The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011319	Janthinobacterium sp. 1_2014MBL_MicDiv, complete genome	6453540	230557	238949	6453540	portal,tRNA	Escherichia_phage(42.86%)	9	NA	NA
WP_083411580.1|230557_231508_+|portal	phage portal protein	portal	E5E3X1	Burkholderia_phage	63.5	6.5e-116
WP_071321778.1|231504_231720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071321779.1|232419_233061_+	DUF4760 domain-containing protein	NA	A0A1B1P9E5	Acinetobacter_phage	31.4	7.2e-10
WP_071321780.1|233469_234150_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_071321781.1|234323_235343_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	47.1	1.6e-80
WP_071321782.1|235455_236340_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	32.7	6.8e-27
WP_071321783.1|236393_236939_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	54.1	1.4e-51
WP_071321784.1|236976_237870_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	64.0	3.2e-101
WP_071321785.1|237866_238949_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	50.2	2.1e-86
>prophage 2
NZ_CP011319	Janthinobacterium sp. 1_2014MBL_MicDiv, complete genome	6453540	1385239	1439866	6453540	head,plate,tail,integrase,transposase,portal,holin,terminase,capsid	Burkholderia_phage(36.36%)	61	1399420:1399439	1409402:1409421
WP_083411664.1|1385239_1386379_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_035820921.1|1386375_1386582_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_156894706.1|1386604_1386880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071322618.1|1386876_1387098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083411665.1|1387240_1389079_-	replication endonuclease	NA	A4JWW0	Burkholderia_virus	42.8	8.7e-109
WP_071322619.1|1389068_1389422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071322620.1|1389523_1389919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071322621.1|1390039_1390303_-	ogr/Delta-like zinc finger family protein	NA	A4JWR6	Burkholderia_virus	45.6	1.3e-13
WP_083411666.1|1390299_1390488_-	hypothetical protein	NA	A4PE59	Ralstonia_virus	55.6	1.7e-07
WP_071322622.1|1390536_1390734_-	hypothetical protein	NA	E5E3U0	Burkholderia_phage	60.4	3.4e-11
WP_071322623.1|1390744_1390948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083411667.1|1391028_1391478_+	helix-turn-helix transcriptional regulator	NA	A0A1S5NPU3	Burkholderia_phage	42.7	1.8e-23
WP_156894708.1|1391474_1391825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156894709.1|1391875_1392541_+	hypothetical protein	NA	A4PE55	Ralstonia_virus	28.7	1.8e-11
WP_071322624.1|1392572_1393817_-	phage late control D family protein	NA	K4PAY4	Burkholderia_phage	49.8	2.1e-82
WP_071322625.1|1393813_1394422_-	oxidoreductase	NA	A0A2H4JG54	uncultured_Caudovirales_phage	58.3	2.9e-37
WP_083411668.1|1394437_1397278_-|tail	phage tail protein	tail	A4PE52	Ralstonia_virus	50.7	2.9e-236
WP_071650284.1|1397308_1397422_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_071322627.1|1397430_1397739_-|tail	phage tail assembly protein	tail	E5E3Q1	Burkholderia_phage	54.8	3.1e-19
WP_071322628.1|1397776_1398286_-|tail	phage major tail tube protein	tail	E5E3U9	Burkholderia_phage	56.2	3.9e-51
WP_071322629.1|1398343_1399519_-|tail	phage tail sheath protein	tail	A0A2H4JCP8	uncultured_Caudovirales_phage	67.8	9.1e-152
1399420:1399439	attL	TGGCGATCAGGCCCAGCACG	NA	NA	NA	NA
WP_071322630.1|1399524_1399758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071322631.1|1399758_1401288_-	hypothetical protein	NA	M1TAS6	Escherichia_phage	43.5	5.3e-67
WP_071326286.1|1401284_1401884_-|tail	phage tail protein I	tail	A0A2H4JAU2	uncultured_Caudovirales_phage	62.4	2.1e-67
WP_071322632.1|1401897_1402809_-|plate	baseplate assembly protein	plate	A0A077K9X9	Ralstonia_phage	57.5	1.6e-79
WP_071322633.1|1402805_1403150_-	oxidoreductase	NA	E5E3V5	Burkholderia_phage	52.1	4.7e-24
WP_071322634.1|1403146_1403809_-|plate	phage baseplate assembly protein V	plate	A0A2H4JFJ8	uncultured_Caudovirales_phage	39.0	7.1e-29
WP_156894710.1|1403904_1404816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071322635.1|1404954_1405422_-	phage virion morphogenesis protein	NA	R4JJX8	Burkholderia_phage	50.0	3.5e-30
WP_071322636.1|1405418_1405907_-|tail	phage tail protein	tail	E5FFH7	Burkholderia_phage	52.7	6.6e-32
WP_156895015.1|1405890_1406352_-	lysozyme	NA	NA	NA	NA	NA
WP_071322638.1|1406399_1406960_-	hypothetical protein	NA	G0YQI3	Erwinia_phage	53.5	1.7e-44
WP_035820867.1|1406959_1407331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034778648.1|1407395_1407611_-	hypothetical protein	NA	A0A1I9KG34	Aeromonas_phage	46.6	4.7e-06
WP_071322639.1|1407610_1408114_-|head	head completion/stabilization protein	head	E5E3S2	Burkholderia_phage	49.1	7.6e-31
WP_071322640.1|1408221_1408938_-|integrase	integrase	integrase	A4PE31	Ralstonia_virus	45.7	4.2e-43
WP_071322641.1|1408937_1409957_-|capsid	phage major capsid protein, P2 family	capsid	E5E3W8	Burkholderia_phage	62.3	5.3e-116
1409402:1409421	attR	TGGCGATCAGGCCCAGCACG	NA	NA	NA	NA
WP_083411669.1|1410006_1410795_-|capsid	GPO family capsid scaffolding protein	capsid	E5FFI7	Burkholderia_phage	49.5	1.3e-58
WP_071326287.1|1410931_1412743_+|terminase	terminase ATPase subunit family protein	terminase	A4JWQ1	Burkholderia_virus	67.0	4.1e-236
WP_083411670.1|1412658_1413804_+|portal	phage portal protein	portal	K4NZV0	Burkholderia_phage	60.4	1.8e-128
WP_071322643.1|1413800_1414016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156894711.1|1414412_1414859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071322645.1|1414869_1415508_+	SOS response-associated peptidase	NA	A0A218MNF5	uncultured_virus	41.0	1.4e-37
WP_156894712.1|1415664_1417002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083411671.1|1417103_1417640_-	DUF4145 domain-containing protein	NA	Q7Y4L7	Streptococcus_phage	35.0	1.2e-13
WP_071322647.1|1418640_1418886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071326289.1|1419177_1420560_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_071322648.1|1421168_1423181_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_071322649.1|1423299_1423590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071322650.1|1423667_1424201_-|tail	phage tail protein	tail	A0A218M5J9	Arthrobacter_phage	28.6	3.5e-10
WP_071322651.1|1424237_1424771_-|tail	phage tail protein	tail	E3T4R8	Cafeteria_roenbergensis_virus	35.9	1.3e-17
WP_071322652.1|1424877_1425411_-|tail	phage tail protein	tail	E3T4R8	Cafeteria_roenbergensis_virus	34.9	7.8e-10
WP_083411672.1|1425638_1431167_+	autotransporter domain-containing protein	NA	G9FH37	Rhodococcus_phage	45.2	1.3e-09
WP_071322654.1|1431246_1432215_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_071322655.1|1432320_1433034_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_071322656.1|1433030_1433675_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_071322657.1|1433671_1434442_-	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_071322658.1|1434443_1435487_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_156894713.1|1435612_1436218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071322660.1|1436904_1438992_-	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_156894714.1|1439050_1439866_-|holin	choline dehydrogenase	holin	NA	NA	NA	NA
>prophage 3
NZ_CP011319	Janthinobacterium sp. 1_2014MBL_MicDiv, complete genome	6453540	4325421	4332389	6453540	plate,tail	Burkholderia_phage(50.0%)	9	NA	NA
WP_071324672.1|4325421_4325910_+|tail	phage tail protein	tail	E5FFH7	Burkholderia_phage	49.7	1.5e-31
WP_071324673.1|4325906_4326374_+	phage virion morphogenesis protein	NA	A0A2H4J927	uncultured_Caudovirales_phage	48.7	1.3e-32
WP_156894910.1|4326696_4327023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156894911.1|4327019_4328279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083411944.1|4328534_4328906_+	phage virion morphogenesis protein	NA	E5FFH6	Burkholderia_phage	49.6	7.3e-23
WP_156894912.1|4329046_4330297_+	DUF4427 domain-containing protein	NA	NA	NA	NA	NA
WP_071326613.1|4330477_4331140_+|plate	phage baseplate assembly protein V	plate	A0A2H4JFJ8	uncultured_Caudovirales_phage	39.9	2.5e-29
WP_071324676.1|4331136_4331481_+	oxidoreductase	NA	E5E3V5	Burkholderia_phage	50.4	1.8e-23
WP_071324677.1|4331477_4332389_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	52.2	5.9e-74
>prophage 4
NZ_CP011319	Janthinobacterium sp. 1_2014MBL_MicDiv, complete genome	6453540	4850067	4930714	6453540	head,plate,tail,integrase,portal,tRNA,terminase,capsid	Burkholderia_phage(26.47%)	80	4928834:4928857	4940840:4940863
WP_071325040.1|4850067_4850994_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_071326655.1|4851068_4853300_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_071325041.1|4853825_4856501_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_071325042.1|4856493_4857387_+	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	49.6	2.0e-66
WP_071325043.1|4857504_4857945_-	DUF695 domain-containing protein	NA	NA	NA	NA	NA
WP_156894934.1|4857989_4858649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083412178.1|4858800_4859667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156894935.1|4859883_4860762_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_071325047.1|4860776_4861967_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_071325048.1|4862073_4863075_-	PHB depolymerase family esterase	NA	NA	NA	NA	NA
WP_083411980.1|4863192_4865403_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_083411981.1|4865550_4866360_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_156895063.1|4866476_4867100_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_071325051.1|4867213_4868179_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_083411982.1|4868398_4869169_-	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	36.4	2.0e-14
WP_071325052.1|4869308_4869737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071325053.1|4869864_4870359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071325054.1|4870409_4870931_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_071325055.1|4870970_4871489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071325056.1|4871492_4872209_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_071325057.1|4872371_4873676_+	MFS transporter	NA	NA	NA	NA	NA
WP_083411983.1|4873733_4874162_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_071325059.1|4874597_4876178_+	isocitrate lyase	NA	NA	NA	NA	NA
WP_071325060.1|4876446_4877079_+	LysE family translocator	NA	NA	NA	NA	NA
WP_071325061.1|4877444_4879061_-	DUF2326 domain-containing protein	NA	NA	NA	NA	NA
WP_156894936.1|4879050_4879272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156894937.1|4879271_4880114_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_156894938.1|4880747_4884926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156894939.1|4885385_4886738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034760447.1|4886974_4887175_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_071325066.1|4887311_4888178_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_156894940.1|4889126_4889306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071325067.1|4889298_4890609_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1V0E8G8	Vibrio_phage	31.9	1.8e-63
WP_156894941.1|4891280_4891775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071325068.1|4892166_4892382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156894942.1|4892378_4893524_-|portal	phage portal protein	portal	K4NZV0	Burkholderia_phage	58.3	7.8e-124
WP_071326658.1|4893439_4895251_-|terminase	terminase ATPase subunit family protein	terminase	A4JWQ1	Burkholderia_virus	66.7	1.0e-234
WP_156894943.1|4895387_4896176_+|capsid	phage capsid protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	47.6	1.1e-57
WP_071325071.1|4896224_4897241_+|capsid	phage major capsid protein, P2 family	capsid	A4PE30	Ralstonia_virus	63.4	2.3e-119
WP_071325072.1|4897244_4897961_+|integrase	integrase	integrase	K4NX86	Burkholderia_phage	45.5	6.7e-41
WP_071325073.1|4898064_4898571_+|head	head completion/stabilization protein	head	E5E3S2	Burkholderia_phage	49.1	7.6e-31
WP_071325074.1|4898570_4898780_+|tail	phage tail protein	tail	A0A1W6JT40	Escherichia_phage	42.4	1.0e-05
WP_071325075.1|4898825_4899197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071325076.1|4899196_4899757_+	hypothetical protein	NA	A0A0E3JI96	Rhodoferax_phage	50.0	9.6e-43
WP_156895064.1|4899729_4900266_+	lysozyme	NA	NA	NA	NA	NA
WP_071325078.1|4900249_4900738_+|tail	phage tail protein	tail	E5FFH7	Burkholderia_phage	51.9	4.3e-31
WP_071325079.1|4900734_4901202_+	phage virion morphogenesis protein	NA	A0A2H4J927	uncultured_Caudovirales_phage	50.0	2.0e-33
WP_071325080.1|4901514_4902312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071325081.1|4902308_4903058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071325082.1|4903181_4903844_+|plate	phage baseplate assembly protein V	plate	A0A2H4JFJ8	uncultured_Caudovirales_phage	39.9	1.6e-28
WP_071325083.1|4903840_4904185_+	oxidoreductase	NA	E5E3V5	Burkholderia_phage	51.3	1.4e-23
WP_071325084.1|4904181_4905093_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	56.2	7.9e-79
WP_071326659.1|4905106_4905706_+|tail	phage tail protein I	tail	A0A2H4JAU2	uncultured_Caudovirales_phage	63.5	1.7e-61
WP_071325085.1|4905702_4907232_+	hypothetical protein	NA	M1TAS6	Escherichia_phage	43.8	4.0e-67
WP_156894944.1|4907232_4907466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071325086.1|4907471_4908647_+|tail	phage tail sheath protein	tail	A0A2H4JCP8	uncultured_Caudovirales_phage	67.3	4.5e-151
WP_071325087.1|4908697_4909207_+|tail	phage major tail tube protein	tail	R4JEU1	Burkholderia_phage	58.6	4.8e-49
WP_071325088.1|4909244_4909553_+|tail	phage tail assembly protein	tail	A4PE51	Ralstonia_virus	53.2	1.1e-19
WP_083411985.1|4909561_4909675_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	55.6	6.0e-05
WP_071325089.1|4909954_4912552_+	hypothetical protein	NA	A4PE52	Ralstonia_virus	42.8	2.1e-172
WP_071325090.1|4912567_4913176_+|tail	phage tail protein	tail	A0A2H4JG54	uncultured_Caudovirales_phage	58.3	2.9e-37
WP_071325091.1|4913172_4914435_+	phage late control D family protein	NA	K4PAY4	Burkholderia_phage	48.9	3.7e-82
WP_156894945.1|4914497_4915187_-	hypothetical protein	NA	A4PE55	Ralstonia_virus	34.4	7.5e-13
WP_083411986.1|4915288_4915714_-	helix-turn-helix transcriptional regulator	NA	K4NXA8	Burkholderia_phage	43.8	3.1e-25
WP_083411987.1|4916026_4916224_+	hypothetical protein	NA	E5E3U0	Burkholderia_phage	62.3	2.6e-11
WP_083411988.1|4916272_4916461_+	hypothetical protein	NA	A4PE59	Ralstonia_virus	57.4	1.7e-07
WP_071325093.1|4916457_4916721_+	ogr/Delta-like zinc finger family protein	NA	A4JWR6	Burkholderia_virus	45.7	5.7e-14
WP_071325094.1|4916841_4917243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071325095.1|4917344_4917563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071325096.1|4917562_4917988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083411989.1|4917939_4919757_+	replication endonuclease	NA	A4JWW0	Burkholderia_virus	41.2	4.6e-86
WP_071325098.1|4919807_4920014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083411990.1|4919997_4920231_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_083411991.1|4920214_4921267_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JDJ8	uncultured_Caudovirales_phage	30.4	1.6e-22
WP_156894946.1|4921599_4922685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071325101.1|4923145_4925152_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	39.4	7.3e-85
WP_071325102.1|4925460_4926075_+	YqhA family protein	NA	K4K6D8	Caulobacter_phage	31.1	1.3e-19
WP_071325103.1|4926186_4927731_+	fumarate hydratase	NA	NA	NA	NA	NA
WP_071325104.1|4927795_4928641_+	glutamate racemase	NA	NA	NA	NA	NA
4928834:4928857	attL	CCCCATCAGCCACCCCACAGAATA	NA	NA	NA	NA
WP_071325105.1|4928962_4930714_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_071325105.1|4928962_4930714_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
4940840:4940863	attR	CCCCATCAGCCACCCCACAGAATA	NA	NA	NA	NA
