The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017888	Bacillus coagulans strain BC-HY1 chromosome, complete genome	3599077	224565	230835	3599077		Streptococcus_phage(33.33%)	7	NA	NA
WP_061564966.1|224565_225513_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.4	3.7e-87
WP_014095823.1|226299_226758_+	8-oxo-dGTP diphosphatase	NA	K4F7D9	Cronobacter_phage	33.3	6.9e-07
WP_061564965.1|226794_227685_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.8	4.3e-05
WP_061564964.1|227681_228662_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	44.1	1.2e-67
WP_061564963.1|228740_229694_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.4	3.2e-54
WP_014095819.1|229893_230163_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_013858693.1|230244_230835_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	56.0	1.7e-53
>prophage 2
NZ_CP017888	Bacillus coagulans strain BC-HY1 chromosome, complete genome	3599077	388996	439403	3599077	transposase,integrase,protease,portal	Bacillus_phage(23.08%)	48	392103:392151	411461:411509
WP_071451820.1|388996_390307_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_071451821.1|390808_391198_+	hypothetical protein	NA	NA	NA	NA	NA
392103:392151	attL	TGATTCCGACTGGTCTCGAACCAGCGACCTCCACCCTGTCAAGGTGGCG	NA	NA	NA	NA
WP_071451822.1|392275_392863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071451823.1|392877_393216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071451824.1|393272_393518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071451825.1|393599_394220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081355888.1|394786_396055_-|portal	phage portal protein	portal	D7RWI5	Brochothrix_phage	23.2	6.4e-10
WP_081355887.1|396179_397625_-	DNA packaging protein	NA	A0A2I7RNR6	Vibrio_phage	26.8	5.6e-26
WP_071451828.1|397825_398221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155759646.1|398217_398376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071451829.1|398499_399423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071451830.1|399960_400182_-	hypothetical protein	NA	A0A0H3UZE3	Geobacillus_virus	47.5	5.1e-08
WP_071451831.1|400286_401207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071451832.1|401326_401506_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071451833.1|401583_402447_-	DUF5309 domain-containing protein	NA	NA	NA	NA	NA
WP_071451834.1|402513_402939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155759647.1|402931_403099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071451835.1|403118_403394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071451836.1|403386_404703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071451837.1|404717_405071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071451838.1|406537_407848_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013858128.1|408251_409562_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_071451839.1|410007_410319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081355850.1|410308_410422_-	DNA-binding anti-repressor SinI	NA	NA	NA	NA	NA
WP_081355851.1|410425_411340_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	25.9	9.2e-27
WP_026683808.1|411653_412535_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
411461:411509	attR	TGATTCCGACTGGTCTCGAACCAGCGACCTCCACCCTGTCAAGGTGGCG	NA	NA	NA	NA
WP_017552126.1|412851_414075_+	acetate kinase	NA	NA	NA	NA	NA
WP_017552127.1|414160_415261_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	49.0	1.9e-98
WP_014095657.1|417545_418964_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	35.9	5.6e-63
WP_014095656.1|420295_421219_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	46.8	1.9e-59
WP_014095655.1|421651_421927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017552134.1|422148_422910_-	fumarylacetoacetate hydrolase	NA	NA	NA	NA	NA
WP_013858874.1|423130_423565_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_071451841.1|423740_424952_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_013858876.1|425248_426001_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_013858877.1|426335_426782_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	52.2	1.6e-32
WP_014095646.1|427103_428090_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_014095645.1|428343_429420_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_014095644.1|429646_431215_+	peptide chain release factor 3	NA	A0A1B0RXH7	Streptococcus_phage	27.5	7.9e-34
WP_014095643.1|431331_431802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014095642.1|432126_432930_+	TerC family protein	NA	A0A068EP98	Bacillus_phage	40.4	4.6e-30
WP_014095641.1|432974_433175_-	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	64.5	5.7e-14
WP_014095638.1|433924_435442_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_081355852.1|435380_435851_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	45.8	4.8e-19
WP_013858888.1|435888_436311_-	DUF1232 domain-containing protein	NA	NA	NA	NA	NA
WP_017552150.1|436668_436959_+	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_017552151.1|437045_437294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017552152.1|437246_439403_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	41.8	4.4e-128
>prophage 3
NZ_CP017888	Bacillus coagulans strain BC-HY1 chromosome, complete genome	3599077	1349697	1406421	3599077	transposase,tRNA,protease,coat	Moraxella_phage(33.33%)	53	NA	NA
WP_013859802.1|1349697_1350027_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_013859803.1|1350039_1350348_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_071451953.1|1350490_1351969_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_014097868.1|1352020_1352887_-	stage IV sporulation protein FB	NA	NA	NA	NA	NA
WP_061574066.1|1352879_1353632_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_017552666.1|1353758_1354568_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_035184496.1|1354560_1355253_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_017551061.1|1355477_1355996_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_017551062.1|1355995_1356862_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_017551063.1|1356968_1357985_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_017551064.1|1358158_1358842_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_071451954.1|1359041_1360025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071451955.1|1360143_1360905_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_071451956.1|1361010_1361715_-	type 4a pilus biogenesis protein PilO	NA	NA	NA	NA	NA
WP_071451957.1|1361711_1362587_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_017551068.1|1362587_1363586_-	pilus assembly protein PilM	NA	NA	NA	NA	NA
WP_043052461.1|1363631_1365152_-|transposase	IS5-like element ISBco3 family transposase	transposase	NA	NA	NA	NA
WP_017551069.1|1365355_1365829_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_017551070.1|1365910_1367116_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_017551071.1|1367102_1368155_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_017551072.1|1368164_1369826_-	type II secretion system protein E	NA	NA	NA	NA	NA
WP_017551073.1|1369870_1371325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017551074.1|1371341_1372070_-	photosystem reaction center subunit H	NA	NA	NA	NA	NA
WP_017551075.1|1372096_1373920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026104584.1|1374047_1375691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017551077.1|1375690_1376200_-	type II secretion system protein	NA	NA	NA	NA	NA
WP_013859827.1|1376196_1376616_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_014097850.1|1376734_1378057_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_017551078.1|1378119_1380765_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	43.7	3.4e-162
WP_014097848.1|1381191_1381383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014097847.1|1381399_1382584_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_014097846.1|1382614_1384432_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014097845.1|1384817_1386107_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	A0A1V0SKB7	Klosneuvirus	27.6	4.4e-06
WP_014097844.1|1386122_1387100_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_014097843.1|1387336_1388125_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_014097842.1|1388121_1389054_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_014097841.1|1389066_1389891_-	cytochrome c	NA	NA	NA	NA	NA
WP_014097840.1|1389906_1391238_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_014097839.1|1391423_1391918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014097838.1|1392094_1392679_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_061565532.1|1392675_1395000_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	44.5	4.8e-181
WP_071451958.1|1395043_1396681_-|protease	ATP-dependent protease LonB	protease	A0A0R6PGP8	Moraxella_phage	36.4	5.0e-15
WP_014097835.1|1396972_1398241_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	67.4	5.4e-150
WP_071451959.1|1398610_1399897_-	trigger factor	NA	NA	NA	NA	NA
WP_071451960.1|1400060_1401053_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_071451961.1|1401191_1401635_-	YndM family protein	NA	NA	NA	NA	NA
WP_061086562.1|1401769_1402066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071451962.1|1402306_1402708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014097829.1|1403515_1404025_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_014097828.1|1404021_1404630_-	XTP/dITP diphosphatase	NA	A0A2H4UUV7	Bodo_saltans_virus	33.3	8.1e-11
WP_014097827.1|1404737_1405778_-	sporulation protein	NA	NA	NA	NA	NA
WP_014097826.1|1405921_1406122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071451963.1|1406118_1406421_+|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 4
NZ_CP017888	Bacillus coagulans strain BC-HY1 chromosome, complete genome	3599077	1747263	1823624	3599077	transposase,coat	Tupanvirus(30.0%)	60	NA	NA
WP_035189621.1|1747263_1747611_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_035189620.1|1747646_1748801_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_152598484.1|1749013_1749358_+	thiol reductase thioredoxin	NA	A0A2K9L3H4	Tupanvirus	30.0	2.6e-06
WP_035189617.1|1749398_1750838_-	phospholipase	NA	NA	NA	NA	NA
WP_014097513.1|1750962_1751118_+	lmo0937 family membrane protein	NA	NA	NA	NA	NA
WP_026683847.1|1751492_1754690_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.7	5.3e-69
WP_017551449.1|1755938_1757114_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	42.6	3.6e-84
WP_035189616.1|1757639_1758671_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_035190401.1|1758984_1760478_+	catalase	NA	A0A2K9L0T1	Tupanvirus	46.2	1.9e-93
WP_035184119.1|1760749_1761328_-	undecaprenyl-diphosphatase	NA	NA	NA	NA	NA
WP_014097507.1|1761324_1762068_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_035190398.1|1762043_1763327_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_035190395.1|1763640_1764519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035190393.1|1764522_1765029_-	anti-sigma factor	NA	NA	NA	NA	NA
WP_014097504.1|1765033_1765567_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_046721089.1|1765906_1767076_-	galactosyldiacylglycerol synthase	NA	NA	NA	NA	NA
WP_071452021.1|1767732_1769964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035184106.1|1772369_1773386_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_017552002.1|1773583_1774555_-	sugar kinase	NA	NA	NA	NA	NA
WP_026104668.1|1774716_1775547_-	5-dehydro-4-deoxy-D-glucuronate isomerase	NA	NA	NA	NA	NA
WP_026683835.1|1775600_1776377_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	NA	NA	NA	NA
WP_014097496.1|1776791_1778216_-	MFS transporter	NA	NA	NA	NA	NA
WP_026683833.1|1778284_1779697_-	glucuronate isomerase	NA	NA	NA	NA	NA
WP_014097494.1|1779731_1781222_-	altronate dehydratase	NA	NA	NA	NA	NA
WP_035191113.1|1781211_1782648_-	tagaturonate reductase	NA	NA	NA	NA	NA
WP_014097492.1|1782766_1783771_-	sugar kinase	NA	NA	NA	NA	NA
WP_014097491.1|1783763_1784441_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_061565096.1|1784591_1785362_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_043052461.1|1785831_1787352_-|transposase	IS5-like element ISBco3 family transposase	transposase	NA	NA	NA	NA
WP_017551893.1|1788667_1790224_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.2	3.5e-58
WP_017551891.1|1790589_1791213_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_014097488.1|1794123_1795323_+	peptidase S8	NA	A0A1V0SLL0	Klosneuvirus	31.6	1.3e-25
WP_014097487.1|1795413_1795635_-	hypothetical protein	NA	A0A172JI00	Bacillus_phage	50.8	6.3e-14
WP_071452022.1|1796980_1797373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035191206.1|1797852_1798164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017550734.1|1798154_1798379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017550735.1|1798447_1798975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071452023.1|1799186_1800104_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_035190577.1|1800105_1800324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014097481.1|1800304_1800769_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	63.2	1.7e-48
WP_061087234.1|1800808_1803097_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	40.6	2.4e-92
WP_035200618.1|1803124_1803871_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_014097478.1|1804068_1804302_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_035190575.1|1804850_1806146_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	71.5	1.5e-171
WP_026684779.1|1806374_1807910_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_026684780.1|1807902_1808664_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_071452024.1|1808690_1809875_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_014097472.1|1809964_1810972_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_014097471.1|1811037_1812066_-	sugar-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_014097470.1|1812201_1812447_-	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_014097469.1|1812640_1813975_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_014095824.1|1814267_1815578_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_014097467.1|1816029_1816248_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_014097466.1|1816240_1816747_-	DUF1641 domain-containing protein	NA	NA	NA	NA	NA
WP_017551324.1|1816818_1819812_-	formate dehydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_026684782.1|1819941_1820160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026684784.1|1822005_1822254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026684785.1|1822255_1822489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014097458.1|1822485_1822713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014097457.1|1822709_1823624_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP017888	Bacillus coagulans strain BC-HY1 chromosome, complete genome	3599077	1849620	1897534	3599077	transposase,tRNA,integrase	Streptococcus_phage(28.57%)	42	1845519:1845539	1889498:1889518
1845519:1845539	attL	GATTCGTTCAGCAAGCCCTAA	NA	NA	NA	NA
WP_026683962.1|1849620_1850094_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_017551341.1|1850129_1851011_-	amidase domain-containing protein	NA	NA	NA	NA	NA
WP_014097429.1|1851330_1852461_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_014097428.1|1852836_1853460_+	NAAT family transporter	NA	NA	NA	NA	NA
WP_017551344.1|1853789_1854719_-	manganese-dependent inorganic pyrophosphatase	NA	NA	NA	NA	NA
WP_035189494.1|1854891_1855356_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_014097425.1|1855364_1856222_-	proline iminopeptidase-family hydrolase	NA	A0A2K9KZN8	Tupanvirus	30.9	4.2e-05
WP_014097424.1|1856372_1857170_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014097423.1|1857156_1857849_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_061565103.1|1857861_1858599_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.0	8.5e-31
WP_026683951.1|1858661_1859498_-	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_019721283.1|1859829_1860177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142010184.1|1861361_1861613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017551801.1|1861978_1863139_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_017551800.1|1863517_1865782_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	45.2	6.6e-183
WP_014097418.1|1865871_1866609_+	pyruvate formate lyase-activating protein	NA	NA	NA	NA	NA
WP_071452029.1|1866869_1867427_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014097416.1|1867445_1867979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071452030.1|1868097_1869078_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_071452031.1|1869074_1869986_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	38.4	7.5e-37
WP_014097413.1|1869982_1870786_-	lipase	NA	NA	NA	NA	NA
WP_014097412.1|1871219_1871450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061086853.1|1872086_1873067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014097410.1|1873472_1874510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014097409.1|1875043_1875742_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.0	3.1e-30
WP_014097408.1|1875741_1877100_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_014097407.1|1877279_1877912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155759650.1|1878204_1878558_+	folate family ECF transporter S component	NA	NA	NA	NA	NA
WP_014097040.1|1879062_1880478_-|transposase	ISLre2-like element ISBco6 family transposase	transposase	NA	NA	NA	NA
WP_041818223.1|1880589_1881111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014096191.1|1881153_1882506_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_014096192.1|1882498_1883299_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_017550355.1|1883472_1884786_+|transposase	IS1380-like element ISBco1 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	48.8	7.1e-113
WP_155759651.1|1885040_1885202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035189483.1|1885453_1885786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035189482.1|1885805_1886633_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_152598483.1|1886654_1887983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013858128.1|1888154_1889465_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_152598482.1|1889842_1890469_-	hypothetical protein	NA	NA	NA	NA	NA
1889498:1889518	attR	TTAGGGCTTGCTGAACGAATC	NA	NA	NA	NA
WP_071452033.1|1890624_1891938_+|transposase	IS1380-like element ISBco1 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	48.9	4.2e-113
WP_035191088.1|1892145_1893531_-	MFS transporter	NA	NA	NA	NA	NA
WP_071452034.1|1895980_1897534_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP017888	Bacillus coagulans strain BC-HY1 chromosome, complete genome	3599077	2046677	2090232	3599077	transposase,tRNA	Bacillus_virus(20.0%)	35	NA	NA
WP_071452072.1|2046677_2047796_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	47.5	2.8e-78
WP_003352379.1|2047883_2048024_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_017550103.1|2049452_2050448_-|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
WP_017550102.1|2050649_2050988_+	RNA-binding protein S4	NA	NA	NA	NA	NA
WP_017550101.1|2051031_2051835_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	NA	NA	NA	NA
WP_017550100.1|2052194_2053454_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	46.8	1.3e-10
WP_014097273.1|2053491_2054490_-	beta-ketoacyl-ACP synthase	NA	NA	NA	NA	NA
WP_014097272.1|2054516_2054876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014097270.1|2055742_2057071_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	44.1	3.4e-94
WP_017550098.1|2058183_2059962_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	38.6	1.8e-95
WP_017550097.1|2059961_2060561_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017551000.1|2061017_2061407_-	arsenate reductase ArsC	NA	NA	NA	NA	NA
WP_017551001.1|2061416_2063153_-	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
WP_017551002.1|2063153_2063549_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_017551003.1|2063564_2064197_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_017551004.1|2064198_2065257_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_017551005.1|2065253_2065799_-	DUF2703 domain-containing protein	NA	NA	NA	NA	NA
WP_017551006.1|2065791_2066127_-	helix-turn-helix transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	36.5	6.8e-12
WP_017551007.1|2066312_2066756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081355865.1|2067147_2068230_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	29.8	9.0e-21
WP_017550856.1|2068428_2069268_-	nucleotidyltransferase domain-containing protein	NA	A0A1X9I6C9	Streptococcus_phage	77.0	6.1e-118
WP_014096851.1|2069655_2070933_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_051039155.1|2071057_2072236_-	macrolide efflux MFS transporter Mef(A)	NA	A0A1B0RXA6	Streptococcus_phage	95.2	4.5e-199
WP_003127235.1|2072634_2073399_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_017552090.1|2073870_2074401_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003127232.1|2074449_2075298_-	sialate O-acetylesterase	NA	NA	NA	NA	NA
WP_071452073.1|2076580_2077699_-	AAA family ATPase	NA	G3MAX6	Bacillus_virus	44.6	7.3e-58
WP_071452074.1|2077709_2079287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071452076.1|2079726_2081505_-	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_071452077.1|2081600_2081813_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_081355866.1|2081974_2083129_-	recombinase family protein	NA	A0A2K5B2B4	Erysipelothrix_phage	55.5	4.0e-112
WP_071452078.1|2083562_2084846_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_071452079.1|2084964_2086665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071452080.1|2086902_2088456_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_013858128.1|2088921_2090232_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP017888	Bacillus coagulans strain BC-HY1 chromosome, complete genome	3599077	2254257	2296236	3599077	transposase,integrase	Streptococcus_phage(27.27%)	32	2267315:2267335	2294231:2294251
WP_081355869.1|2254257_2255595_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_071452122.1|2257383_2260467_-	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	23.1	1.0e-24
WP_071452123.1|2260482_2261715_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_071452124.1|2261714_2264279_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	45.4	1.0e-110
WP_071452125.1|2264603_2264912_-	SAM-dependent DNA methyltransferase	NA	NA	NA	NA	NA
WP_035189966.1|2265221_2265419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017551178.1|2265571_2266216_-	LysE family transporter	NA	NA	NA	NA	NA
WP_017551179.1|2266600_2267074_+	glutathione peroxidase	NA	NA	NA	NA	NA
2267315:2267335	attL	AAAAACTTAAGTTCATTTTAT	NA	NA	NA	NA
WP_017551180.1|2267346_2267835_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_081355870.1|2268293_2269214_-	maltose-6'-phosphate glucosidase	NA	NA	NA	NA	NA
WP_013860497.1|2271139_2271715_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0T6D2	Bacillus_phage	39.3	2.9e-26
WP_014097067.1|2271903_2274039_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	84.7	0.0e+00
WP_013860499.1|2274031_2274400_-	helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	77.0	2.6e-49
WP_071452432.1|2274624_2275527_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014097059.1|2276166_2276643_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A0A8WJI9	Clostridium_phage	50.3	1.3e-37
WP_061087059.1|2276639_2278511_-	anaerobic ribonucleoside triphosphate reductase	NA	A0A2R2ZH54	Clostridioides_phage	45.7	6.1e-158
WP_071452127.1|2279289_2280369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013860504.1|2280506_2281556_-	2,3-butanediol dehydrogenase	NA	NA	NA	NA	NA
WP_041818033.1|2282064_2283210_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	38.4	1.5e-45
WP_014097055.1|2283347_2284460_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	48.4	1.1e-79
WP_014095882.1|2285015_2286134_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	47.5	8.3e-78
WP_003352379.1|2286221_2286362_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_071452433.1|2286524_2287445_-	ribose ABC transporter substrate-binding protein RbsB	NA	NA	NA	NA	NA
WP_026684459.1|2287460_2288405_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_014097053.1|2288388_2289888_-	sugar ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.8	1.1e-11
WP_014097052.1|2289934_2290330_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_014097051.1|2290326_2291208_-	ribokinase	NA	NA	NA	NA	NA
WP_071452128.1|2291210_2292188_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_071452129.1|2293184_2294078_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_014097045.1|2294294_2294783_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
2294231:2294251	attR	AAAAACTTAAGTTCATTTTAT	NA	NA	NA	NA
WP_017550090.1|2294981_2295245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014097043.1|2295246_2296236_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP017888	Bacillus coagulans strain BC-HY1 chromosome, complete genome	3599077	2418665	2454256	3599077	transposase	uncultured_Mediterranean_phage(16.67%)	27	NA	NA
WP_014095824.1|2418665_2419976_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_061577245.1|2420297_2421299_-	hydroxyacid dehydrogenase	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	27.2	8.9e-23
WP_061577244.1|2421311_2422208_-	decarboxylating 6-phosphogluconate dehydrogenase	NA	A0A222YX62	Synechococcus_phage	37.1	1.9e-56
WP_061577242.1|2423165_2424044_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_061577241.1|2424040_2424952_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_061577240.1|2425492_2425861_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_061565433.1|2426656_2427262_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_061565434.1|2427303_2428425_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_061577239.1|2429343_2430366_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	23.9	4.8e-24
WP_035189308.1|2430565_2430931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017551572.1|2432214_2433000_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.4	2.5e-20
WP_071452142.1|2434082_2435315_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	23.1	4.8e-10
WP_081355871.1|2435433_2435730_-	DUF2750 domain-containing protein	NA	NA	NA	NA	NA
WP_017551570.1|2435907_2436810_-	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035183368.1|2436978_2438142_+	MFS transporter	NA	NA	NA	NA	NA
WP_014096948.1|2438505_2439279_+	acetoin reductase	NA	NA	NA	NA	NA
WP_035189307.1|2439805_2440636_+	DUF1835 domain-containing protein	NA	NA	NA	NA	NA
WP_014096946.1|2440906_2441611_-	DUF2961 domain-containing protein	NA	NA	NA	NA	NA
WP_014096945.1|2441693_2443379_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_014096944.1|2443490_2443889_-	DUF2961 domain-containing protein	NA	NA	NA	NA	NA
WP_013858128.1|2445819_2447130_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081355872.1|2448132_2449470_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_014096940.1|2449695_2450517_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_014096939.1|2450513_2451314_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_014096938.1|2451326_2451818_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_014096937.1|2451829_2452270_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_155759655.1|2452972_2454256_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	49.0	3.9e-108
>prophage 9
NZ_CP017888	Bacillus coagulans strain BC-HY1 chromosome, complete genome	3599077	2493231	2501546	3599077		Synechococcus_phage(33.33%)	8	NA	NA
WP_026684446.1|2493231_2493825_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.3	6.4e-29
WP_071452149.1|2493817_2494861_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	45.6	2.9e-61
WP_071452150.1|2494880_2496305_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.7	6.0e-49
WP_071452151.1|2496289_2498539_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	44.2	2.7e-168
WP_071452152.1|2498522_2499206_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_013860601.1|2499202_2499457_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_071452153.1|2499449_2500160_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SS43	Cyanophage	42.8	7.4e-48
WP_014096900.1|2500250_2501546_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.5	6.5e-18
>prophage 10
NZ_CP017888	Bacillus coagulans strain BC-HY1 chromosome, complete genome	3599077	2691262	2731883	3599077	holin,transposase,bacteriocin,tRNA,protease,coat	Cafeteria_roenbergensis_virus(16.67%)	41	NA	NA
WP_017550330.1|2691262_2692933_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_017550331.1|2692929_2693370_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_017550332.1|2693525_2694398_-	agmatinase	NA	NA	NA	NA	NA
WP_035316507.1|2694578_2696630_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_017550334.1|2696732_2697245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017550335.1|2697275_2697938_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_071646869.1|2698053_2698269_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_017550336.1|2698283_2698802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017550337.1|2698819_2700136_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	27.7	6.6e-26
WP_071452170.1|2700627_2701338_+	RsfA family transcriptional regulator	NA	A0A1D6X8E5	Bacillus_phage	50.0	4.1e-06
WP_035183189.1|2702727_2703561_-	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_035183186.1|2704340_2705312_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_014096713.1|2705481_2706237_+	heme-dependent peroxidase	NA	NA	NA	NA	NA
WP_014096712.1|2706397_2706844_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
WP_017550344.1|2706886_2707258_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_017550345.1|2707421_2707667_-	YwdI family protein	NA	NA	NA	NA	NA
WP_017550346.1|2707681_2707879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017550347.1|2708011_2708698_-	uracil-DNA glycosylase	NA	A0A0B5IW78	Pandoravirus	45.6	2.0e-50
WP_071452171.1|2708847_2709195_+	general stress protein	NA	NA	NA	NA	NA
WP_017550349.1|2709319_2709592_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017550350.1|2710134_2711493_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017550351.1|2711641_2711869_+|bacteriocin	circular bacteriocin, circularin A/uberolysin family	bacteriocin	NA	NA	NA	NA
WP_017550352.1|2711943_2713569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017550353.1|2713614_2714133_+	stage II sporulation protein M	NA	NA	NA	NA	NA
WP_080738159.1|2714129_2714816_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	28.8	3.3e-13
WP_013860794.1|2715052_2715292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035190076.1|2715371_2716016_-	ABC-2 transporter permease	NA	NA	NA	NA	NA
WP_081111651.1|2716021_2716783_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.5	3.6e-16
WP_048339774.1|2716762_2718283_+|transposase	IS5-like element ISBco3 family transposase	transposase	NA	NA	NA	NA
WP_071452172.1|2718722_2719916_-	MFS transporter	NA	NA	NA	NA	NA
WP_014096700.1|2720283_2721102_+	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_026684567.1|2721221_2721569_+	YojF family protein	NA	NA	NA	NA	NA
WP_046721726.1|2721582_2722266_+	bacillithiol biosynthesis deacetylase BshB2	NA	NA	NA	NA	NA
WP_071452173.1|2722388_2723255_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_071452174.1|2723247_2725434_-	DNA helicase RecQ	NA	J2YAJ8	Acanthamoeba_polyphaga_lentillevirus	37.0	5.2e-84
WP_014096696.1|2725536_2726808_-	alkaline phosphatase	NA	NA	NA	NA	NA
WP_014096695.1|2726934_2727783_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035183167.1|2728038_2728905_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_035183165.1|2730029_2730509_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_026684575.1|2730832_2731516_-	LrgB family protein	NA	NA	NA	NA	NA
WP_035183163.1|2731505_2731883_-|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
>prophage 11
NZ_CP017888	Bacillus coagulans strain BC-HY1 chromosome, complete genome	3599077	2825672	2833740	3599077	protease	Staphylococcus_phage(66.67%)	10	NA	NA
WP_046721068.1|2825672_2826173_-	single-stranded DNA-binding protein	NA	A0A290GHL8	Caldibacillus_phage	65.7	1.8e-53
WP_014096621.1|2826234_2826522_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_071452204.1|2826775_2827246_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	55.9	2.2e-40
WP_071452205.1|2827257_2828451_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.1	4.2e-112
WP_014096618.1|2828468_2829116_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.8	8.8e-40
WP_152650438.1|2829096_2830218_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	37.2	2.0e-55
WP_014096616.1|2830539_2831640_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_013860891.1|2831800_2832001_-	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_017550664.1|2831990_2832902_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_017550665.1|2833116_2833740_+|protease	spore protease YyaC	protease	G3M9W0	Bacillus_virus	38.5	3.6e-22
>prophage 12
NZ_CP017888	Bacillus coagulans strain BC-HY1 chromosome, complete genome	3599077	3002696	3126587	3599077	tail,capsid,transposase,integrase,terminase,tRNA,portal	Bacillus_phage(20.83%)	113	3038218:3038277	3081572:3081670
WP_014096481.1|3002696_3003434_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_014096480.1|3003634_3004072_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_013858111.1|3004093_3004486_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_061565130.1|3004767_3006825_+	catalase	NA	A0A2K9L0T1	Tupanvirus	45.2	2.8e-132
WP_014096476.1|3009531_3010686_+	sulfate adenylyltransferase	NA	A0A2P1ELS9	Moumouvirus	32.3	3.7e-49
WP_014096475.1|3010719_3011325_+	adenylyl-sulfate kinase	NA	NA	NA	NA	NA
WP_014096474.1|3011524_3013006_+	amino acid permease	NA	NA	NA	NA	NA
WP_014096473.1|3013124_3013568_+	YbaK family protein	NA	NA	NA	NA	NA
WP_014096472.1|3013660_3014374_+	N-acetylmuramoyl-L-alanine amidase CwlD	NA	NA	NA	NA	NA
WP_071452229.1|3014469_3015522_+	Mrp/NBP35 family ATP-binding protein	NA	NA	NA	NA	NA
WP_061566922.1|3016192_3016747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061566923.1|3016994_3017633_+	KinB-signaling pathway activation protein	NA	NA	NA	NA	NA
WP_013858119.1|3017754_3018882_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	46.9	4.1e-77
WP_041818598.1|3018893_3019292_-|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	74.2	2.9e-54
WP_013858120.1|3019701_3020766_-	choloylglycine hydrolase	NA	NA	NA	NA	NA
WP_019722038.1|3020878_3021793_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_050996490.1|3022044_3022551_+	cupin domain-containing protein	NA	Q2I8C5	Bacillus_phage	62.7	4.7e-57
WP_029142968.1|3023188_3023653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071452231.1|3024069_3024810_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_019722035.1|3024948_3025176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071452232.1|3025507_3026899_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_081355877.1|3026898_3027909_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_071452234.1|3028151_3029900_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	26.6	2.3e-26
WP_019722032.1|3029874_3031599_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	25.9	2.8e-24
WP_017553512.1|3031672_3031882_+	hypothetical protein	NA	NA	NA	NA	NA
3038218:3038277	attL	AACACCTTCCCAAGGTGTGGGTCGCGGGTTCGAGTCCCGTCTTCCGCTTAAAGTTTAAAC	NA	NA	NA	NA
WP_029142701.1|3038351_3039578_-|integrase	site-specific integrase	integrase	S5MNZ2	Brevibacillus_phage	47.6	1.0e-92
WP_081355891.1|3039683_3040784_-	hypothetical protein	NA	O64020	Bacillus_phage	72.1	3.0e-64
WP_081105569.1|3040934_3041975_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_153016208.1|3041892_3042279_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2P1JU12	Anoxybacillus_phage	51.2	7.6e-31
WP_071452235.1|3042321_3042798_-	helix-turn-helix transcriptional regulator	NA	Q786F1	Bacillus_phage	43.8	1.4e-23
WP_061574395.1|3042960_3043188_+	helix-turn-helix transcriptional regulator	NA	A0A1V0E021	Clostridioides_phage	44.8	5.5e-05
WP_071452236.1|3043188_3043980_+	hypothetical protein	NA	R9VWW9	Paenibacillus_phage	49.8	7.2e-60
WP_046721488.1|3043980_3044166_+	helix-turn-helix domain-containing protein	NA	U5P0W4	Brevibacillus_phage	61.8	4.6e-10
WP_061574393.1|3044227_3044746_+	hypothetical protein	NA	A0A290FZK9	Caldibacillus_phage	38.6	1.0e-22
WP_061574392.1|3044745_3045030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155375947.1|3045099_3045240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035182881.1|3045666_3045903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052042129.1|3045899_3046106_+	hypothetical protein	NA	A0A290GDU5	Caldibacillus_phage	42.0	5.0e-05
WP_071452441.1|3046209_3047151_+	hypothetical protein	NA	A8ATY5	Listeria_phage	61.3	2.7e-106
WP_071452237.1|3047150_3048044_+	recombinase RecT	NA	A8ATY6	Listeria_phage	69.2	5.6e-93
WP_071452238.1|3048099_3048915_+	hypothetical protein	NA	A0A1C8E9B4	Bacillus_phage	57.1	1.2e-22
WP_071452239.1|3048838_3049705_+	DNA replication protein	NA	S6B1M2	Thermus_phage	70.0	2.3e-112
WP_071452240.1|3050045_3050243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071452241.1|3050239_3050851_+	hypothetical protein	NA	R9TQ23	Paenibacillus_phage	49.0	3.2e-39
WP_071452242.1|3050860_3051322_+	DUF1064 domain-containing protein	NA	A0A2P1JTY5	Anoxybacillus_phage	80.0	3.0e-58
WP_155759663.1|3051855_3052014_+	DUF3954 domain-containing protein	NA	A0A2P1JTX5	Anoxybacillus_phage	69.2	2.6e-14
WP_081355878.1|3051962_3052751_+	SAM-dependent DNA methyltransferase	NA	A8ATD5	Listeria_phage	52.3	1.3e-58
WP_071452246.1|3053021_3053330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071452248.1|3053723_3054167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071452249.1|3054313_3055528_+	DNA modification methylase	NA	A0A2I4R670	Erysipelothrix_phage	52.3	7.5e-117
WP_155759664.1|3055663_3055885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071452251.1|3055922_3056792_+|terminase	terminase	terminase	D2J000	Enterococcus_phage	42.3	2.5e-37
WP_071452252.1|3056760_3058053_+|terminase	PBSX family phage terminase large subunit	terminase	A0A1B1P869	Bacillus_phage	76.6	1.1e-198
WP_071452253.1|3058065_3059607_+|portal	phage portal protein	portal	A0A1B1P863	Bacillus_phage	53.5	7.3e-133
WP_071452254.1|3059610_3060720_+	hypothetical protein	NA	B5LPR2	Bacillus_virus	43.0	2.4e-85
WP_046721459.1|3060726_3060975_+	hypothetical protein	NA	A0A1S5SA34	Streptococcus_phage	61.2	2.3e-20
WP_071452255.1|3061071_3061722_+	hypothetical protein	NA	B3GW02	Streptococcus_phage	41.0	8.0e-17
WP_071452256.1|3061744_3062659_+|capsid	capsid protein	capsid	B5LPR4	Bacillus_virus	65.5	5.3e-107
WP_071452257.1|3062707_3062944_+	hypothetical protein	NA	B5LPR5	Bacillus_virus	48.0	2.4e-11
WP_071452258.1|3062946_3063330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152650448.1|3063365_3063740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071452259.1|3063745_3064099_+|capsid	minor capsid protein	capsid	A0A1B1P872	Bacillus_phage	51.3	7.2e-28
WP_071452260.1|3064085_3064514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071452261.1|3064519_3064978_+|capsid	capsid protein	capsid	O03972	Lactobacillus_phage	63.6	1.9e-44
WP_071452262.1|3065030_3065456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071452263.1|3065462_3066086_+	hypothetical protein	NA	O03936	Lactobacillus_phage	40.3	4.7e-30
WP_071452264.1|3066078_3070125_+	tape measure protein	NA	Q94MA1	Lactococcus_phage	46.0	3.8e-64
WP_071452265.1|3070121_3071804_+|tail	phage tail protein	tail	A0A059T682	Listeria_phage	32.8	5.4e-81
WP_071452266.1|3071817_3074298_+	hypothetical protein	NA	A0A1S5RCP1	Lactobacillus_phage	31.3	3.8e-51
WP_071452267.1|3074310_3077205_+	hypothetical protein	NA	A0A1I9KK49	Lactobacillus_phage	30.7	1.3e-18
WP_071452268.1|3077206_3077449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071452269.1|3077448_3077688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155759658.1|3077723_3078041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071452272.1|3078413_3079712_+	LysM peptidoglycan-binding domain-containing protein	NA	Q6EVN0	Oenoccocus_phage	32.0	9.1e-28
WP_071452273.1|3079780_3080494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071452274.1|3080500_3081169_+	hypothetical protein	NA	Q4ZB11	Staphylococcus_virus	28.7	1.6e-15
WP_071452275.1|3082334_3083234_+	arginase	NA	A0A1V0SJM8	Klosneuvirus	32.2	2.7e-23
3081572:3081670	attR	AACACCTTCCCAAGGTGTGGGTCGCGGGTTCGAGTCCCGTCTTCCGCTTAAAGTTTAAACGCTCAAACCTCTTGATATAAAAGGGTTTGAGCGTTTTTT	NA	NA	NA	NA
WP_014096459.1|3083337_3083511_-	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_017550304.1|3083686_3084250_+	RNA polymerase sigma factor SigW	NA	NA	NA	NA	NA
WP_071452276.1|3084262_3084877_+	anti-sigma factor	NA	NA	NA	NA	NA
WP_013858133.1|3085023_3085851_+	TIGR00159 family protein	NA	NA	NA	NA	NA
WP_013858134.1|3085843_3087094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013858135.1|3087130_3088483_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_014096453.1|3088911_3090714_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q84421	Paramecium_bursaria_Chlorella_virus	39.8	1.9e-108
WP_014096452.1|3091919_3092345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014096451.1|3092437_3092959_+	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_071452277.1|3093143_3093896_+	acyl-ACP thioesterase	NA	NA	NA	NA	NA
WP_013858140.1|3094156_3095368_-	MFS transporter	NA	NA	NA	NA	NA
WP_013858141.1|3095840_3096983_-	MFS transporter	NA	NA	NA	NA	NA
WP_013858128.1|3097783_3099094_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014096447.1|3100200_3100932_-	NAD-dependent protein deacylase	NA	A0A068EPD4	Bacillus_phage	41.4	1.4e-46
WP_014096446.1|3101283_3103017_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.3	3.0e-10
WP_071452278.1|3103095_3103953_-	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_071452279.1|3103945_3104506_-	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_046721647.1|3104498_3104822_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014096442.1|3105162_3106917_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	49.4	1.4e-10
WP_046721646.1|3107089_3108496_-	MFS transporter	NA	NA	NA	NA	NA
WP_046721645.1|3108562_3109132_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_046721644.1|3109243_3109846_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_026683802.1|3110460_3111249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014096438.1|3111555_3111843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071452280.1|3111835_3113002_+	MFS transporter	NA	NA	NA	NA	NA
WP_014096436.1|3113028_3113931_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_046721642.1|3113992_3114217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081355880.1|3114232_3115321_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_026683798.1|3115508_3115808_+	DUF3219 family protein	NA	NA	NA	NA	NA
WP_071452281.1|3115804_3116800_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_071452282.1|3118159_3119389_-	MFS transporter	NA	NA	NA	NA	NA
WP_071452283.1|3119749_3120289_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_071452285.1|3120603_3121092_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_071452286.1|3121479_3121884_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_013858128.1|3123382_3124693_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017554688.1|3125273_3126587_+|transposase	IS1380-like element ISBco1 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	49.1	4.2e-113
>prophage 13
NZ_CP017888	Bacillus coagulans strain BC-HY1 chromosome, complete genome	3599077	3425317	3464256	3599077	transposase,holin	Enterococcus_phage(66.67%)	32	NA	NA
WP_071452358.1|3425317_3426229_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014096156.1|3426230_3426494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017550185.1|3426624_3426948_+	DUF3870 domain-containing protein	NA	NA	NA	NA	NA
WP_071452359.1|3427218_3428430_-	butyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_061577481.1|3428434_3429613_-	CoA transferase	NA	NA	NA	NA	NA
WP_014096152.1|3430338_3431352_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_046721834.1|3431891_3433091_+	MFS transporter	NA	NA	NA	NA	NA
WP_071452360.1|3433249_3435112_+	transcription antiterminator	NA	NA	NA	NA	NA
WP_035189728.1|3435236_3435569_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_061087170.1|3435586_3435916_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_061087169.1|3435949_3437035_+	DUF871 domain-containing protein	NA	NA	NA	NA	NA
WP_071452361.1|3437047_3438331_+	PTS cellobiose transporter subunit IIC	NA	NA	NA	NA	NA
WP_071452362.1|3439117_3440236_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	47.0	7.0e-77
WP_071452363.1|3440974_3441403_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071452364.1|3441399_3442599_+	MFS transporter	NA	NA	NA	NA	NA
WP_014097040.1|3442933_3444349_+|transposase	ISLre2-like element ISBco6 family transposase	transposase	NA	NA	NA	NA
WP_071452365.1|3444769_3445756_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_071452366.1|3445953_3447951_+	beta-galactosidase	NA	NA	NA	NA	NA
WP_071452367.1|3448339_3449017_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_026684775.1|3449028_3449937_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_029142382.1|3449952_3450606_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_071452368.1|3450617_3451763_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	F2Y1V5	Organic_Lake_phycodnavirus	28.3	3.3e-13
WP_013858383.1|3451959_3452505_+	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_029142384.1|3452519_3453080_+	acetyltransferase	NA	NA	NA	NA	NA
WP_155759662.1|3453101_3453245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071452369.1|3454541_3455660_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	47.5	1.1e-77
WP_061087264.1|3456313_3456607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061087265.1|3456757_3457330_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_035191172.1|3457633_3458449_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_071452370.1|3459072_3459789_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_071452371.1|3461759_3463337_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_014096120.1|3463281_3464256_+|transposase	transposase	transposase	NA	NA	NA	NA
