1|4198411_4198885_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118036.1|4199038_4199809_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000343717.1|4199994_4201203_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	3.7e-47
WP_001101839.1|4202739_4203132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000508724.1|4203109_4207342_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.1	6.4e-22
WP_032329316.1|4207417_4209559_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	2.4e-25
WP_001142958.1|4209768_4210287_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037397.1|4210981_4211482_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4211516_4211741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056989.1|4211791_4213267_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000611744.1|4213273_4213687_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393852.1|4213690_4215541_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348793.1|4215504_4216587_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113709.1|4216611_4217892_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|4217888_4218413_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246443.1|4218415_4219747_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 9
NZ_CP013483	Escherichia coli strain Y5 chromosome, complete genome	4839266	4555682	4596760	4839266	holin,transposase	Enterobacteria_phage(25.0%)	36	NA	NA
WP_000998013.1|4555682_4557068_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.1	1.9e-257
WP_000823241.1|4557306_4558665_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000555341.1|4559415_4559673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001283626.1|4561423_4561945_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_001068915.1|4561941_4562895_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_000188246.1|4562981_4565306_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_000879153.1|4565350_4566253_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000125175.1|4566249_4567248_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000684856.1|4567244_4568201_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000175457.1|4568201_4568969_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177057.1|4569526_4569784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160371899.1|4571248_4572091_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001333382.1|4572093_4573182_+	putative hexosyltransferase CapU	NA	NA	NA	NA	NA
WP_001333383.1|4573186_4574137_+	virulence factor VirK	NA	NA	NA	NA	NA
WP_001333384.1|4574201_4575146_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_000088357.1|4575326_4576466_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.5e-68
WP_001293435.1|4576619_4578617_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_000625669.1|4578679_4579957_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_085949416.1|4580236_4581399_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.2	2.0e-50
WP_000145481.1|4581465_4581684_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_049828170.1|4581734_4582124_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	99.2	1.9e-61
WP_139371347.1|4582202_4583415_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_000422112.1|4585014_4585947_-	RNA-directed DNA polymerase	NA	Q7M2A9	Enterobacteria_phage	29.4	1.8e-25
WP_000993028.1|4585948_4586917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001185344.1|4587562_4587835_-	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	44.9	6.3e-08
WP_000126947.1|4587840_4588392_-	Polarity suppression protein	NA	NA	NA	NA	NA
WP_001066218.1|4588388_4589132_-	septation initiation protein	NA	NA	NA	NA	NA
WP_000155331.1|4589532_4592205_-	TOPRIM and DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	34.6	4.1e-59
WP_001075579.1|4592201_4592585_-	DUF5375 family protein	NA	NA	NA	NA	NA
WP_001027153.1|4592581_4592866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001246998.1|4592897_4593257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001118612.1|4593249_4593426_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	55.6	4.2e-05
WP_000235891.1|4593613_4593799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000455467.1|4593895_4594126_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001066505.1|4594502_4595141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000343760.1|4595539_4596760_+|transposase	ISL3-like element ISKox3 family transposase	transposase	NA	NA	NA	NA
