The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015187	Corynebacterium pseudotuberculosis strain 38, complete genome	2403515	145229	166862	2403515	portal,protease,integrase,head,capsid	Corynebacterium_phage(100.0%)	30	139046:139059	149212:149225
139046:139059	attL	ACAAGTGACGGCAA	NA	NA	NA	NA
WP_048653255.1|145229_145844_+	DUF433 domain-containing protein	NA	A0A1W6JRB2	Corynebacterium_phage	100.0	5.1e-114
WP_048653257.1|146296_147523_-|integrase	site-specific integrase	integrase	A0A1W6JRD7	Corynebacterium_phage	100.0	5.1e-238
WP_048653258.1|147691_148531_-	DUF3037 domain-containing protein	NA	A0A1W6JRH2	Corynebacterium_phage	100.0	1.5e-153
WP_048653259.1|149448_149673_-	hypothetical protein	NA	A0A1W6JRB8	Corynebacterium_phage	100.0	2.3e-40
149212:149225	attR	TTGCCGTCACTTGT	NA	NA	NA	NA
WP_155760557.1|149675_149822_-	hypothetical protein	NA	A0A1W6JRC4	Corynebacterium_phage	100.0	4.3e-19
WP_048653260.1|150103_150511_-	hypothetical protein	NA	A0A1W6JRC2	Corynebacterium_phage	100.0	4.5e-74
WP_048653261.1|150520_151012_-	hypothetical protein	NA	A0A1W6JRB0	Corynebacterium_phage	100.0	2.6e-84
WP_048653262.1|151129_151366_+	helix-turn-helix domain-containing protein	NA	A0A1W6JRC7	Corynebacterium_phage	100.0	3.1e-35
WP_048653263.1|151564_151834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048653264.1|152124_152598_+	hypothetical protein	NA	A0A1W6JRE9	Corynebacterium_phage	100.0	9.5e-84
WP_048653265.1|152624_153446_+	antirepressor	NA	A0A1W6JRI1	Corynebacterium_phage	100.0	9.8e-153
WP_048653266.1|153466_153664_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_048653267.1|153660_153894_+	hypothetical protein	NA	A0A1W6JRC8	Corynebacterium_phage	100.0	2.7e-39
WP_048653268.1|153917_154142_+	hypothetical protein	NA	A0A1W6JRD0	Corynebacterium_phage	100.0	6.1e-33
WP_048653269.1|154125_154443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048653270.1|154569_155316_+	hypothetical protein	NA	A0A1W6JRD1	Corynebacterium_phage	100.0	1.9e-134
WP_048653271.1|155473_156520_+	HNH endonuclease	NA	A0A1W6JRD2	Corynebacterium_phage	100.0	7.0e-196
WP_048653272.1|156750_157368_+	hypothetical protein	NA	A0A1W6JRC6	Corynebacterium_phage	100.0	2.6e-113
WP_003850222.1|157419_157737_+	hypothetical protein	NA	A0A1W6JRD4	Corynebacterium_phage	100.0	1.4e-51
WP_148660556.1|157853_158246_+	hypothetical protein	NA	A0A1W6JRH9	Corynebacterium_phage	100.0	1.6e-65
WP_048653273.1|159851_161093_+|portal	phage portal protein	portal	A0A1W6JRE1	Corynebacterium_phage	100.0	2.7e-239
WP_048653274.1|161089_162136_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1W6JRD9	Corynebacterium_phage	100.0	4.7e-200
WP_048653275.1|162132_163383_+|capsid	phage major capsid protein	capsid	A0A1W6JRF1	Corynebacterium_phage	100.0	6.8e-230
WP_048653276.1|163575_164058_+	hypothetical protein	NA	A0A1W6JRD8	Corynebacterium_phage	100.0	1.7e-88
WP_048653277.1|164054_164417_+	hypothetical protein	NA	A0A1W6JRD5	Corynebacterium_phage	100.0	2.2e-64
WP_048653278.1|164409_164676_+	hypothetical protein	NA	A0A1W6JRE6	Corynebacterium_phage	100.0	2.5e-41
WP_048653279.1|164665_165043_+	hypothetical protein	NA	A0A1W6JRI9	Corynebacterium_phage	100.0	1.9e-66
WP_048653280.1|165071_166019_+	hypothetical protein	NA	A0A1W6JRH0	Corynebacterium_phage	100.0	1.8e-179
WP_048653281.1|166113_166491_+	hypothetical protein	NA	A0A1W6JRK1	Corynebacterium_phage	100.0	3.6e-62
WP_048653282.1|166652_166862_+	hypothetical protein	NA	A0A1W6JRF2	Corynebacterium_phage	100.0	4.7e-35
>prophage 2
NZ_CP015187	Corynebacterium pseudotuberculosis strain 38, complete genome	2403515	172545	181565	2403515	holin	Corynebacterium_phage(100.0%)	10	NA	NA
WP_048653283.1|172545_173337_+	hypothetical protein	NA	A0A1W6JRF0	Corynebacterium_phage	100.0	3.6e-152
WP_048653284.1|173299_174160_+	hypothetical protein	NA	A0A1W6JRE8	Corynebacterium_phage	100.0	1.4e-149
WP_048653285.1|174160_175240_+	hypothetical protein	NA	A0A1W6JRE7	Corynebacterium_phage	100.0	5.2e-162
WP_053071070.1|175239_176616_+	hypothetical protein	NA	A0A1W6JRF8	Corynebacterium_phage	100.0	5.6e-193
WP_148660557.1|177064_177652_+	hypothetical protein	NA	A0A1W6JRH8	Corynebacterium_phage	100.0	8.3e-114
WP_048653287.1|177759_178497_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6JRK9	Corynebacterium_phage	100.0	1.9e-147
WP_081277226.1|178496_178736_+|holin	holin	holin	A0A1W6JRG0	Corynebacterium_phage	100.0	4.5e-34
WP_048653289.1|178738_179203_+	hypothetical protein	NA	A0A1W6JRF4	Corynebacterium_phage	100.0	1.6e-80
WP_048653290.1|179199_179538_+	hypothetical protein	NA	A0A1W6JRH1	Corynebacterium_phage	100.0	2.5e-54
WP_014654963.1|179882_181565_+	diphtheria toxin	NA	A0A1W6JRG3	Corynebacterium_phage	100.0	0.0e+00
>prophage 3
NZ_CP015187	Corynebacterium pseudotuberculosis strain 38, complete genome	2403515	1793561	1871264	2403515	protease,bacteriocin,integrase	Agrobacterium_phage(15.38%)	58	1840430:1840457	1846342:1846369
WP_048653450.1|1793561_1794848_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.1	6.7e-132
WP_014655697.1|1795008_1797813_-	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	34.5	2.8e-82
WP_013242459.1|1797889_1798519_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	43.5	1.4e-37
WP_013242460.1|1798534_1799134_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	48.3	1.3e-42
WP_014367463.1|1799344_1800697_-	trigger factor	NA	NA	NA	NA	NA
WP_014300878.1|1801484_1801727_+	hypothetical protein	NA	A0A1W6JRB8	Corynebacterium_phage	48.4	3.9e-09
WP_014523535.1|1801863_1802640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367466.1|1802726_1803737_-	pirin family protein	NA	NA	NA	NA	NA
WP_013242465.1|1803854_1804328_-	ribose-5-phosphate isomerase	NA	NA	NA	NA	NA
WP_014367467.1|1804394_1805015_-	DSBA oxidoreductase	NA	NA	NA	NA	NA
WP_014655699.1|1805348_1807964_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	29.7	5.9e-42
WP_071417248.1|1808385_1808964_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_014367472.1|1809082_1809475_+	globin	NA	NA	NA	NA	NA
WP_014655700.1|1809486_1810383_+	DMT family transporter	NA	NA	NA	NA	NA
WP_014655701.1|1810386_1810995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013242474.1|1811000_1811429_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_014522869.1|1811636_1813307_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L0W2	Tupanvirus	27.9	1.3e-47
WP_014523540.1|1814583_1816338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367477.1|1816334_1817873_+	YcaO-like family protein	NA	NA	NA	NA	NA
WP_014655705.1|1817899_1819378_+	nitroreductase	NA	NA	NA	NA	NA
WP_014655706.1|1819374_1821978_+	lantibiotic dehydratase	NA	NA	NA	NA	NA
WP_014367480.1|1821977_1822991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367481.1|1822987_1823968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014300888.1|1824006_1824183_+|bacteriocin	thiazolylpeptide-type bacteriocin	bacteriocin	NA	NA	NA	NA
WP_014655708.1|1824256_1825708_+	YcaO-like family protein	NA	NA	NA	NA	NA
WP_014367484.1|1825729_1826488_-	permease	NA	NA	NA	NA	NA
WP_014367485.1|1826484_1827408_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.1	4.2e-19
WP_048653452.1|1827498_1829544_-	bifunctional copper resistance protein CopD/cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_014655710.1|1830136_1832422_+	carbon starvation protein A	NA	NA	NA	NA	NA
WP_014401336.1|1832441_1832642_+	YbdD/YjiX family protein	NA	NA	NA	NA	NA
WP_014655711.1|1832982_1834809_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	31.8	5.2e-29
WP_048653453.1|1835084_1836080_+	oxidoreductase	NA	NA	NA	NA	NA
WP_048653454.1|1836206_1837010_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_014523548.1|1837075_1837735_+	oligoribonuclease	NA	M4M9I5	Vibrio_phage	35.0	8.4e-22
WP_014655714.1|1837914_1838742_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_014523549.1|1838795_1839986_-	L,D-transpeptidase	NA	NA	NA	NA	NA
1840430:1840457	attL	TTCGGGGTTCAAGTCCCTGATGGCGCAC	NA	NA	NA	NA
WP_052661840.1|1840604_1841738_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A249XT84	Mycobacterium_phage	30.6	2.4e-32
WP_148660561.1|1842189_1843128_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_081353085.1|1843190_1844000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014733042.1|1845080_1845638_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	46.7	3.1e-33
WP_014367502.1|1846681_1847680_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
1846342:1846369	attR	TTCGGGGTTCAAGTCCCTGATGGCGCAC	NA	NA	NA	NA
WP_014655718.1|1847879_1848434_+	isochorismatase family protein	NA	A0A2K9L2K0	Tupanvirus	32.6	5.2e-17
WP_014800825.1|1848442_1848787_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_014655719.1|1848907_1849183_-	DUF3618 domain-containing protein	NA	NA	NA	NA	NA
WP_013242499.1|1849271_1849751_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_013242500.1|1849788_1850442_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_048653457.1|1850454_1850844_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_014655721.1|1850974_1860073_-	type I polyketide synthase	NA	NA	NA	NA	NA
WP_014523551.1|1860297_1860603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014655722.1|1860763_1861879_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_014524035.1|1863756_1864515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014367512.1|1866284_1866731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013242510.1|1866818_1867178_+	DUF3817 domain-containing protein	NA	NA	NA	NA	NA
WP_014367514.1|1867245_1867869_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_032802570.1|1867865_1868600_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_014523555.1|1868638_1869406_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_048653459.1|1869478_1870372_-	glutamate racemase	NA	NA	NA	NA	NA
WP_048653460.1|1870445_1871264_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
>prophage 4
NZ_CP015187	Corynebacterium pseudotuberculosis strain 38, complete genome	2403515	2019849	2028310	2403515	holin	Pandoravirus(33.33%)	11	NA	NA
WP_048653473.1|2019849_2021598_+|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	31.7	1.5e-62
WP_014367622.1|2021575_2022244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014655796.1|2022251_2022638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014367624.1|2022634_2023150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013242641.1|2023160_2023607_-	DUF3180 domain-containing protein	NA	NA	NA	NA	NA
WP_014655798.1|2023603_2024059_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	S4W084	Pandoravirus	33.8	1.1e-09
WP_014655799.1|2024060_2024402_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_014523608.1|2024388_2025171_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.2	6.5e-21
WP_014367628.1|2025172_2025736_-	GTP cyclohydrolase I FolE	NA	A0A1W7AF02	Streptococcus_virus	57.8	2.6e-48
WP_014523609.1|2025728_2027732_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5EQU5	Bathycoccus_sp._RCC1105_virus	50.3	7.8e-111
WP_014300955.1|2027728_2028310_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	31.4	3.0e-15
