The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017954	Lactiplantibacillus plantarum strain C410L1 chromosome, complete genome	3097773	383727	437867	3097773	portal,capsid,head,terminase,integrase,tail,holin	Lactobacillus_phage(77.5%)	67	397912:397932	438253:438273
WP_061468360.1|383727_384885_-|integrase	site-specific integrase	integrase	Q938N9	Temperate_phage	34.8	6.6e-54
WP_003643618.1|384963_385608_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003643619.1|385755_385935_+	helix-turn-helix domain-containing protein	NA	E9LUT5	Lactobacillus_phage	89.7	2.5e-21
WP_061468359.1|386217_386436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061468358.1|386432_387233_+	bifunctional DNA primase/polymerase	NA	NA	NA	NA	NA
WP_061468357.1|387232_388627_+	virulence protein	NA	Q4ZD27	Staphylococcus_phage	35.8	2.7e-70
WP_003645297.1|388770_389190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024971524.1|389214_389397_+	sporulation protein Cse60	NA	NA	NA	NA	NA
WP_061468356.1|389406_389745_+|head	phage head closure protein	head	A0A2P0ZLF0	Lactobacillus_phage	35.6	4.6e-08
WP_061468355.1|389737_390127_+	HNH endonuclease	NA	A0A1J0MFT4	Staphylococcus_phage	45.2	3.0e-19
WP_071542597.1|390740_391214_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_071542599.1|391210_392914_+|terminase	terminase large subunit	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	40.1	1.3e-119
WP_071542602.1|393068_394175_+|portal	phage portal protein	portal	A0A2H4J9Q5	uncultured_Caudovirales_phage	33.6	1.0e-48
WP_071542604.1|394164_395763_+|capsid	phage major capsid protein	capsid	A0A1J0MFW8	Staphylococcus_phage	33.4	1.2e-40
WP_071542605.1|395979_396249_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_071542607.1|396415_396787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016511207.1|396869_397175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642774.1|397594_397801_+	hypothetical protein	NA	NA	NA	NA	NA
397912:397932	attL	CCGTGCGGGTGATAAGTCGAC	NA	NA	NA	NA
WP_070083730.1|398152_399274_-|integrase	tyrosine-type recombinase/integrase	integrase	D6PSS4	Lactobacillus_phage	32.7	1.7e-46
WP_070083729.1|399781_400699_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	Q4ZE81	Staphylococcus_phage	51.9	4.3e-16
WP_080396925.1|400886_401063_-	hypothetical protein	NA	A0A2P0ZL93	Lactobacillus_phage	53.4	9.1e-08
WP_071542609.1|401346_401685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071542611.1|401644_402220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061468341.1|402270_403617_-	DUF4041 domain-containing protein	NA	A0A1B0Y697	Lactobacillus_phage	51.8	1.1e-81
WP_061468340.1|403642_404056_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_011101778.1|404067_404430_-	helix-turn-helix domain-containing protein	NA	A0A2R2ZGJ3	Clostridioides_phage	48.4	1.7e-08
WP_061468339.1|404558_404786_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003642792.1|404782_404953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071542613.1|404965_405271_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_071542614.1|405338_405851_+	helix-turn-helix transcriptional regulator	NA	D6PST4	Lactobacillus_phage	43.5	1.0e-27
WP_074161518.1|406221_406608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071542618.1|406604_407492_+	recombinase RecT	NA	E9LUM3	Lactobacillus_phage	47.3	4.3e-61
WP_071542855.1|407523_408276_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0P0IZH9	Lactobacillus_phage	50.6	5.0e-71
WP_071542620.1|408357_409194_+	DUF4373 domain-containing protein	NA	NA	NA	NA	NA
WP_071542621.1|409174_410017_+	ATP-binding protein	NA	O03914	Lactobacillus_phage	95.7	2.5e-151
WP_016527203.1|410173_410896_+	phage antirepressor KilAC domain-containing protein	NA	Q8SDM9	Staphylococcus_phage	45.6	2.1e-50
WP_071542623.1|410900_411419_+	hypothetical protein	NA	O03915	Lactobacillus_phage	53.9	2.3e-38
WP_003642802.1|411415_411790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071542624.1|411792_412104_+	hypothetical protein	NA	A0A2P0ZLB4	Lactobacillus_phage	98.1	1.6e-52
WP_155118873.1|412268_412418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155118874.1|412419_412569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071542626.1|412552_412954_+	hypothetical protein	NA	D6PSV5	Lactobacillus_phage	56.0	3.9e-30
WP_033609727.1|413250_413721_+	hypothetical protein	NA	B4XYT9	Lactobacillus_phage	40.0	1.9e-15
WP_071542628.1|414417_414945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071542630.1|414937_415654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071542632.1|415663_416686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071542634.1|416802_416991_+	hypothetical protein	NA	E9LUP6	Lactobacillus_phage	63.8	2.7e-10
WP_071542636.1|417176_417695_+|terminase	terminase small subunit	terminase	O03926	Lactobacillus_phage	86.0	2.0e-71
WP_071542638.1|417675_419019_+|terminase	PBSX family phage terminase large subunit	terminase	O03927	Lactobacillus_phage	95.7	1.1e-257
WP_071542856.1|419028_420555_+|portal	phage portal protein	portal	O03928	Lactobacillus_phage	82.1	6.3e-246
WP_071542640.1|420551_421694_+|capsid	capsid protein	capsid	O03929	Lactobacillus_phage	92.4	1.3e-166
WP_071542643.1|422390_423272_+|capsid	capsid protein	capsid	U3PDP8	Lactobacillus_phage	59.4	3.5e-92
WP_071542644.1|423292_423721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071542646.1|423720_424071_+|capsid	capsid protein	capsid	O03932	Lactobacillus_phage	91.4	2.3e-55
WP_071542647.1|424070_424418_+|capsid	capsid protein	capsid	O03933	Lactobacillus_phage	92.2	9.4e-57
WP_071542648.1|424417_424822_+|capsid	minor capsid protein	capsid	O03934	Lactobacillus_phage	96.3	2.0e-66
WP_071542650.1|424856_425411_+|capsid	capsid protein	capsid	O03972	Lactobacillus_phage	90.9	2.6e-85
WP_071542651.1|425461_425893_+	hypothetical protein	NA	O03935	Lactobacillus_phage	95.8	3.1e-73
WP_071542653.1|425898_426522_+	hypothetical protein	NA	O03936	Lactobacillus_phage	95.5	5.4e-103
WP_071542655.1|426525_431388_+	peptidoglycan DD-metalloendopeptidase family protein	NA	O03937	Lactobacillus_phage	59.9	0.0e+00
WP_071542657.1|431384_432233_+|tail	phage tail family protein	tail	D2KRB8	Lactobacillus_phage	46.4	3.0e-64
WP_071542658.1|432236_433385_+|tail	phage tail protein	tail	D2KRB9	Lactobacillus_phage	30.6	1.5e-53
WP_071542659.1|433374_433698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071542660.1|433694_435908_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_071542857.1|436093_437206_+	LysM peptidoglycan-binding domain-containing protein	NA	O03950	Lactobacillus_phage	35.9	1.3e-35
WP_016511341.1|437206_437503_+	hypothetical protein	NA	A0A1I9KK55	Lactobacillus_phage	77.6	4.4e-39
WP_071542661.1|437489_437867_+|holin	holin	holin	A0A2H4PBB2	Lactobacillus_phage	83.3	3.7e-14
438253:438273	attR	CCGTGCGGGTGATAAGTCGAC	NA	NA	NA	NA
>prophage 2
NZ_CP017954	Lactiplantibacillus plantarum strain C410L1 chromosome, complete genome	3097773	1263704	1273305	3097773		Lactobacillus_phage(87.5%)	9	NA	NA
WP_003645220.1|1263704_1264700_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	38.8	3.1e-52
WP_015380221.1|1265326_1265464_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_003643094.1|1265559_1266000_+	nucleoside 2-deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	99.3	8.0e-77
WP_016527054.1|1266070_1266631_-	hypothetical protein	NA	A0A2P0ZL75	Lactobacillus_phage	99.5	1.3e-100
WP_015380220.1|1266718_1269157_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	99.5	0.0e+00
WP_003643097.1|1269159_1269774_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	100.0	6.3e-112
WP_003645222.1|1270117_1271065_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	99.7	1.7e-177
WP_015640259.1|1271250_1272222_+	Nisin resistance protein	NA	A0A2P0ZL68	Lactobacillus_phage	98.8	2.0e-181
WP_071542710.1|1272312_1273305_-	hypothetical protein	NA	A0A2P0ZL72	Lactobacillus_phage	77.1	3.2e-158
>prophage 3
NZ_CP017954	Lactiplantibacillus plantarum strain C410L1 chromosome, complete genome	3097773	1299407	1367839	3097773	tRNA,capsid,protease,head,terminase,integrase,tail,holin	Lactobacillus_phage(84.44%)	72	1320921:1320937	1362114:1362130
WP_003645238.1|1299407_1301096_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.9	1.2e-75
WP_003645239.1|1301367_1301814_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003643130.1|1302202_1302448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016527046.1|1302574_1303966_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_003645240.1|1304241_1306017_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_016527045.1|1306449_1308189_-	aryl-sulfate sulfotransferase	NA	NA	NA	NA	NA
WP_003645242.1|1308409_1309366_-	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_003645243.1|1309355_1309979_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	40.6	4.8e-27
WP_003645244.1|1309981_1311157_-	sulfate adenylyltransferase	NA	A0A2P1ELS9	Moumouvirus	31.7	1.4e-48
WP_003645245.1|1311134_1312772_-	sulfotransferase family protein	NA	NA	NA	NA	NA
WP_003645246.1|1313660_1315967_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_011101376.1|1315980_1317837_+	bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_003645248.1|1317909_1318269_+	YisL family protein	NA	NA	NA	NA	NA
WP_003643142.1|1318368_1318890_-	GtrA family protein	NA	NA	NA	NA	NA
WP_016527043.1|1318995_1320009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003645249.1|1320173_1320599_+	hypothetical protein	NA	NA	NA	NA	NA
1320921:1320937	attL	CTGCCTGGGGCATAATT	NA	NA	NA	NA
WP_071542712.1|1321175_1321553_-|holin	holin	holin	A0A2K9VCG4	Lactobacillus_phage	62.5	1.3e-14
WP_021357089.1|1321564_1321828_-	hemolysin XhlA family protein	NA	E9LUR9	Lactobacillus_phage	92.0	3.4e-35
WP_071542713.1|1321827_1322988_-	LysM peptidoglycan-binding domain-containing protein	NA	E9LUR8	Lactobacillus_phage	87.2	3.6e-193
WP_071542714.1|1322999_1323254_-	hypothetical protein	NA	A0A0A1ENR9	Lactobacillus_phage	82.0	2.2e-18
WP_071542715.1|1323253_1324252_-	hypothetical protein	NA	A0A2P0ZLF6	Lactobacillus_phage	86.4	9.7e-62
WP_162985027.1|1324235_1324397_-	hypothetical protein	NA	A0A2P0ZLG1	Lactobacillus_phage	94.3	6.1e-19
WP_071542716.1|1324400_1324640_-	hypothetical protein	NA	A0A2K9VDF6	Lactobacillus_phage	93.5	2.7e-31
WP_071542717.1|1324632_1327410_-	hypothetical protein	NA	E9LUR4	Lactobacillus_phage	94.6	5.1e-177
WP_071542718.1|1327411_1329769_-|tail	phage tail protein	tail	E9LUR3	Lactobacillus_phage	92.2	0.0e+00
WP_071542719.1|1329834_1331604_-|tail	phage tail family protein	tail	E9LUR2	Lactobacillus_phage	91.3	0.0e+00
WP_071542720.1|1331676_1336560_-	C40 family peptidase	NA	A0A2P0ZLG0	Lactobacillus_phage	57.4	0.0e+00
WP_015640500.1|1336591_1336777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071542721.1|1336821_1337196_-|tail	phage tail assembly chaperone	tail	A0A2P0ZLH4	Lactobacillus_phage	95.2	5.4e-58
WP_071542722.1|1337271_1337925_-|tail	phage tail protein	tail	A0A2P0ZLH1	Lactobacillus_phage	89.4	2.9e-107
WP_071542723.1|1337938_1338319_-	DUF806 family protein	NA	A0A2P0ZLF4	Lactobacillus_phage	92.1	2.9e-59
WP_071542724.1|1338318_1338726_-	HK97 gp10 family phage protein	NA	A0A2P0ZLE6	Lactobacillus_phage	93.2	6.5e-65
WP_041142734.1|1338728_1339076_-|head	phage head closure protein	head	A0A2P0ZLF0	Lactobacillus_phage	72.2	1.2e-43
WP_071542725.1|1339062_1339398_-|head,tail	phage gp6-like head-tail connector protein	head,tail	E9LUQ4	Lactobacillus_phage	85.5	1.2e-45
WP_071542726.1|1339470_1340703_-|capsid	phage major capsid protein	capsid	E9LUQ3	Lactobacillus_phage	91.2	6.7e-206
WP_071542727.1|1340702_1341452_-|protease	Clp protease ClpP	protease	E9LUQ2	Lactobacillus_phage	93.6	8.7e-124
WP_071542728.1|1342628_1342823_-	DUF1056 family protein	NA	E9LUQ0	Lactobacillus_phage	95.3	8.2e-26
WP_071542729.1|1342812_1344711_-|terminase	terminase large subunit	terminase	E9LUP9	Lactobacillus_phage	96.7	0.0e+00
WP_187337823.1|1345865_1346012_-	hypothetical protein	NA	E9LUP6	Lactobacillus_phage	82.1	9.8e-16
WP_071542730.1|1346035_1346302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071542731.1|1346703_1347135_-	transcriptional regulator	NA	E9LUP5	Lactobacillus_phage	95.8	1.6e-74
WP_071542860.1|1347634_1348069_-	hypothetical protein	NA	Q5ULU9	Lactobacillus_virus	59.3	2.2e-42
WP_155118875.1|1348244_1348403_-	hypothetical protein	NA	A0A2P0ZLB5	Lactobacillus_phage	92.0	1.6e-16
WP_071542734.1|1348445_1348655_-	hypothetical protein	NA	D6PSV2	Lactobacillus_phage	98.6	1.8e-31
WP_071542735.1|1348651_1349029_-	endodeoxyribonuclease	NA	NA	NA	NA	NA
WP_071542861.1|1349025_1349544_-	hypothetical protein	NA	O03915	Lactobacillus_phage	52.6	1.5e-37
WP_071542736.1|1349703_1350489_-	ATP-binding protein	NA	E9LUN6	Lactobacillus_phage	90.8	5.3e-132
WP_071542737.1|1351305_1351998_-	hypothetical protein	NA	E9LUU3	Lactobacillus_phage	88.7	2.5e-117
WP_071542738.1|1352012_1352417_-	single-stranded DNA-binding protein	NA	D6PSU2	Lactobacillus_phage	65.7	3.7e-44
WP_071542739.1|1352413_1353061_-	ERF family protein	NA	D6PSU1	Lactobacillus_phage	59.0	3.0e-64
WP_071542740.1|1353063_1353474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_187337824.1|1353574_1353721_-	hypothetical protein	NA	E9LUT9	Lactobacillus_phage	89.4	5.2e-17
WP_071542741.1|1353890_1354145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021732031.1|1354233_1354563_-	DUF771 domain-containing protein	NA	E9LUT3	Lactobacillus_phage	82.6	2.0e-48
WP_071542742.1|1354655_1355375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015825325.1|1355538_1355748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080487843.1|1355759_1356503_-	ORF6C domain-containing protein	NA	A0A1P8BM06	Lactococcus_phage	45.6	8.2e-50
WP_071542744.1|1356508_1356730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063733609.1|1356975_1357314_+	helix-turn-helix transcriptional regulator	NA	Q8W5Y0	Listeria_phage	43.1	4.6e-16
WP_071542862.1|1357323_1357602_+	hypothetical protein	NA	D2KRD5	Lactobacillus_phage	58.0	1.8e-21
WP_071542745.1|1357658_1358435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641358.1|1358446_1358647_+	hypothetical protein	NA	E9LUS6	Lactobacillus_phage	100.0	4.9e-26
WP_027822546.1|1358952_1359135_+	hypothetical protein	NA	A0A2P0ZL93	Lactobacillus_phage	66.7	8.8e-14
WP_071542746.1|1359319_1359634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056988408.1|1359705_1359936_-	hypothetical protein	NA	U5U783	Lactobacillus_phage	47.5	5.4e-08
WP_063485466.1|1359959_1360697_+	hypothetical protein	NA	U5U717	Lactobacillus_phage	40.7	4.4e-35
WP_070085494.1|1360860_1361997_+|integrase	site-specific integrase	integrase	E9LUS1	Lactobacillus_phage	98.7	2.6e-212
WP_041142698.1|1362641_1364909_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	31.5	2.0e-118
1362114:1362130	attR	CTGCCTGGGGCATAATT	NA	NA	NA	NA
WP_003643147.1|1364973_1365261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003643148.1|1365375_1365888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003643149.1|1366004_1366481_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003645251.1|1367152_1367839_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 4
NZ_CP017954	Lactiplantibacillus plantarum strain C410L1 chromosome, complete genome	3097773	1690648	1754483	3097773	bacteriocin,transposase,tRNA,protease,integrase	Lactobacillus_phage(26.67%)	55	1719296:1719317	1723114:1723135
WP_003641210.1|1690648_1690978_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003645735.1|1691186_1691855_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_016526995.1|1691986_1692556_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011101234.1|1692606_1693371_-	YibE/F family protein	NA	NA	NA	NA	NA
WP_015640120.1|1693367_1694618_-	YibE/F family protein	NA	NA	NA	NA	NA
WP_003645738.1|1694581_1695583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641204.1|1696002_1696785_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003641203.1|1697119_1697446_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003645740.1|1697637_1698519_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_016511043.1|1698561_1700370_-	DNA helicase RecQ	NA	M1PGQ0	Moumouvirus	36.1	1.0e-77
WP_071542761.1|1700627_1700825_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003644064.1|1701044_1701311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003645742.1|1701361_1702594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641197.1|1702629_1704036_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_003641196.1|1704488_1705496_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	43.0	1.4e-63
WP_003645743.1|1705534_1706830_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	31.2	4.2e-57
WP_016526992.1|1707000_1707630_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_003641193.1|1707738_1708212_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080487831.1|1708490_1710380_-	FAD-binding protein	NA	A0A2P0ZL82	Lactobacillus_phage	26.2	8.9e-16
WP_003645746.1|1710566_1711493_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.8	3.2e-19
WP_003644057.1|1711563_1712115_-	helix-turn-helix domain-containing protein	NA	X2CXD8	Lactobacillus_phage	48.4	4.9e-07
WP_003645747.1|1712214_1712967_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003644055.1|1713035_1713530_-	kinase	NA	NA	NA	NA	NA
WP_003645748.1|1713618_1713738_-	putative metal homeostasis protein	NA	NA	NA	NA	NA
WP_071542762.1|1713946_1717720_+	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_003645751.1|1717834_1718365_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_071542763.1|1718678_1719275_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_046783358.1|1719282_1719870_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
1719296:1719317	attL	CTTGGGAGCAGCGTAAGCTAAA	NA	NA	NA	NA
WP_015379944.1|1719880_1720798_-|integrase	site-specific integrase	integrase	A8ATM2	Listeria_phage	44.7	2.7e-74
WP_016526887.1|1721065_1721995_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	3.2e-19
WP_016526988.1|1722089_1723187_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	27.4	8.5e-11
1723114:1723135	attR	TTTAGCTTACGCTGCTCCCAAG	NA	NA	NA	NA
WP_016526987.1|1723183_1724770_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	62.9	4.2e-176
WP_016526986.1|1724783_1727657_-	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_003645758.1|1727884_1730419_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	27.4	3.5e-68
WP_003644050.1|1730600_1731173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003644049.1|1731278_1731611_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_003645760.1|1731972_1732983_-	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_016526985.1|1733114_1733915_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_016526984.1|1734118_1734559_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_003644046.1|1734619_1735042_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_003641174.1|1735056_1735239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003644045.1|1735251_1735797_-	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_003641172.1|1735808_1736063_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_016526983.1|1736303_1738151_-	acetyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	23.7	5.8e-20
WP_003645764.1|1738140_1738524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003645765.1|1739008_1741510_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_015640093.1|1743154_1744030_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	28.9	2.8e-20
WP_003645768.1|1744038_1744746_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071542764.1|1744901_1745246_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003645770.1|1745465_1746149_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003641165.1|1746714_1747083_+	helix-turn-helix transcriptional regulator	NA	E9LUL4	Lactobacillus_phage	42.7	5.9e-17
WP_003641164.1|1747316_1747685_+	membrane protein	NA	NA	NA	NA	NA
WP_041161819.1|1748221_1749646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641157.1|1751424_1751943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016526887.1|1753553_1754483_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	3.2e-19
>prophage 5
NZ_CP017954	Lactiplantibacillus plantarum strain C410L1 chromosome, complete genome	3097773	1946961	1955585	3097773		Streptococcus_phage(66.67%)	11	NA	NA
WP_003643943.1|1946961_1947957_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.2	5.9e-51
WP_003640969.1|1948095_1948881_-	acyl-ACP thioesterase	NA	NA	NA	NA	NA
WP_003643942.1|1948884_1949781_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	55.7	9.9e-82
WP_003640967.1|1949879_1950227_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	33.3	2.4e-12
WP_003640966.1|1950251_1951271_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	33.5	2.1e-32
WP_003640965.1|1951287_1951617_-	cyclic-di-AMP receptor	NA	NA	NA	NA	NA
WP_003644908.1|1951613_1952279_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.7	1.4e-53
WP_003640957.1|1952676_1952928_-	YaaL family protein	NA	NA	NA	NA	NA
WP_003637790.1|1952942_1953542_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_003640956.1|1953557_1953866_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_003644909.1|1953887_1955585_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	37.0	3.9e-55
>prophage 6
NZ_CP017954	Lactiplantibacillus plantarum strain C410L1 chromosome, complete genome	3097773	2088895	2144417	3097773	bacteriocin,tRNA,protease	uncultured_Mediterranean_phage(20.0%)	53	NA	NA
WP_003646511.1|2088895_2090167_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.7	4.5e-96
WP_003642042.1|2090634_2092248_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.9	1.2e-143
WP_003642041.1|2092420_2093029_-	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_003642040.1|2093073_2093514_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_015639962.1|2093876_2094809_+	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_169484456.1|2094817_2096176_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	32.9	5.2e-26
WP_003646508.1|2096195_2097005_+	sugar-phosphatase	NA	NA	NA	NA	NA
WP_003643831.1|2097174_2098161_-	lipoprotein	NA	NA	NA	NA	NA
WP_003646506.1|2098243_2099266_-	YdcF family protein	NA	NA	NA	NA	NA
WP_003643830.1|2099555_2100536_-	ribose-phosphate diphosphokinase	NA	A0A2K9L8D8	Tupanvirus	36.3	4.9e-42
WP_003646505.1|2100901_2101726_-	serine hydrolase	NA	NA	NA	NA	NA
WP_071542781.1|2101961_2103344_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L140	Tupanvirus	33.6	1.5e-28
WP_003642030.1|2103412_2104249_-	pur operon repressor	NA	NA	NA	NA	NA
WP_003642029.1|2104741_2105005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071542782.1|2105019_2105562_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_003646500.1|2106642_2107440_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_003642023.1|2107432_2108131_-	ABC transporter ATP-binding protein	NA	A0A1V0SGN0	Hokovirus	27.8	1.2e-15
WP_003642022.1|2108397_2109342_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003643828.1|2109651_2110518_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_003642020.1|2110650_2110902_-	Veg family protein	NA	NA	NA	NA	NA
WP_003646498.1|2111006_2111897_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_011101014.1|2111893_2112457_-	ribonuclease M5	NA	NA	NA	NA	NA
WP_069137150.1|2112443_2113220_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_003646496.1|2113471_2113960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016511603.1|2115445_2116630_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_003646493.1|2116862_2118914_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	35.8	2.7e-90
WP_071542783.1|2119231_2119621_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_003642012.1|2120217_2121060_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_003646490.1|2121059_2121764_-	NAD-dependent protein deacylase	NA	NA	NA	NA	NA
WP_071542784.1|2121785_2122745_-	IpaB/EvcA family protein	NA	NA	NA	NA	NA
WP_003642009.1|2122737_2124012_-	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_003642008.1|2124057_2124975_-	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_003646487.1|2125416_2126430_-|tRNA	tRNA-dihydrouridine synthase family protein	tRNA	NA	NA	NA	NA
WP_003646486.1|2126660_2127026_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A1S5SAB3	Streptococcus_phage	44.1	1.8e-21
WP_003646485.1|2127012_2127231_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003646484.1|2127364_2127787_-	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_003641999.1|2127776_2127965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641998.1|2127971_2129333_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_071542785.1|2129405_2130116_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071542786.1|2130523_2131540_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003646481.1|2131979_2132756_-	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
WP_003646480.1|2133014_2135324_+	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003646479.1|2135613_2135907_-	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	48.3	9.9e-07
WP_101494318.1|2135938_2136211_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_003646477.1|2136326_2137013_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_071542787.1|2137106_2137787_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003646475.1|2137873_2138542_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003646474.1|2138609_2139299_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003646473.1|2139388_2140765_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_071542788.1|2140780_2142931_-	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	27.7	1.8e-44
WP_003646471.1|2143197_2143362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003643811.1|2143386_2143545_+|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnF	bacteriocin	NA	NA	NA	NA
WP_003646470.1|2143643_2144417_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 1
NZ_CP017955	Lactiplantibacillus plantarum strain C410L1 plasmid unnamed1, complete sequence	73978	484	68671	73978	transposase,holin,protease	uncultured_Caudovirales_phage(11.11%)	60	NA	NA
WP_006293514.1|484_589_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_071542869.1|988_1231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071542870.1|1304_1940_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_071542871.1|1941_4131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062689804.1|4102_4570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016526645.1|4587_5088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080487850.1|5089_5383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080487844.1|5694_6603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071542874.1|6621_7047_-	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_016526641.1|7043_7343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016526640.1|7339_7558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080487851.1|7559_7772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071542876.1|7771_8728_-	hypothetical protein	NA	A0A2H4JAH5	uncultured_Caudovirales_phage	48.2	5.7e-35
WP_071542877.1|9544_10174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071542878.1|10186_11347_-	CHAP domain-containing protein	NA	A0A0A0RSI6	Bacillus_phage	35.5	7.6e-10
WP_071542879.1|11347_11554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071542880.1|11556_13509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071542881.1|13524_14184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071542882.1|14155_14539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071542883.1|14802_17364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071542884.1|17683_19216_-	primase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_016526629.1|19994_20768_+	ParA family protein	NA	F0PIG8	Enterococcus_phage	36.6	4.3e-33
WP_016526628.1|20770_20995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016526627.1|21169_21481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071542885.1|21594_22896_+	Y-family DNA polymerase	NA	M1Q231	Streptococcus_phage	40.0	9.9e-83
WP_071542886.1|22888_23209_+	acetyl-CoA carboxylase	NA	NA	NA	NA	NA
WP_071542887.1|23201_23585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_187337826.1|24067_24460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155118879.1|24410_24686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071542890.1|25074_25446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071542891.1|25420_25885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155118880.1|25885_26059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080487845.1|29131_29416_-	BRCT domain-containing protein	NA	NA	NA	NA	NA
WP_071542894.1|29530_29866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071542895.1|31119_32511_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_071542896.1|35734_36760_-	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_071542897.1|36761_37463_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_071542898.1|37523_38444_-|transposase	IS30-like element ISLsa1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	38.2	9.2e-51
WP_071542899.1|39013_39787_-	tyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_071542900.1|39773_40502_-	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_071542901.1|40513_41284_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_080487846.1|42116_42419_-	VanZ family protein	NA	NA	NA	NA	NA
WP_071542903.1|42900_44076_-|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	29.2	7.0e-27
WP_071542904.1|44312_45359_-	glycosyltransferase family 2 protein	NA	A0A0F7L2F7	uncultured_marine_virus	29.6	3.0e-05
WP_155118882.1|45351_46473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071542906.1|46538_47258_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_071542908.1|47632_48127_-	glycosyl transferase	NA	NA	NA	NA	NA
WP_071542909.1|48126_48576_-	UDP-N-acetylglucosamine--LPS N-acetylglucosamine transferase	NA	NA	NA	NA	NA
WP_065201559.1|52006_52645_+	sugar transferase	NA	NA	NA	NA	NA
WP_155118883.1|53248_54036_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_071542913.1|54973_56380_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_071542914.1|56392_57226_-	LicD family protein	NA	A0A1V0SD50	Indivirus	34.1	9.4e-10
WP_071542915.1|57313_58147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_187337825.1|59525_60077_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_071542918.1|60178_60475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071542919.1|60550_63490_-	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
WP_071542920.1|63518_64298_-	class A sortase	NA	NA	NA	NA	NA
WP_071542921.1|64307_66413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071542922.1|66506_66821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071542923.1|66886_68671_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	33.8	8.8e-82
>prophage 1
NZ_CP017956	Lactiplantibacillus plantarum strain C410L1 plasmid unnamed2, complete sequence	71134	14635	61194	71134	protease,holin,transposase	Bacillus_phage(15.38%)	37	NA	NA
WP_071542944.1|14635_15271_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_071542945.1|15551_15656_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_016526651.1|15717_16242_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155118884.1|16196_17093_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	36.2	2.1e-39
WP_071542946.1|17701_19864_+	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	46.3	2.2e-103
WP_071542947.1|20119_20326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071542948.1|20749_20989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016526772.1|22031_22226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071542951.1|22228_22861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071542952.1|22863_24648_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	33.6	4.0e-82
WP_016526775.1|24714_25029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071542953.1|25124_27227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071542954.1|27236_28025_+	class A sortase	NA	NA	NA	NA	NA
WP_071542957.1|31068_31365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071542958.1|31746_31926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_187337827.1|33181_33340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071542959.1|34782_36399_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	50.3	2.1e-127
WP_071542960.1|36412_39580_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	22.7	9.0e-21
WP_155118887.1|39782_40178_+	recombinase family protein	NA	A0A0A8WIK3	Clostridium_phage	43.1	1.2e-20
WP_071542962.1|40300_41014_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_071542963.1|41098_41992_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	29.7	5.7e-21
WP_010012236.1|41988_42663_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	33.3	6.2e-28
WP_071542980.1|43142_44471_+	MFS transporter	NA	NA	NA	NA	NA
WP_003567312.1|44671_45229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071542965.1|45462_45879_-	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	56.9	3.9e-33
WP_071542966.1|45901_46237_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_071542967.1|46292_47213_-|transposase	IS30-like element ISLsa1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	37.9	1.7e-49
WP_071542967.1|48388_49309_-|transposase	IS30-like element ISLsa1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	37.9	1.7e-49
WP_155118886.1|51848_52010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056953201.1|52147_52444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003646125.1|52892_53429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003636336.1|53710_54292_+	recombinase family protein	NA	A0A1J1J8Z4	Escherichia_phage	45.1	7.2e-33
WP_071542968.1|54738_55161_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_071542969.1|55653_56052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071542970.1|56190_56472_+	BRCT domain-containing protein	NA	NA	NA	NA	NA
WP_071542971.1|56654_59363_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_071542972.1|59532_61194_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	41.5	4.6e-93
>prophage 1
NZ_CP017957	Lactiplantibacillus plantarum strain C410L1 plasmid unnamed3, complete sequence	30542	0	4978	30542	transposase	unidentified_phage(100.0%)	4	NA	NA
WP_016511784.1|709_2083_-	MFS transporter	NA	NA	NA	NA	NA
WP_016511783.1|2122_3652_-	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_003576326.1|3778_3970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071542982.1|4048_4978_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	29.8	1.1e-24
>prophage 2
NZ_CP017957	Lactiplantibacillus plantarum strain C410L1 plasmid unnamed3, complete sequence	30542	9283	10858	30542		Clostridium_phage(50.0%)	2	NA	NA
WP_016511420.1|9283_9868_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	30.5	1.2e-11
WP_016511421.1|10048_10858_+	ParA family protein	NA	A0A1V0DZZ0	Clostridioides_phage	27.8	5.1e-21
>prophage 3
NZ_CP017957	Lactiplantibacillus plantarum strain C410L1 plasmid unnamed3, complete sequence	30542	25953	30027	30542	transposase	Streptococcus_phage(50.0%)	4	NA	NA
WP_003580213.1|25953_26649_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.7	8.3e-36
WP_071542987.1|26816_27740_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	2.1e-31
WP_003577309.1|27932_29771_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	28.9	2.6e-68
WP_016511950.1|29814_30027_+	tyrosine recombinase	NA	A0A1S5SEW4	Streptococcus_phage	45.6	5.4e-07
