The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024899	Rhodobaca barguzinensis strain alga05 chromosome, complete genome	3899419	140586	231824	3899419	coat,integrase,capsid,terminase,tail,portal,head,transposase	Acidithiobacillus_phage(21.88%)	90	153258:153282	248572:248620
WP_071479424.1|140586_142026_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_071479421.1|142977_144321_-	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_071479420.1|144385_144967_-	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_084634640.1|144970_146029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071479418.1|146100_147402_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_071479417.1|147398_148193_-	citryl-CoA lyase	NA	NA	NA	NA	NA
WP_071479416.1|148307_148994_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_157798877.1|149602_149860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157798878.1|150392_151622_+	hypothetical protein	NA	NA	NA	NA	NA
153258:153282	attL	TTTTGGTTGCGGGGACAGGATTTGA	NA	NA	NA	NA
WP_134014114.1|153982_154777_-	hypothetical protein	NA	NA	NA	NA	NA
153258:153282	attL	TTTTGGTTGCGGGGACAGGATTTGA	NA	NA	NA	NA
WP_134014112.1|155633_155900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100319044.1|155896_156481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071480102.1|156977_157487_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_134014110.1|158771_159449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157798879.1|159666_159819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100319045.1|159841_160033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157798880.1|160094_160451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157798881.1|160447_160612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071480100.1|161225_161843_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_071480099.1|162334_163306_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_071480098.1|163302_165684_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_071480097.1|165661_166378_-	molecular chaperone	NA	NA	NA	NA	NA
WP_084634753.1|166392_166893_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_157798882.1|167270_167423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100319047.1|167547_167820_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_134014105.1|167833_168070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084634751.1|169361_169589_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_157798883.1|169755_171456_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_071480093.1|171452_172526_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_071480092.1|172525_174166_+	recombinase family protein	NA	R9TP69	Rhizobium_phage	35.9	5.4e-78
WP_084634747.1|174259_175504_+|integrase	site-specific integrase	integrase	A0A221SAN4	Ralstonia_phage	33.1	5.4e-38
WP_071480091.1|175728_175935_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071480090.1|176082_177252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071480089.1|177652_179230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071480087.1|181107_181794_+	dTMP kinase	NA	NA	NA	NA	NA
179803:179827	attR	TTTTGGTTGCGGGGACAGGATTTGA	NA	NA	NA	NA
WP_157798884.1|181770_182340_-	AAA family ATPase	NA	NA	NA	NA	NA
179803:179827	attR	TTTTGGTTGCGGGGACAGGATTTGA	NA	NA	NA	NA
WP_071480086.1|182345_183185_-	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_100319049.1|183380_184373_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_071480084.1|184551_185154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071480083.1|185168_186428_-|integrase	site-specific integrase	integrase	A0A0S2MV79	Bacillus_phage	24.5	2.1e-13
WP_100319050.1|186564_186837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071480081.1|187036_187300_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_084635078.1|187308_187566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071480079.1|187562_187985_+	VRR-NUC domain-containing protein	NA	NA	NA	NA	NA
WP_071480078.1|187981_189019_+	helix-turn-helix domain-containing protein	NA	A0A068CE61	Rhizobium_phage	43.7	1.9e-15
WP_084635076.1|189045_189729_+	hypothetical protein	NA	G8DGC1	Emiliania_huxleyi_virus	41.5	8.7e-38
WP_071481957.1|189880_191107_+	DNA (cytosine-5-)-methyltransferase	NA	E5E3X6	Burkholderia_phage	58.0	4.3e-120
WP_071480076.1|191099_191576_+	DNA mismatch endonuclease Vsr	NA	E5E3X5	Burkholderia_phage	52.3	4.0e-42
WP_071480075.1|191576_192812_+	type II restriction endonuclease	NA	E5E3X4	Burkholderia_phage	47.5	2.7e-98
WP_157798885.1|193026_194277_+	DNA cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	27.7	5.3e-33
WP_157798886.1|194282_195278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_134014103.1|195235_197305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157798887.1|197314_198340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071480070.1|200606_201869_+	site-specific DNA-methyltransferase	NA	A0A0A8ILE7	Aurantimonas_phage	54.8	1.0e-124
WP_071480069.1|201865_203212_+	site-specific DNA-methyltransferase	NA	K4I3Y2	Acidithiobacillus_phage	56.7	1.2e-131
WP_071480068.1|203211_203721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071480067.1|203717_203933_+	hypothetical protein	NA	K4I1E3	Acidithiobacillus_phage	65.2	6.5e-16
WP_071481956.1|203992_204382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071481955.1|204457_205135_+	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_071480066.1|205146_205713_-	DUF3489 domain-containing protein	NA	K4HZZ2	Acidithiobacillus_phage	34.4	3.6e-13
WP_071480065.1|205750_206152_-	hypothetical protein	NA	A0A2H4JI44	uncultured_Caudovirales_phage	41.0	1.2e-15
WP_071479593.1|206269_206635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071479592.1|206661_206946_-	hypothetical protein	NA	A0A0K0PVG0	Roseobacter_phage	49.3	2.9e-11
WP_071479591.1|206956_207175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071480064.1|207171_207396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071480063.1|207430_207643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071480062.1|207776_208316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100319227.1|208350_210306_+|terminase	phage terminase large subunit family protein	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	58.3	9.9e-212
WP_071480060.1|210309_210519_+	hypothetical protein	NA	K4HZB1	Acidithiobacillus_phage	50.0	4.1e-07
WP_071481954.1|210530_212021_+|portal	phage portal protein	portal	K4I1F2	Acidithiobacillus_phage	67.1	4.8e-182
WP_071480059.1|212020_213475_+	S49 family peptidase	NA	A0A068CE01	Rhizobium_phage	48.6	1.5e-63
WP_071480058.1|213563_213944_+|head	head decoration protein	head	K4ICP8	Acidithiobacillus_phage	54.0	1.5e-23
WP_071480057.1|213993_215016_+|capsid	major capsid protein	capsid	K4I3Z3	Acidithiobacillus_phage	55.1	8.3e-101
WP_071480056.1|215027_215339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071480055.1|215335_215968_+	hypothetical protein	NA	G8DH49	Emiliania_huxleyi_virus	51.5	4.9e-51
WP_071480054.1|216167_216968_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_071480053.1|217082_217502_+	acyl-CoA transferase	NA	G8DH50	Emiliania_huxleyi_virus	53.6	1.6e-34
WP_084634743.1|217511_217997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071480051.1|218108_219065_+	hypothetical protein	NA	G8DH51	Emiliania_huxleyi_virus	56.0	3.0e-97
WP_071480050.1|219065_219521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100319052.1|219559_219760_+	hypothetical protein	NA	G8DH53	Emiliania_huxleyi_virus	61.9	1.3e-05
WP_071480049.1|219740_221921_+|tail	phage tail tape-measure protein	tail	I6S2X0	Marinomonas_phage	36.9	1.9e-30
WP_071480048.1|222012_223425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071480047.1|223565_224192_+	DUF2460 domain-containing protein	NA	A0A0B5A2K3	Paracoccus_phage	54.9	4.1e-58
WP_071480046.1|224188_225073_+	DUF2163 domain-containing protein	NA	A0A0B5A5B8	Paracoccus_phage	45.6	8.3e-65
WP_071480045.1|225069_225528_+	peptidase	NA	A0A1V0DYB6	Dinoroseobacter_phage	45.5	3.8e-29
WP_071480044.1|225537_229572_+	hypothetical protein	NA	A0A0B5A7K5	Paracoccus_phage	40.7	1.3e-266
WP_071480043.1|229592_230669_+	DUF2793 domain-containing protein	NA	A0A0B5A0F6	Paracoccus_phage	37.7	2.9e-56
WP_071480042.1|230665_230974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071480041.1|231143_231824_+	DUF882 domain-containing protein	NA	A0A0K1LLY2	Rhodobacter_phage	55.7	2.1e-44
248572:248620	attR	TTTGGTTGCGGGGACAGGATTTGAACCTGTGACCTTCAGGTTATGAGCC	NA	NA	NA	NA
>prophage 2
NZ_CP024899	Rhodobaca barguzinensis strain alga05 chromosome, complete genome	3899419	1313068	1386105	3899419	capsid,terminase,tail,protease,portal,head,transposase	Acidithiobacillus_phage(20.59%)	72	NA	NA
WP_071479055.1|1313068_1314283_+|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	37.2	1.3e-55
WP_071479056.1|1314279_1314522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071479057.1|1314535_1315066_+|head,protease	HK97 family phage prohead protease	head,protease	A0A0U2BX10	Paracoccus_phage	53.7	5.3e-35
WP_100319243.1|1315232_1316369_+|capsid	phage major capsid protein	capsid	B0VK33	Azospirillum_phage	40.1	5.1e-59
WP_071479092.1|1316521_1317109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071479059.1|1317105_1317447_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_071479060.1|1317443_1317854_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_071479061.1|1317880_1318294_+|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_071479062.1|1318297_1318612_+	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_071479063.1|1318608_1318827_+|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_071479064.1|1318804_1319419_+|tail	phage tail tape measure protein	tail	A0A0A8J8P3	Ralstonia_phage	51.4	5.3e-10
WP_071479065.1|1319432_1320065_+	DUF2460 domain-containing protein	NA	A0A0B5A2K3	Paracoccus_phage	48.3	1.5e-52
WP_071479066.1|1320061_1320937_+	DUF2163 domain-containing protein	NA	F4YXU3	Roseobacter_phage	31.2	5.7e-42
WP_071479067.1|1320933_1321362_+	peptidase	NA	F4YXU4	Roseobacter_phage	37.5	2.1e-21
WP_071479068.1|1321379_1325300_+	host specificity protein	NA	A0A0B5A7K5	Paracoccus_phage	38.1	4.2e-217
WP_134014005.1|1325405_1325720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071479070.1|1325768_1327580_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	26.5	2.6e-33
WP_071479071.1|1327681_1328905_-	MFS transporter	NA	NA	NA	NA	NA
WP_071479551.1|1335383_1336106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100319111.1|1336265_1337426_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	44.6	1.8e-51
WP_157798917.1|1337743_1339513_-	DUF2326 domain-containing protein	NA	NA	NA	NA	NA
WP_071479555.1|1339509_1339752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071479556.1|1339748_1340540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071479557.1|1341068_1342439_+	exonuclease I	NA	NA	NA	NA	NA
WP_071481862.1|1342605_1342860_+	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_071479558.1|1342856_1343279_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_071479559.1|1343275_1346026_+	class I SAM-dependent DNA methyltransferase	NA	Q6NE04	Leptospira_phage	33.3	2.0e-125
WP_071479560.1|1346022_1346508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071479561.1|1346497_1346938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071479562.1|1346937_1348986_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_071479563.1|1348978_1350181_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_071479564.1|1350180_1351206_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_084635056.1|1352458_1354297_+	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	47.9	2.1e-38
WP_071479565.1|1354293_1355598_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_071479566.1|1355621_1356023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084634658.1|1356083_1356278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071479568.1|1356240_1356498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071479569.1|1356497_1357178_-	DUF882 domain-containing protein	NA	A0A0K1LLY2	Rhodobacter_phage	53.8	4.0e-43
WP_071479570.1|1357347_1357656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071479571.1|1357689_1359597_-	DUF2793 domain-containing protein	NA	A0A0K1LM04	Rhodobacter_phage	30.5	7.8e-36
WP_071479572.1|1359628_1363771_-	hypothetical protein	NA	A0A0B5A7K5	Paracoccus_phage	39.3	1.9e-257
WP_071481863.1|1363776_1364223_-	peptidase	NA	A0A1V0DYB6	Dinoroseobacter_phage	48.1	5.7e-30
WP_071479573.1|1364237_1365122_-	DUF2163 domain-containing protein	NA	A0A0K0PVK1	Roseobacter_phage	43.6	5.4e-64
WP_071479574.1|1365118_1365745_-	DUF2460 domain-containing protein	NA	A0A0B5A2K3	Paracoccus_phage	54.4	7.4e-60
WP_071479575.1|1366012_1366531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071479576.1|1366629_1368810_-|tail	phage tail tape-measure protein	tail	A0A1J0GUY9	Halomonas_phage	33.9	2.1e-21
WP_100319112.1|1368790_1368991_-	hypothetical protein	NA	G8DH53	Emiliania_huxleyi_virus	57.1	6.3e-05
WP_071479578.1|1369029_1369467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071479579.1|1369467_1370409_-	hypothetical protein	NA	G8DH51	Emiliania_huxleyi_virus	56.4	4.2e-99
WP_071479580.1|1370437_1370860_-	acyl-CoA transferase	NA	G8DH50	Emiliania_huxleyi_virus	54.3	1.4e-33
WP_071479581.1|1370971_1371388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071479582.1|1371418_1372051_-	hypothetical protein	NA	G8DH49	Emiliania_huxleyi_virus	52.4	1.3e-51
WP_071479583.1|1372047_1372359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071479584.1|1372370_1373393_-|capsid	major capsid protein	capsid	K4I3Z3	Acidithiobacillus_phage	54.3	1.2e-99
WP_071479585.1|1373455_1373836_-|head	head decoration protein	head	K4ICP8	Acidithiobacillus_phage	54.0	7.5e-23
WP_071479586.1|1373946_1375377_-	S49 family peptidase	NA	A0A068CE01	Rhizobium_phage	47.5	1.1e-63
WP_071481865.1|1375376_1376873_-|portal	phage portal protein	portal	K4I1F2	Acidithiobacillus_phage	67.1	9.1e-181
WP_071481864.1|1376884_1377094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071479587.1|1377105_1379136_-|terminase	phage terminase large subunit family protein	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	58.9	5.0e-214
WP_071479588.1|1379083_1379659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071479589.1|1379792_1380005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071479590.1|1380039_1380264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071479591.1|1380260_1380479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071479592.1|1380489_1380774_+	hypothetical protein	NA	A0A0K0PVG0	Roseobacter_phage	49.3	2.9e-11
WP_071479593.1|1380800_1381166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071479594.1|1381283_1381685_+	hypothetical protein	NA	A0A2H4JI44	uncultured_Caudovirales_phage	40.8	7.2e-16
WP_071479595.1|1381723_1382296_+	DUF3489 domain-containing protein	NA	K4HZZ2	Acidithiobacillus_phage	35.5	2.5e-14
WP_071479596.1|1382362_1382803_-	cytochrome c	NA	NA	NA	NA	NA
WP_071481866.1|1382799_1383198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071479597.1|1383257_1383473_-	hypothetical protein	NA	K4I1E3	Acidithiobacillus_phage	64.2	4.2e-15
WP_071479598.1|1383469_1384846_-	site-specific DNA-methyltransferase	NA	K4I3Y2	Acidithiobacillus_phage	56.4	5.5e-132
WP_071479599.1|1384842_1386105_-	site-specific DNA-methyltransferase	NA	A0A0A8ILE7	Aurantimonas_phage	53.9	4.0e-121
>prophage 3
NZ_CP024899	Rhodobaca barguzinensis strain alga05 chromosome, complete genome	3899419	1499849	1507810	3899419		Enterobacteria_phage(33.33%)	6	NA	NA
WP_071480187.1|1499849_1500728_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	55.1	1.3e-86
WP_071480188.1|1500724_1501573_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	37.2	2.5e-34
WP_071480189.1|1501569_1502613_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	50.6	1.5e-89
WP_071480190.1|1502616_1503171_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	43.7	1.1e-33
WP_157798918.1|1503889_1506103_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.9	7.5e-14
WP_071480192.1|1506157_1507810_-	hypothetical protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	25.2	3.7e-10
>prophage 4
NZ_CP024899	Rhodobaca barguzinensis strain alga05 chromosome, complete genome	3899419	1812720	1853852	3899419	holin,protease	Pandoravirus(14.29%)	40	NA	NA
WP_084634830.1|1812720_1813725_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_071480432.1|1813724_1814849_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_071480433.1|1814919_1816284_-	glutathione-disulfide reductase	NA	NA	NA	NA	NA
WP_071480434.1|1816293_1817082_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_071480435.1|1817181_1817574_-	cytochrome c	NA	NA	NA	NA	NA
WP_071480436.1|1817724_1819095_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_071480437.1|1819511_1819844_+	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_071482027.1|1819819_1820233_-	dioxygenase	NA	NA	NA	NA	NA
WP_071482028.1|1820310_1821264_-	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	36.7	3.2e-38
WP_071480438.1|1821402_1823109_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_084634831.1|1823105_1824182_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_071480439.1|1824239_1824374_+	aa3-type cytochrome c oxidase subunit IV	NA	NA	NA	NA	NA
WP_071480440.1|1824404_1825037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071480441.1|1825044_1825695_+	RNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_071480442.1|1825869_1827561_+	NADH-quinone oxidoreductase subunit F	NA	NA	NA	NA	NA
WP_071480443.1|1827564_1830342_+	formate dehydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_100319135.1|1830463_1831753_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.2	3.0e-47
WP_071482030.1|1831980_1832337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071480445.1|1832548_1832755_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	45.9	8.7e-10
WP_071482031.1|1832782_1833100_-	arsenate reductase	NA	NA	NA	NA	NA
WP_071480446.1|1833225_1833819_+	thymidine kinase	NA	C4MZJ3	Enterobacteria_phage	58.1	5.9e-59
WP_071480447.1|1833809_1834748_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_071480448.1|1834747_1835035_-	SCP2 sterol-binding domain-containing protein	NA	NA	NA	NA	NA
WP_100319252.1|1835105_1835669_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_071482032.1|1835709_1838457_+	disulfide oxidoreductase	NA	A0A248SJQ0	Salicola_phage	35.1	4.1e-30
WP_071480450.1|1838461_1838839_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_071480451.1|1838910_1839249_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_071480452.1|1839469_1839979_+	CarD family transcriptional regulator	NA	NA	NA	NA	NA
WP_071480453.1|1840116_1840857_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_071480454.1|1840863_1841763_-	DMT family transporter	NA	NA	NA	NA	NA
WP_134013932.1|1841840_1844114_-	response regulator	NA	NA	NA	NA	NA
WP_071480455.1|1844299_1845457_-	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_071480456.1|1845666_1846077_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_071480457.1|1846184_1846976_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_071480458.1|1847040_1848078_-|holin	choline ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	34.0	1.5e-20
WP_071480459.1|1848074_1848926_-|holin	choline ABC transporter permease subunit	holin	NA	NA	NA	NA
WP_071482034.1|1848987_1849911_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_071480460.1|1850013_1850598_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_071480461.1|1850594_1852046_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_071480462.1|1852202_1853852_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.0	1.7e-58
