The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015186	Corynebacterium pseudotuberculosis strain 36, complete genome	2403412	134882	158076	2403412	portal,capsid,head,integrase,protease	Corynebacterium_phage(96.43%)	31	131065:131077	139002:139014
131065:131077	attL	ACGGAATTGTTCT	NA	NA	NA	NA
WP_048653254.1|134882_135914_-	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	24.5	2.3e-18
WP_048653255.1|136443_137058_+	DUF433 domain-containing protein	NA	A0A1W6JRB2	Corynebacterium_phage	100.0	5.1e-114
WP_048653257.1|137510_138737_-|integrase	site-specific integrase	integrase	A0A1W6JRD7	Corynebacterium_phage	100.0	5.1e-238
WP_048653258.1|138905_139745_-	DUF3037 domain-containing protein	NA	A0A1W6JRH2	Corynebacterium_phage	100.0	1.5e-153
139002:139014	attR	ACGGAATTGTTCT	NA	NA	NA	NA
WP_048653259.1|140662_140887_-	hypothetical protein	NA	A0A1W6JRB8	Corynebacterium_phage	100.0	2.3e-40
WP_155760557.1|140889_141036_-	hypothetical protein	NA	A0A1W6JRC4	Corynebacterium_phage	100.0	4.3e-19
WP_048653260.1|141317_141725_-	hypothetical protein	NA	A0A1W6JRC2	Corynebacterium_phage	100.0	4.5e-74
WP_048653261.1|141734_142226_-	hypothetical protein	NA	A0A1W6JRB0	Corynebacterium_phage	100.0	2.6e-84
WP_048653262.1|142343_142580_+	helix-turn-helix domain-containing protein	NA	A0A1W6JRC7	Corynebacterium_phage	100.0	3.1e-35
WP_048653263.1|142778_143048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048653264.1|143338_143812_+	hypothetical protein	NA	A0A1W6JRE9	Corynebacterium_phage	100.0	9.5e-84
WP_048653265.1|143838_144660_+	antirepressor	NA	A0A1W6JRI1	Corynebacterium_phage	100.0	9.8e-153
WP_048653266.1|144680_144878_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_048653267.1|144874_145108_+	hypothetical protein	NA	A0A1W6JRC8	Corynebacterium_phage	100.0	2.7e-39
WP_048653268.1|145131_145356_+	hypothetical protein	NA	A0A1W6JRD0	Corynebacterium_phage	100.0	6.1e-33
WP_048653269.1|145339_145657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048653270.1|145783_146530_+	hypothetical protein	NA	A0A1W6JRD1	Corynebacterium_phage	100.0	1.9e-134
WP_048653271.1|146687_147734_+	HNH endonuclease	NA	A0A1W6JRD2	Corynebacterium_phage	100.0	7.0e-196
WP_048653272.1|147964_148582_+	hypothetical protein	NA	A0A1W6JRC6	Corynebacterium_phage	100.0	2.6e-113
WP_003850222.1|148633_148951_+	hypothetical protein	NA	A0A1W6JRD4	Corynebacterium_phage	100.0	1.4e-51
WP_148660556.1|149067_149460_+	hypothetical protein	NA	A0A1W6JRH9	Corynebacterium_phage	100.0	1.6e-65
WP_048653273.1|151065_152307_+|portal	phage portal protein	portal	A0A1W6JRE1	Corynebacterium_phage	100.0	2.7e-239
WP_048653274.1|152303_153350_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1W6JRD9	Corynebacterium_phage	100.0	4.7e-200
WP_048653275.1|153346_154597_+|capsid	phage major capsid protein	capsid	A0A1W6JRF1	Corynebacterium_phage	100.0	6.8e-230
WP_048653276.1|154789_155272_+	hypothetical protein	NA	A0A1W6JRD8	Corynebacterium_phage	100.0	1.7e-88
WP_048653277.1|155268_155631_+	hypothetical protein	NA	A0A1W6JRD5	Corynebacterium_phage	100.0	2.2e-64
WP_048653278.1|155623_155890_+	hypothetical protein	NA	A0A1W6JRE6	Corynebacterium_phage	100.0	2.5e-41
WP_048653279.1|155879_156257_+	hypothetical protein	NA	A0A1W6JRI9	Corynebacterium_phage	100.0	1.9e-66
WP_048653280.1|156285_157233_+	hypothetical protein	NA	A0A1W6JRH0	Corynebacterium_phage	100.0	1.8e-179
WP_048653281.1|157327_157705_+	hypothetical protein	NA	A0A1W6JRK1	Corynebacterium_phage	100.0	3.6e-62
WP_048653282.1|157866_158076_+	hypothetical protein	NA	A0A1W6JRF2	Corynebacterium_phage	100.0	4.7e-35
>prophage 2
NZ_CP015186	Corynebacterium pseudotuberculosis strain 36, complete genome	2403412	163759	172779	2403412	holin	Corynebacterium_phage(100.0%)	10	NA	NA
WP_048653283.1|163759_164551_+	hypothetical protein	NA	A0A1W6JRF0	Corynebacterium_phage	100.0	3.6e-152
WP_048653284.1|164513_165374_+	hypothetical protein	NA	A0A1W6JRE8	Corynebacterium_phage	100.0	1.4e-149
WP_048653285.1|165374_166454_+	hypothetical protein	NA	A0A1W6JRE7	Corynebacterium_phage	100.0	5.2e-162
WP_053071070.1|166453_167830_+	hypothetical protein	NA	A0A1W6JRF8	Corynebacterium_phage	100.0	5.6e-193
WP_148660557.1|168278_168866_+	hypothetical protein	NA	A0A1W6JRH8	Corynebacterium_phage	100.0	8.3e-114
WP_048653287.1|168973_169711_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6JRK9	Corynebacterium_phage	100.0	1.9e-147
WP_081277226.1|169710_169950_+|holin	holin	holin	A0A1W6JRG0	Corynebacterium_phage	100.0	4.5e-34
WP_048653289.1|169952_170417_+	hypothetical protein	NA	A0A1W6JRF4	Corynebacterium_phage	100.0	1.6e-80
WP_048653290.1|170413_170752_+	hypothetical protein	NA	A0A1W6JRH1	Corynebacterium_phage	100.0	2.5e-54
WP_014654963.1|171096_172779_+	diphtheria toxin	NA	A0A1W6JRG3	Corynebacterium_phage	100.0	0.0e+00
>prophage 3
NZ_CP015186	Corynebacterium pseudotuberculosis strain 36, complete genome	2403412	1793320	1871024	2403412	bacteriocin,integrase,protease	Agrobacterium_phage(15.38%)	58	1840189:1840216	1846101:1846128
WP_048653450.1|1793320_1794607_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.1	6.7e-132
WP_014655697.1|1794767_1797572_-	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	34.5	2.8e-82
WP_013242459.1|1797648_1798278_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	43.5	1.4e-37
WP_013242460.1|1798293_1798893_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	48.3	1.3e-42
WP_014367463.1|1799103_1800456_-	trigger factor	NA	NA	NA	NA	NA
WP_014300878.1|1801243_1801486_+	hypothetical protein	NA	A0A1W6JRB8	Corynebacterium_phage	48.4	3.9e-09
WP_014523535.1|1801622_1802399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367466.1|1802485_1803496_-	pirin family protein	NA	NA	NA	NA	NA
WP_013242465.1|1803613_1804087_-	ribose-5-phosphate isomerase	NA	NA	NA	NA	NA
WP_014367467.1|1804153_1804774_-	DSBA oxidoreductase	NA	NA	NA	NA	NA
WP_014655699.1|1805107_1807723_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	29.7	5.9e-42
WP_071417248.1|1808144_1808723_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_014367472.1|1808841_1809234_+	globin	NA	NA	NA	NA	NA
WP_014655700.1|1809245_1810142_+	DMT family transporter	NA	NA	NA	NA	NA
WP_014655701.1|1810145_1810754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013242474.1|1810759_1811188_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_014522869.1|1811395_1813066_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L0W2	Tupanvirus	27.9	1.3e-47
WP_014523540.1|1814342_1816097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367477.1|1816093_1817632_+	YcaO-like family protein	NA	NA	NA	NA	NA
WP_014655705.1|1817658_1819137_+	nitroreductase	NA	NA	NA	NA	NA
WP_014655706.1|1819133_1821737_+	lantibiotic dehydratase	NA	NA	NA	NA	NA
WP_014367480.1|1821736_1822750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367481.1|1822746_1823727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014300888.1|1823765_1823942_+|bacteriocin	thiazolylpeptide-type bacteriocin	bacteriocin	NA	NA	NA	NA
WP_014655708.1|1824015_1825467_+	YcaO-like family protein	NA	NA	NA	NA	NA
WP_014367484.1|1825488_1826247_-	permease	NA	NA	NA	NA	NA
WP_014367485.1|1826243_1827167_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.1	4.2e-19
WP_048653452.1|1827257_1829303_-	bifunctional copper resistance protein CopD/cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_014655710.1|1829895_1832181_+	carbon starvation protein A	NA	NA	NA	NA	NA
WP_014401336.1|1832200_1832401_+	YbdD/YjiX family protein	NA	NA	NA	NA	NA
WP_014655711.1|1832741_1834568_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	31.8	5.2e-29
WP_048653453.1|1834843_1835839_+	oxidoreductase	NA	NA	NA	NA	NA
WP_048653454.1|1835965_1836769_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_014523548.1|1836834_1837494_+	oligoribonuclease	NA	M4M9I5	Vibrio_phage	35.0	8.4e-22
WP_014655714.1|1837673_1838501_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_014523549.1|1838554_1839745_-	L,D-transpeptidase	NA	NA	NA	NA	NA
1840189:1840216	attL	TTCGGGGTTCAAGTCCCTGATGGCGCAC	NA	NA	NA	NA
WP_052661840.1|1840363_1841497_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A249XT84	Mycobacterium_phage	30.6	2.4e-32
WP_148660561.1|1841948_1842887_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_081353085.1|1842949_1843759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014733042.1|1844839_1845397_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	46.7	3.1e-33
WP_014367502.1|1846440_1847439_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
1846101:1846128	attR	TTCGGGGTTCAAGTCCCTGATGGCGCAC	NA	NA	NA	NA
WP_014655718.1|1847638_1848193_+	isochorismatase family protein	NA	A0A2K9L2K0	Tupanvirus	32.6	5.2e-17
WP_014800825.1|1848201_1848546_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_014655719.1|1848667_1848943_-	DUF3618 domain-containing protein	NA	NA	NA	NA	NA
WP_013242499.1|1849031_1849511_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_013242500.1|1849548_1850202_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_048653457.1|1850214_1850604_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_014655721.1|1850734_1859833_-	type I polyketide synthase	NA	NA	NA	NA	NA
WP_014523551.1|1860057_1860363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014655722.1|1860523_1861639_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_014524035.1|1863516_1864275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014367512.1|1866044_1866491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013242510.1|1866578_1866938_+	DUF3817 domain-containing protein	NA	NA	NA	NA	NA
WP_014367514.1|1867005_1867629_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_032802570.1|1867625_1868360_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_014523555.1|1868398_1869166_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_048653459.1|1869238_1870132_-	glutamate racemase	NA	NA	NA	NA	NA
WP_048653460.1|1870205_1871024_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
>prophage 4
NZ_CP015186	Corynebacterium pseudotuberculosis strain 36, complete genome	2403412	2019741	2028202	2403412	holin	Pandoravirus(33.33%)	11	NA	NA
WP_048653473.1|2019741_2021490_+|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	31.7	1.5e-62
WP_014367622.1|2021467_2022136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014655796.1|2022143_2022530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014367624.1|2022526_2023042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013242641.1|2023052_2023499_-	DUF3180 domain-containing protein	NA	NA	NA	NA	NA
WP_014655798.1|2023495_2023951_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	S4W084	Pandoravirus	33.8	1.1e-09
WP_014655799.1|2023952_2024294_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_014523608.1|2024280_2025063_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.2	6.5e-21
WP_014367628.1|2025064_2025628_-	GTP cyclohydrolase I FolE	NA	A0A1W7AF02	Streptococcus_virus	57.8	2.6e-48
WP_014523609.1|2025620_2027624_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5EQU5	Bathycoccus_sp._RCC1105_virus	50.3	7.8e-111
WP_014300955.1|2027620_2028202_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	31.4	3.0e-15
