The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017863	Campylobacter jejuni strain IF1100 chromosome, complete genome	1744171	883690	933368	1744171	integrase,plate,protease,tRNA	Phaeocystis_globosa_virus(25.0%)	37	890508:890525	935667:935684
WP_002870052.1|883690_884209_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_002853001.1|884307_884724_+	PepSY-like domain-containing protein	NA	NA	NA	NA	NA
WP_002886756.1|884732_886343_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	R4TQL5	Phaeocystis_globosa_virus	44.4	1.7e-71
WP_002870050.1|886346_887597_-|tRNA	tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))- methylthiotransferase MtaB	tRNA	NA	NA	NA	NA
WP_002852957.1|887593_889165_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_002852978.1|889161_890217_-	3-dehydroquinate synthase	NA	A0A0P0C619	Ostreococcus_mediterraneus_virus	35.0	5.7e-28
WP_002870049.1|890262_891663_-	potassium transporter TrkA	NA	NA	NA	NA	NA
890508:890525	attL	TTTGAGAATTTGGATTAT	NA	NA	NA	NA
WP_002912984.1|891692_892814_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	38.8	3.7e-70
WP_002912988.1|892815_893583_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_057036129.1|894520_895192_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_052786887.1|895618_895849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079865650.1|896556_897042_-	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_058001793.1|902039_903335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071305064.1|903410_903908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071305009.1|903951_904704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071305063.1|904693_906298_-	lysozyme	NA	NA	NA	NA	NA
WP_071305010.1|907215_907713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042635850.1|907832_908336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071305011.1|908454_908964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071305012.1|908964_910476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016818319.1|910617_910935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154021488.1|910942_912190_-	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_052813915.1|912935_913523_+	lysozyme	NA	A0A068CDE9	Acinetobacter_phage	38.1	3.1e-15
WP_002779560.1|913551_913911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071305013.1|914179_918112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002779664.1|919037_919937_-	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_071305015.1|919933_923461_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_002779662.1|923578_924094_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002869988.1|924343_925117_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_002779660.1|925113_926511_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002779659.1|926520_926967_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002779658.1|927092_928340_+	nucleobase:cation symporter	NA	NA	NA	NA	NA
WP_002779657.1|928408_928894_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002869989.1|928895_930350_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002779655.1|930352_930745_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_002779654.1|930741_932463_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_057991629.1|932459_933368_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
935667:935684	attR	ATAATCCAAATTCTCAAA	NA	NA	NA	NA
>prophage 2
NZ_CP017863	Campylobacter jejuni strain IF1100 chromosome, complete genome	1744171	1221720	1262940	1744171	integrase,portal,terminase,capsid,head,tail,tRNA	Campylobacter_phage(100.0%)	58	1219731:1219750	1232868:1232887
1219731:1219750	attL	AATCTTTAGAAATTTTAAAA	NA	NA	NA	NA
WP_002869671.1|1221720_1222899_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_079263611.1|1222898_1224134_-	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
WP_002869673.1|1224078_1225047_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_002853654.1|1225124_1226225_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_002787311.1|1226563_1227739_+|integrase	site-specific integrase	integrase	X2KXI6	Campylobacter_phage	100.0	1.7e-222
WP_002787309.1|1227735_1227942_-	helix-turn-helix domain-containing protein	NA	X2KXB9	Campylobacter_phage	100.0	4.8e-32
WP_002787307.1|1227943_1228297_-	hypothetical protein	NA	X2KRB4	Campylobacter_phage	100.0	2.1e-56
WP_002787306.1|1228314_1229070_-	site-specific DNA-methyltransferase	NA	X2KR14	Campylobacter_phage	100.0	9.6e-147
WP_002787304.1|1229047_1229314_-	hypothetical protein	NA	X2KLR9	Campylobacter_phage	100.0	4.7e-40
WP_002858334.1|1229297_1229669_-	hypothetical protein	NA	X2KQ09	Campylobacter_phage	100.0	1.2e-60
WP_011049924.1|1229669_1229894_-	hypothetical protein	NA	X2KXC3	Campylobacter_phage	100.0	4.1e-37
WP_002869676.1|1229902_1230664_-	hypothetical protein	NA	X2KQ45	Campylobacter_phage	99.5	4.0e-124
WP_002787295.1|1230600_1230915_-	hypothetical protein	NA	X2KR17	Campylobacter_phage	100.0	1.6e-50
WP_002787293.1|1230993_1231314_-	hypothetical protein	NA	X2KLS2	Campylobacter_phage	100.0	1.4e-51
WP_002787289.1|1231701_1231938_-	hypothetical protein	NA	X2KXC5	Campylobacter_phage	100.0	8.1e-36
WP_002787287.1|1231951_1232719_-	hypothetical protein	NA	X2KRC2	Campylobacter_phage	100.0	3.7e-138
WP_071305029.1|1232735_1233137_-	hypothetical protein	NA	X2KR21	Campylobacter_phage	97.4	1.1e-11
1232868:1232887	attR	TTTTAAAATTTCTAAAGATT	NA	NA	NA	NA
WP_002787283.1|1233141_1233372_-	hypothetical protein	NA	X2KLS5	Campylobacter_phage	100.0	5.0e-38
WP_002787281.1|1233337_1233601_-	hypothetical protein	NA	X2KQ17	Campylobacter_phage	100.0	4.1e-44
WP_002787279.1|1233657_1233945_-	hypothetical protein	NA	X2KXC8	Campylobacter_phage	100.0	2.4e-50
WP_071305030.1|1233997_1234729_-	DNA-binding protein	NA	X2KQ88	Campylobacter_phage	99.6	4.1e-126
WP_002788580.1|1235159_1235444_-	hypothetical protein	NA	X2KRM3	Campylobacter_phage	100.0	2.3e-40
WP_071305031.1|1235440_1235644_-	hypothetical protein	NA	X2KQ19	Campylobacter_phage	98.5	1.4e-28
WP_002870336.1|1235848_1236502_+	hypothetical protein	NA	X2KXC9	Campylobacter_phage	100.0	1.2e-113
WP_002870274.1|1236736_1237399_+	peptidase S24	NA	X2KRC9	Campylobacter_phage	100.0	4.2e-122
WP_071305066.1|1237404_1238013_+	DNA/RNA non-specific endonuclease	NA	X2KR27	Campylobacter_phage	93.1	2.0e-110
WP_002870263.1|1238029_1238311_+	hypothetical protein	NA	X2KLT3	Campylobacter_phage	100.0	9.3e-47
WP_002913413.1|1238324_1238522_-	hypothetical protein	NA	X2KQ22	Campylobacter_phage	100.0	4.4e-27
WP_002870261.1|1238439_1238859_-	hypothetical protein	NA	X2KXD3	Campylobacter_phage	100.0	2.9e-52
WP_071305032.1|1239087_1239549_-	hypothetical protein	NA	X2KRD2	Campylobacter_phage	99.3	3.2e-84
WP_002801920.1|1239597_1240881_-	hypothetical protein	NA	X2KRN1	Campylobacter_phage	100.0	1.3e-239
WP_002801918.1|1240877_1241249_-	DUF1353 domain-containing protein	NA	X2KRC3	Campylobacter_phage	100.0	9.7e-68
WP_002801917.1|1241238_1241703_-	hypothetical protein	NA	X2KM25	Campylobacter_phage	100.0	5.1e-74
WP_002789149.1|1241699_1242335_-	DUF4376 domain-containing protein	NA	X2KRD7	Campylobacter_phage	100.0	1.3e-96
WP_071305033.1|1242347_1242797_-	hypothetical protein	NA	X2KR34	Campylobacter_phage	98.7	1.5e-78
WP_057981352.1|1242798_1244364_-	hypothetical protein	NA	X2KLU0	Campylobacter_phage	99.4	5.3e-208
WP_002869967.1|1244356_1244989_-	hypothetical protein	NA	X2KQ29	Campylobacter_phage	100.0	6.0e-110
WP_002788295.1|1244985_1245303_-|head,tail	head-tail adaptor protein	head,tail	X2KXD7	Campylobacter_phage	100.0	9.2e-51
WP_002788293.1|1245315_1245753_-|head,tail	phage gp6-like head-tail connector protein	head,tail	X2KR38	Campylobacter_phage	100.0	1.8e-76
WP_002788291.1|1245749_1246001_-	hypothetical protein	NA	X2KLU2	Campylobacter_phage	100.0	3.7e-18
WP_002788288.1|1246011_1247178_-|capsid	phage major capsid protein	capsid	X2KQ31	Campylobacter_phage	100.0	2.8e-214
WP_002788287.1|1247194_1247752_-	peptidase	NA	X2KXE1	Campylobacter_phage	100.0	1.1e-96
WP_002788286.1|1247837_1248707_-	hypothetical protein	NA	X2KRE5	Campylobacter_phage	100.0	3.9e-168
WP_002800774.1|1248719_1254446_-	hypothetical protein	NA	X2KLJ2	Campylobacter_phage	100.0	0.0e+00
WP_002788283.1|1254505_1254844_+	hypothetical protein	NA	X2KLU6	Campylobacter_phage	100.0	1.6e-56
WP_002788282.1|1254835_1255051_-	hypothetical protein	NA	X2KXE3	Campylobacter_phage	100.0	2.2e-32
WP_002788281.1|1255131_1255488_-	hypothetical protein	NA	X2KRE9	Campylobacter_phage	100.0	1.8e-58
WP_002788279.1|1255484_1256465_-	hypothetical protein	NA	X2KR44	Campylobacter_phage	100.0	3.9e-180
WP_002869970.1|1256611_1256836_+	hypothetical protein	NA	X2KLV0	Campylobacter_phage	100.0	5.7e-31
WP_002869971.1|1256832_1257096_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	X2KQ37	Campylobacter_phage	100.0	2.9e-34
WP_002788276.1|1257083_1257434_-	hypothetical protein	NA	X2KXE7	Campylobacter_phage	100.0	7.3e-57
WP_002800770.1|1257434_1257977_-	hypothetical protein	NA	X2KRF4	Campylobacter_phage	100.0	5.7e-93
WP_002788272.1|1257973_1259146_-|portal	phage portal protein	portal	X2KR48	Campylobacter_phage	100.0	3.1e-216
WP_002913302.1|1259305_1259740_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	X2KLV2	Campylobacter_phage	100.0	2.4e-78
WP_002913304.1|1259794_1261420_-|terminase	terminase large subunit	terminase	X2KQ40	Campylobacter_phage	100.0	0.0e+00
WP_002913306.1|1261423_1262062_-|terminase	terminase	terminase	X2KXE9	Campylobacter_phage	100.0	1.9e-111
WP_002869973.1|1262312_1262663_-	HNH endonuclease	NA	X2KRF8	Campylobacter_phage	100.0	1.9e-65
WP_002788257.1|1262649_1262940_-	hypothetical protein	NA	X2KM44	Campylobacter_phage	97.4	2.6e-15
>prophage 3
NZ_CP017863	Campylobacter jejuni strain IF1100 chromosome, complete genome	1744171	1394076	1402540	1744171		Synechococcus_phage(57.14%)	9	NA	NA
WP_002903944.1|1394076_1394799_-	capsular polysaccharide biosynthesis protein	NA	E3SJ89	Synechococcus_phage	26.7	2.9e-15
WP_002903942.1|1394795_1396319_-	hypothetical protein	NA	B2ZYD9	Ralstonia_phage	27.5	5.3e-35
WP_014516848.1|1396315_1396714_-	capsule biosynthesis phosphatase	NA	A0A2K9L0P7	Tupanvirus	41.0	1.7e-09
WP_002903935.1|1396753_1398673_-	hypothetical protein	NA	E3SJ94	Synechococcus_phage	27.8	2.9e-06
WP_002903931.1|1398666_1400526_-	methyltransferase domain-containing protein	NA	M4QRS6	Synechococcus_phage	40.2	3.0e-56
WP_002826454.1|1400522_1400852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014516850.1|1400854_1401190_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_002903928.1|1401182_1401908_-	NTP transferase domain-containing protein	NA	A0A1D8KNV9	Synechococcus_phage	33.6	9.2e-30
WP_057981435.1|1401901_1402540_-	HAD family phosphatase	NA	M1I080	Acanthocystis_turfacea_Chlorella_virus	42.8	6.4e-35
>prophage 4
NZ_CP017863	Campylobacter jejuni strain IF1100 chromosome, complete genome	1744171	1586811	1617989	1744171	tail,integrase,transposase,terminase,plate,head	Campylobacter_phage(50.0%)	49	1586763:1586779	1617237:1617253
1586763:1586779	attL	TAAAGAATTAAAAGAAA	NA	NA	NA	NA
WP_071305051.1|1586811_1588929_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_002790751.1|1589017_1589875_+	AAA family ATPase	NA	A0A0M3LP72	Mannheimia_phage	31.2	9.6e-26
WP_002795448.1|1589871_1590063_+	DNA-directed RNA polymerase sigma-70 factor	NA	NA	NA	NA	NA
WP_002824157.1|1590059_1590245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002865075.1|1590300_1590732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002865074.1|1590805_1591144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071305052.1|1591339_1591825_+	host-nuclease inhibitor protein Gam	NA	A0A2K9VGT9	Faecalibacterium_phage	33.3	6.4e-19
WP_002791416.1|1591821_1592001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002791414.1|1592064_1592337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002791413.1|1592333_1592720_+	hypothetical protein	NA	D5GVQ0	Campylobacter_virus	56.4	2.7e-36
WP_002864977.1|1592834_1593014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002790255.1|1593010_1593439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002790256.1|1593490_1593682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002876205.1|1593668_1594148_+	hypothetical protein	NA	A7YGZ0	Campylobacter_phage	30.2	2.8e-06
WP_002870187.1|1594286_1595420_-	hypothetical protein	NA	A0A1C6ZDL9	Pseudomonas_phage	34.2	5.1e-27
WP_002913010.1|1595536_1596919_-	DUF935 family protein	NA	A0A0M3LRU4	Mannheimia_phage	23.2	6.3e-11
WP_002865465.1|1596915_1598442_-|terminase	phage terminase large subunit	terminase	A0A0M3LQB7	Mannheimia_phage	31.1	6.4e-49
WP_002790261.1|1598531_1598846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002784496.1|1598957_1599206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002784498.1|1599202_1599544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002878913.1|1599554_1599944_-	DUF882 domain-containing protein	NA	A0A1X9Q0V8	Human_gokushovirus	46.3	6.5e-22
WP_002790266.1|1599933_1600299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002790896.1|1600295_1600649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019108985.1|1600645_1600915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002790002.1|1600914_1601802_-|head	head protein	head	A0A2K9VH18	Faecalibacterium_phage	43.7	3.5e-63
WP_002790001.1|1601801_1602842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002865847.1|1602972_1603437_+	DUF1804 family protein	NA	NA	NA	NA	NA
WP_002869851.1|1603433_1604066_+|plate	phage baseplate assembly protein V	plate	V5YUM9	Pseudomonas_phage	35.5	7.1e-10
WP_002795238.1|1604074_1604266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002795239.1|1604262_1604553_+|plate	baseplate assembly protein	plate	Q8H9N4	Vibrio_phage	40.8	2.7e-09
WP_039332515.1|1604549_1605716_+|plate	baseplate assembly protein	plate	A0A1X9SH02	Bradyrhizobium_phage	26.0	1.5e-13
WP_039332513.1|1605813_1606434_+|tail	phage tail protein I	tail	A7YGG0	Campylobacter_phage	100.0	2.5e-60
WP_039332511.1|1606433_1607465_+|tail	phage tail protein	tail	A7YGF9	Campylobacter_phage	100.0	6.2e-189
WP_071305053.1|1607489_1607996_+	DUF4376 domain-containing protein	NA	A7YGA6	Campylobacter_phage	98.8	9.8e-87
WP_002938257.1|1607992_1608364_+	DUF1353 domain-containing protein	NA	A7YGH7	Campylobacter_phage	100.0	1.5e-68
WP_039332504.1|1608487_1609495_+	hypothetical protein	NA	A7YGZ7	Campylobacter_phage	99.4	1.1e-190
WP_071305054.1|1609513_1610704_+|tail	phage tail sheath family protein	tail	A7YG77	Campylobacter_phage	99.0	6.1e-196
WP_002865794.1|1610826_1611342_+|tail	tail protein	tail	A0A0F7LDZ1	Escherichia_phage	25.7	5.8e-10
WP_002789979.1|1611352_1611589_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_002870149.1|1611696_1611927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002870150.1|1611956_1613921_+|tail	phage tail tape measure protein	tail	A7YG97	Campylobacter_phage	30.3	7.1e-08
WP_002870151.1|1613922_1614297_+|tail	tail protein	tail	NA	NA	NA	NA
WP_002789964.1|1614289_1614481_+|tail	tail protein	tail	NA	NA	NA	NA
WP_002870152.1|1614474_1615443_+|tail	phage tail protein	tail	A0A219Y9Y2	Aeromonas_phage	26.8	4.3e-14
WP_071305055.1|1615544_1616360_+	DNA adenine methylase	NA	A7YGG5	Campylobacter_phage	99.6	1.2e-150
WP_002865289.1|1616387_1616675_-	hypothetical protein	NA	A7YGG4	Campylobacter_phage	100.0	1.9e-47
WP_002843339.1|1616754_1616949_-	hypothetical protein	NA	A7YG72	Campylobacter_phage	100.0	1.8e-28
WP_002865000.1|1616958_1617279_-	hypothetical protein	NA	A7YGI4	Campylobacter_phage	100.0	1.3e-52
1617237:1617253	attR	TTTCTTTTAATTCTTTA	NA	NA	NA	NA
WP_071305056.1|1617359_1617989_-	S24 family peptidase	NA	A7YG70	Campylobacter_phage	98.2	3.7e-59
