The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015189	Corynebacterium pseudotuberculosis strain 43, complete genome	2365075	1755067	1832773	2365075	protease,bacteriocin,integrase	Agrobacterium_phage(15.38%)	59	1801937:1801964	1807848:1807875
WP_048653450.1|1755067_1756354_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.1	6.7e-132
WP_014655697.1|1756514_1759319_-	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	34.5	2.8e-82
WP_013242459.1|1759395_1760025_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	43.5	1.4e-37
WP_013242460.1|1760040_1760640_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	48.3	1.3e-42
WP_014367463.1|1760850_1762203_-	trigger factor	NA	NA	NA	NA	NA
WP_014300878.1|1762991_1763234_+	hypothetical protein	NA	A0A1W6JRB8	Corynebacterium_phage	48.4	3.9e-09
WP_014523535.1|1763370_1764147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367466.1|1764233_1765244_-	pirin family protein	NA	NA	NA	NA	NA
WP_013242465.1|1765361_1765835_-	ribose-5-phosphate isomerase	NA	NA	NA	NA	NA
WP_014367467.1|1765901_1766522_-	DSBA oxidoreductase	NA	NA	NA	NA	NA
WP_014655699.1|1766855_1769471_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	29.7	5.9e-42
WP_071417248.1|1769892_1770471_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_014367472.1|1770589_1770982_+	globin	NA	NA	NA	NA	NA
WP_014655700.1|1770993_1771890_+	DMT family transporter	NA	NA	NA	NA	NA
WP_014655701.1|1771893_1772502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013242474.1|1772507_1772936_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_014522869.1|1773143_1774814_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L0W2	Tupanvirus	27.9	1.3e-47
WP_014523540.1|1776090_1777845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367477.1|1777841_1779380_+	YcaO-like family protein	NA	NA	NA	NA	NA
WP_014655705.1|1779406_1780885_+	nitroreductase	NA	NA	NA	NA	NA
WP_014655706.1|1780881_1783485_+	lantibiotic dehydratase	NA	NA	NA	NA	NA
WP_014367480.1|1783484_1784498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367481.1|1784494_1785475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014300888.1|1785513_1785690_+|bacteriocin	thiazolylpeptide-type bacteriocin	bacteriocin	NA	NA	NA	NA
WP_014655708.1|1785763_1787215_+	YcaO-like family protein	NA	NA	NA	NA	NA
WP_014367484.1|1787236_1787995_-	permease	NA	NA	NA	NA	NA
WP_014367485.1|1787991_1788915_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.1	4.2e-19
WP_048653452.1|1789005_1791051_-	bifunctional copper resistance protein CopD/cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_014655710.1|1791643_1793929_+	carbon starvation protein A	NA	NA	NA	NA	NA
WP_014401336.1|1793948_1794149_+	YbdD/YjiX family protein	NA	NA	NA	NA	NA
WP_014655711.1|1794489_1796316_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	31.8	5.2e-29
WP_048653453.1|1796591_1797587_+	oxidoreductase	NA	NA	NA	NA	NA
WP_048653454.1|1797713_1798517_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_014523548.1|1798582_1799242_+	oligoribonuclease	NA	M4M9I5	Vibrio_phage	35.0	8.4e-22
WP_014655714.1|1799421_1800249_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_014523549.1|1800302_1801493_-	L,D-transpeptidase	NA	NA	NA	NA	NA
1801937:1801964	attL	TTCGGGGTTCAAGTCCCTGATGGCGCAC	NA	NA	NA	NA
WP_052661840.1|1802111_1803245_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A249XT84	Mycobacterium_phage	30.6	2.4e-32
WP_148660561.1|1803696_1804635_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_081353085.1|1804697_1805507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014733042.1|1806587_1807145_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	46.7	3.1e-33
WP_071437099.1|1807487_1807718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014367502.1|1808187_1809186_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
1807848:1807875	attR	TTCGGGGTTCAAGTCCCTGATGGCGCAC	NA	NA	NA	NA
WP_014655718.1|1809385_1809940_+	isochorismatase family protein	NA	A0A2K9L2K0	Tupanvirus	32.6	5.2e-17
WP_014800825.1|1809948_1810293_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_014655719.1|1810414_1810690_-	DUF3618 domain-containing protein	NA	NA	NA	NA	NA
WP_013242499.1|1810778_1811258_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_013242500.1|1811295_1811949_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_048653457.1|1811961_1812351_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_014655721.1|1812481_1821580_-	type I polyketide synthase	NA	NA	NA	NA	NA
WP_014523551.1|1821804_1822110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014655722.1|1822270_1823386_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_014524035.1|1825264_1826023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014367512.1|1827792_1828239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013242510.1|1828326_1828686_+	DUF3817 domain-containing protein	NA	NA	NA	NA	NA
WP_014367514.1|1828754_1829378_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_032802570.1|1829374_1830109_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_014523555.1|1830147_1830915_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_048653459.1|1830987_1831881_-	glutamate racemase	NA	NA	NA	NA	NA
WP_048653460.1|1831954_1832773_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP015189	Corynebacterium pseudotuberculosis strain 43, complete genome	2365075	1981404	1989865	2365075	holin	Pandoravirus(33.33%)	11	NA	NA
WP_048653473.1|1981404_1983153_+|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	31.7	1.5e-62
WP_014367622.1|1983130_1983799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014655796.1|1983806_1984193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014367624.1|1984189_1984705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013242641.1|1984715_1985162_-	DUF3180 domain-containing protein	NA	NA	NA	NA	NA
WP_014655798.1|1985158_1985614_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	S4W084	Pandoravirus	33.8	1.1e-09
WP_014655799.1|1985615_1985957_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_014523608.1|1985943_1986726_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.2	6.5e-21
WP_014367628.1|1986727_1987291_-	GTP cyclohydrolase I FolE	NA	A0A1W7AF02	Streptococcus_virus	57.8	2.6e-48
WP_014523609.1|1987283_1989287_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5EQU5	Bathycoccus_sp._RCC1105_virus	50.3	7.8e-111
WP_014300955.1|1989283_1989865_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	31.4	3.0e-15
