The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015188	Corynebacterium pseudotuberculosis strain 39, complete genome	2403579	145227	166860	2403579	protease,integrase,portal,capsid,head	Corynebacterium_phage(100.0%)	30	139044:139057	149210:149223
139044:139057	attL	ACAAGTGACGGCAA	NA	NA	NA	NA
WP_048653255.1|145227_145842_+	DUF433 domain-containing protein	NA	A0A1W6JRB2	Corynebacterium_phage	100.0	5.1e-114
WP_048653257.1|146294_147521_-|integrase	site-specific integrase	integrase	A0A1W6JRD7	Corynebacterium_phage	100.0	5.1e-238
WP_048653258.1|147689_148529_-	DUF3037 domain-containing protein	NA	A0A1W6JRH2	Corynebacterium_phage	100.0	1.5e-153
WP_048653259.1|149446_149671_-	hypothetical protein	NA	A0A1W6JRB8	Corynebacterium_phage	100.0	2.3e-40
149210:149223	attR	TTGCCGTCACTTGT	NA	NA	NA	NA
WP_155760557.1|149673_149820_-	hypothetical protein	NA	A0A1W6JRC4	Corynebacterium_phage	100.0	4.3e-19
WP_048653260.1|150101_150509_-	hypothetical protein	NA	A0A1W6JRC2	Corynebacterium_phage	100.0	4.5e-74
WP_048653261.1|150518_151010_-	hypothetical protein	NA	A0A1W6JRB0	Corynebacterium_phage	100.0	2.6e-84
WP_048653262.1|151127_151364_+	helix-turn-helix domain-containing protein	NA	A0A1W6JRC7	Corynebacterium_phage	100.0	3.1e-35
WP_048653263.1|151562_151832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048653264.1|152122_152596_+	hypothetical protein	NA	A0A1W6JRE9	Corynebacterium_phage	100.0	9.5e-84
WP_048653265.1|152622_153444_+	antirepressor	NA	A0A1W6JRI1	Corynebacterium_phage	100.0	9.8e-153
WP_048653266.1|153464_153662_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_048653267.1|153658_153892_+	hypothetical protein	NA	A0A1W6JRC8	Corynebacterium_phage	100.0	2.7e-39
WP_048653268.1|153915_154140_+	hypothetical protein	NA	A0A1W6JRD0	Corynebacterium_phage	100.0	6.1e-33
WP_048653269.1|154123_154441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048653270.1|154567_155314_+	hypothetical protein	NA	A0A1W6JRD1	Corynebacterium_phage	100.0	1.9e-134
WP_048653271.1|155471_156518_+	HNH endonuclease	NA	A0A1W6JRD2	Corynebacterium_phage	100.0	7.0e-196
WP_048653272.1|156748_157366_+	hypothetical protein	NA	A0A1W6JRC6	Corynebacterium_phage	100.0	2.6e-113
WP_003850222.1|157417_157735_+	hypothetical protein	NA	A0A1W6JRD4	Corynebacterium_phage	100.0	1.4e-51
WP_148660556.1|157851_158244_+	hypothetical protein	NA	A0A1W6JRH9	Corynebacterium_phage	100.0	1.6e-65
WP_048653273.1|159849_161091_+|portal	phage portal protein	portal	A0A1W6JRE1	Corynebacterium_phage	100.0	2.7e-239
WP_048653274.1|161087_162134_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1W6JRD9	Corynebacterium_phage	100.0	4.7e-200
WP_048653275.1|162130_163381_+|capsid	phage major capsid protein	capsid	A0A1W6JRF1	Corynebacterium_phage	100.0	6.8e-230
WP_048653276.1|163573_164056_+	hypothetical protein	NA	A0A1W6JRD8	Corynebacterium_phage	100.0	1.7e-88
WP_048653277.1|164052_164415_+	hypothetical protein	NA	A0A1W6JRD5	Corynebacterium_phage	100.0	2.2e-64
WP_048653278.1|164407_164674_+	hypothetical protein	NA	A0A1W6JRE6	Corynebacterium_phage	100.0	2.5e-41
WP_048653279.1|164663_165041_+	hypothetical protein	NA	A0A1W6JRI9	Corynebacterium_phage	100.0	1.9e-66
WP_048653280.1|165069_166017_+	hypothetical protein	NA	A0A1W6JRH0	Corynebacterium_phage	100.0	1.8e-179
WP_048653281.1|166111_166489_+	hypothetical protein	NA	A0A1W6JRK1	Corynebacterium_phage	100.0	3.6e-62
WP_048653282.1|166650_166860_+	hypothetical protein	NA	A0A1W6JRF2	Corynebacterium_phage	100.0	4.7e-35
>prophage 2
NZ_CP015188	Corynebacterium pseudotuberculosis strain 39, complete genome	2403579	172543	181563	2403579	holin	Corynebacterium_phage(100.0%)	10	NA	NA
WP_048653283.1|172543_173335_+	hypothetical protein	NA	A0A1W6JRF0	Corynebacterium_phage	100.0	3.6e-152
WP_048653284.1|173297_174158_+	hypothetical protein	NA	A0A1W6JRE8	Corynebacterium_phage	100.0	1.4e-149
WP_048653285.1|174158_175238_+	hypothetical protein	NA	A0A1W6JRE7	Corynebacterium_phage	100.0	5.2e-162
WP_053071070.1|175237_176614_+	hypothetical protein	NA	A0A1W6JRF8	Corynebacterium_phage	100.0	5.6e-193
WP_148660557.1|177062_177650_+	hypothetical protein	NA	A0A1W6JRH8	Corynebacterium_phage	100.0	8.3e-114
WP_048653287.1|177757_178495_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6JRK9	Corynebacterium_phage	100.0	1.9e-147
WP_081277226.1|178494_178734_+|holin	holin	holin	A0A1W6JRG0	Corynebacterium_phage	100.0	4.5e-34
WP_048653289.1|178736_179201_+	hypothetical protein	NA	A0A1W6JRF4	Corynebacterium_phage	100.0	1.6e-80
WP_048653290.1|179197_179536_+	hypothetical protein	NA	A0A1W6JRH1	Corynebacterium_phage	100.0	2.5e-54
WP_014654963.1|179880_181563_+	diphtheria toxin	NA	A0A1W6JRG3	Corynebacterium_phage	100.0	0.0e+00
>prophage 3
NZ_CP015188	Corynebacterium pseudotuberculosis strain 39, complete genome	2403579	1793566	1871269	2403579	protease,integrase,bacteriocin	Agrobacterium_phage(15.38%)	59	1840435:1840462	1846346:1846373
WP_048653450.1|1793566_1794853_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.1	6.7e-132
WP_014655697.1|1795013_1797818_-	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	34.5	2.8e-82
WP_013242459.1|1797894_1798524_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	43.5	1.4e-37
WP_013242460.1|1798539_1799139_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	48.3	1.3e-42
WP_014367463.1|1799349_1800702_-	trigger factor	NA	NA	NA	NA	NA
WP_014300878.1|1801489_1801732_+	hypothetical protein	NA	A0A1W6JRB8	Corynebacterium_phage	48.4	3.9e-09
WP_014523535.1|1801868_1802645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367466.1|1802731_1803742_-	pirin family protein	NA	NA	NA	NA	NA
WP_013242465.1|1803859_1804333_-	ribose-5-phosphate isomerase	NA	NA	NA	NA	NA
WP_014367467.1|1804399_1805020_-	DSBA oxidoreductase	NA	NA	NA	NA	NA
WP_014655699.1|1805353_1807969_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	29.7	5.9e-42
WP_071417248.1|1808390_1808969_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_014367472.1|1809087_1809480_+	globin	NA	NA	NA	NA	NA
WP_014655700.1|1809491_1810388_+	DMT family transporter	NA	NA	NA	NA	NA
WP_014655701.1|1810391_1811000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013242474.1|1811005_1811434_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_014522869.1|1811641_1813312_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L0W2	Tupanvirus	27.9	1.3e-47
WP_014523540.1|1814588_1816343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367477.1|1816339_1817878_+	YcaO-like family protein	NA	NA	NA	NA	NA
WP_014655705.1|1817904_1819383_+	nitroreductase	NA	NA	NA	NA	NA
WP_014655706.1|1819379_1821983_+	lantibiotic dehydratase	NA	NA	NA	NA	NA
WP_014367480.1|1821982_1822996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367481.1|1822992_1823973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014300888.1|1824011_1824188_+|bacteriocin	thiazolylpeptide-type bacteriocin	bacteriocin	NA	NA	NA	NA
WP_014655708.1|1824261_1825713_+	YcaO-like family protein	NA	NA	NA	NA	NA
WP_014367484.1|1825734_1826493_-	permease	NA	NA	NA	NA	NA
WP_014367485.1|1826489_1827413_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.1	4.2e-19
WP_048653452.1|1827503_1829549_-	bifunctional copper resistance protein CopD/cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_014655710.1|1830141_1832427_+	carbon starvation protein A	NA	NA	NA	NA	NA
WP_014401336.1|1832446_1832647_+	YbdD/YjiX family protein	NA	NA	NA	NA	NA
WP_014655711.1|1832987_1834814_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	31.8	5.2e-29
WP_048653453.1|1835089_1836085_+	oxidoreductase	NA	NA	NA	NA	NA
WP_048653454.1|1836211_1837015_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_014523548.1|1837080_1837740_+	oligoribonuclease	NA	M4M9I5	Vibrio_phage	35.0	8.4e-22
WP_014655714.1|1837919_1838747_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_014523549.1|1838800_1839991_-	L,D-transpeptidase	NA	NA	NA	NA	NA
1840435:1840462	attL	TTCGGGGTTCAAGTCCCTGATGGCGCAC	NA	NA	NA	NA
WP_052661840.1|1840609_1841743_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A249XT84	Mycobacterium_phage	30.6	2.4e-32
WP_148660561.1|1842194_1843133_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_081353085.1|1843195_1844005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014733042.1|1845085_1845643_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	46.7	3.1e-33
WP_071437099.1|1845985_1846216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014367502.1|1846685_1847684_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
1846346:1846373	attR	TTCGGGGTTCAAGTCCCTGATGGCGCAC	NA	NA	NA	NA
WP_014655718.1|1847883_1848438_+	isochorismatase family protein	NA	A0A2K9L2K0	Tupanvirus	32.6	5.2e-17
WP_014800825.1|1848446_1848791_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_014655719.1|1848912_1849188_-	DUF3618 domain-containing protein	NA	NA	NA	NA	NA
WP_013242499.1|1849276_1849756_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_013242500.1|1849793_1850447_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_048653457.1|1850459_1850849_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_014655721.1|1850979_1860078_-	type I polyketide synthase	NA	NA	NA	NA	NA
WP_014523551.1|1860302_1860608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014655722.1|1860768_1861884_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_014524035.1|1863761_1864520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014367512.1|1866289_1866736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013242510.1|1866823_1867183_+	DUF3817 domain-containing protein	NA	NA	NA	NA	NA
WP_014367514.1|1867250_1867874_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_032802570.1|1867870_1868605_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_014523555.1|1868643_1869411_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_048653459.1|1869483_1870377_-	glutamate racemase	NA	NA	NA	NA	NA
WP_048653460.1|1870450_1871269_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
>prophage 4
NZ_CP015188	Corynebacterium pseudotuberculosis strain 39, complete genome	2403579	2019917	2028378	2403579	holin	Pandoravirus(33.33%)	11	NA	NA
WP_048653473.1|2019917_2021666_+|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	31.7	1.5e-62
WP_014367622.1|2021643_2022312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014655796.1|2022319_2022706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014367624.1|2022702_2023218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013242641.1|2023228_2023675_-	DUF3180 domain-containing protein	NA	NA	NA	NA	NA
WP_014655798.1|2023671_2024127_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	S4W084	Pandoravirus	33.8	1.1e-09
WP_014655799.1|2024128_2024470_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_014523608.1|2024456_2025239_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.2	6.5e-21
WP_014367628.1|2025240_2025804_-	GTP cyclohydrolase I FolE	NA	A0A1W7AF02	Streptococcus_virus	57.8	2.6e-48
WP_014523609.1|2025796_2027800_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5EQU5	Bathycoccus_sp._RCC1105_virus	50.3	7.8e-111
WP_014300955.1|2027796_2028378_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	31.4	3.0e-15
