The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013113	Pseudomonas aeruginosa strain Paer4_119 chromosome, complete genome	6504659	652497	715362	6504659	tail,tRNA,integrase,plate	Pseudomonas_phage(23.33%)	61	644303:644319	716656:716672
644303:644319	attL	AGCGCGCGGTGGAGCTG	NA	NA	NA	NA
WP_003121829.1|652497_653571_-|integrase	site-specific integrase	integrase	W6MYA3	Pseudomonas_phage	38.9	3.2e-47
WP_031687214.1|653791_657529_-	bifunctional diguanylate cyclase/phosphodiesterase	NA	A0A127AWB9	Bacillus_phage	35.4	4.8e-13
WP_003085035.1|657635_659489_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.8	1.2e-36
WP_003121834.1|659568_661563_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	40.7	3.8e-73
WP_003085042.1|661645_662095_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	38.8	5.0e-18
WP_003085057.1|662164_662380_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_003099590.1|662580_663606_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.1	1.4e-108
WP_003085061.1|663684_664254_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_003099587.1|664337_664691_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_003099585.1|664681_665224_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_003121835.1|665196_666429_-	multifunctional CCA addition/repair protein	NA	A0A076G5T8	Escherichia_phage	43.1	2.6e-77
WP_003085071.1|666472_666979_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_003099581.1|667072_668626_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_003099579.1|668622_669894_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.2	4.2e-09
WP_003085078.1|669994_671917_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_003099577.1|672195_672528_-	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_003121837.1|672571_673423_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	33.3	1.1e-08
WP_003121838.1|673422_673803_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_003121839.1|673839_674646_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_003085089.1|674761_675748_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_003109024.1|675744_677037_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_029610110.1|677017_679810_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_003099554.1|679936_680953_+	phosphotransferase	NA	NA	NA	NA	NA
WP_003099549.1|680949_681624_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_003099547.1|681625_682384_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_003099546.1|682384_683446_-	DUF3530 family protein	NA	NA	NA	NA	NA
WP_003142788.1|683597_685991_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_003099542.1|686039_686669_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003085106.1|686797_687832_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_003085109.1|688065_689175_+	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.4	7.8e-28
WP_003099539.1|689230_690277_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003113206.1|690391_691639_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003099535.1|691744_692575_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003085122.1|692698_693373_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_003099532.1|693372_694191_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_003085126.1|694263_695742_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_003121843.1|696058_696373_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_003113202.1|696472_697243_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	59.1	1.4e-71
WP_003085132.1|697700_697901_+	repressor PtrB	NA	W6ATC1	Enterobacter_phage	58.3	3.7e-05
WP_003118907.1|697948_698308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003118908.1|698670_699120_+	hypothetical protein	NA	B5TK61	Pseudomonas_phage	53.3	5.0e-26
WP_003101620.1|699141_699657_+	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	43.4	1.8e-32
WP_003121844.1|699653_700211_+|plate	phage baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	70.3	6.0e-45
WP_003121845.1|700363_700690_+	hypothetical protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	59.3	9.2e-30
WP_003161928.1|700686_701574_+	bacteriophage protein	NA	S4TNY7	Salmonella_phage	59.8	4.1e-88
WP_003118911.1|701566_702100_+|tail	phage tail protein I	tail	Q9ZXK7	Pseudomonas_virus	64.6	3.9e-62
WP_003161927.1|702101_704207_+|tail	phage tail fiber protein	tail	Q9ZXK6	Pseudomonas_virus	52.7	3.0e-222
WP_016852415.1|704214_704655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003121848.1|704697_705858_+|tail	phage tail sheath family protein	tail	Q38068	Phage_PS17	83.4	1.2e-188
WP_003085175.1|705870_706374_+|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	73.5	8.0e-65
WP_003085178.1|706388_706733_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_031638514.1|706902_709140_+|tail	phage tail length tape measure protein	tail	NA	NA	NA	NA
WP_003121850.1|709149_710022_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	52.1	4.6e-76
WP_003101635.1|709996_710203_+	hypothetical protein	NA	A0A2H4J9Z9	uncultured_Caudovirales_phage	64.2	2.3e-18
WP_003121851.1|710260_711250_+	phage late control D family protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	55.8	1.7e-106
WP_003113192.1|711282_711912_+	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	78.0	1.6e-86
WP_003121852.1|711908_712271_+	hypothetical protein	NA	H2BDA0	Pseudomonas_phage	47.9	4.2e-15
WP_003118919.1|712267_712525_+	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	64.6	8.3e-18
WP_003101640.1|712872_713478_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	65.8	6.0e-75
WP_003085203.1|713479_714529_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	57.8	1.8e-111
WP_003085205.1|714525_715362_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	56.9	2.1e-70
716656:716672	attR	AGCGCGCGGTGGAGCTG	NA	NA	NA	NA
>prophage 2
NZ_CP013113	Pseudomonas aeruginosa strain Paer4_119 chromosome, complete genome	6504659	1472286	1481314	6504659		Bacillus_phage(33.33%)	8	NA	NA
WP_003098558.1|1472286_1472922_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.3	1.0e-40
WP_003115226.1|1472967_1473861_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0S2SXL7	Bacillus_phage	34.3	3.0e-06
WP_003113871.1|1473965_1474970_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.3	7.0e-36
WP_003092272.1|1475395_1475719_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_003122151.1|1475785_1478353_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.1	2.4e-24
WP_003098486.1|1478478_1479486_-	TolB family protein	NA	NA	NA	NA	NA
WP_003092262.1|1479633_1480140_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	76.0	8.1e-57
WP_003092260.1|1480273_1481314_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	59.5	1.5e-113
>prophage 3
NZ_CP013113	Pseudomonas aeruginosa strain Paer4_119 chromosome, complete genome	6504659	2551909	2611236	6504659	capsid,tRNA,portal,plate,terminase,head,holin,tail,protease,integrase,lysis	Pseudomonas_virus(68.75%)	66	2575412:2575441	2612224:2612253
WP_003119971.1|2551909_2553037_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_003097654.1|2553080_2553551_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003122606.1|2553637_2555863_-	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_003090436.1|2556221_2557478_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	81.5	3.1e-17
WP_003090435.1|2557550_2557823_-	cold shock domain-containing protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	58.8	1.1e-15
WP_003097649.1|2558048_2558417_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	41.6	4.9e-11
WP_003090432.1|2558444_2560721_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.8	3.4e-163
WP_002553999.1|2560802_2561021_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_003097644.1|2561125_2561833_-	arginyltransferase	NA	NA	NA	NA	NA
WP_003108768.1|2561887_2562568_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_003122607.1|2562604_2563555_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.0	1.2e-61
WP_003119977.1|2563782_2566218_+	DNA translocase FtsK	NA	G1D482	Mycobacterium_virus	52.8	1.9e-87
WP_003090414.1|2566243_2566870_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_003097632.1|2566879_2568205_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	39.2	1.2e-80
WP_003097631.1|2568326_2569607_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.4	8.2e-98
WP_003113366.1|2569608_2571006_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_003097628.1|2571010_2571985_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_003108776.1|2572072_2573056_-	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	74.3	9.3e-142
WP_003090393.1|2573052_2573388_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	69.4	3.3e-38
WP_003090391.1|2573384_2573690_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_003090389.1|2573689_2574049_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	61.7	1.4e-34
WP_003090387.1|2574045_2574441_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	72.1	2.7e-47
WP_003090386.1|2574550_2575219_-	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	82.1	1.5e-90
2575412:2575441	attL	TGAGTTCGAATCTCACCGCCTCCGCCATAT	NA	NA	NA	NA
WP_039843340.1|2575559_2576729_-|integrase	site-specific integrase	integrase	A0A2H4JGM5	uncultured_Caudovirales_phage	65.8	2.6e-151
WP_071659023.1|2576949_2578860_-	DNA cytosine methyltransferase	NA	A0A0U1T6D1	Pseudomonas_phage	91.3	1.1e-279
WP_034086370.1|2579163_2579370_-	TraR/DksA family transcriptional regulator	NA	Q9ZXI6	Pseudomonas_virus	98.5	1.6e-32
WP_023089226.1|2579381_2579735_-	hypothetical protein	NA	Q9ZXI7	Pseudomonas_virus	97.4	2.4e-60
WP_071659024.1|2579779_2582500_-	bifunctional DNA primase/helicase	NA	Q9ZXI8	Pseudomonas_virus	97.0	0.0e+00
WP_003098410.1|2582496_2582730_-	hypothetical protein	NA	Q9ZXI9	Pseudomonas_virus	100.0	7.8e-39
WP_039843298.1|2582801_2583152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034063875.1|2583148_2583442_-	ogr/Delta-like zinc finger family protein	NA	Q9ZXJ1	Pseudomonas_virus	96.9	9.4e-50
WP_033936176.1|2583438_2583876_-	hypothetical protein	NA	Q9ZXJ2	Pseudomonas_virus	91.7	1.0e-68
WP_079396003.1|2584195_2584666_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_039843297.1|2584702_2585170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_126566000.1|2585315_2585723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_126565998.1|2585939_2586806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_126453141.1|2586798_2587395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139148416.1|2587488_2588052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039843294.1|2588175_2589447_-	phage late control D family protein	NA	Q9ZXJ8	Pseudomonas_virus	97.6	3.0e-233
WP_015967206.1|2589443_2589884_-|tail	phage tail protein	tail	Q9ZXJ9	Pseudomonas_virus	100.0	6.1e-77
WP_071659025.1|2589889_2592649_-|tail	phage tail tape measure protein	tail	Q9ZXK0	Pseudomonas_virus	94.7	0.0e+00
WP_003098394.1|2592638_2592758_-|tail	GpE family phage tail protein	tail	Q9ZXK1	Pseudomonas_virus	100.0	1.8e-15
WP_023093078.1|2592766_2593105_-|tail	phage tail assembly protein	tail	Q9ZXK2	Pseudomonas_virus	84.3	2.3e-39
WP_071659026.1|2593158_2593674_-|tail	phage major tail tube protein	tail	Q9ZXK3	Pseudomonas_virus	98.8	4.2e-93
WP_039843305.1|2593730_2594906_-|tail	phage tail sheath protein	tail	Q9ZXK4	Pseudomonas_virus	97.2	3.6e-217
WP_023876125.1|2594996_2595458_-|tail	tail fiber assembly protein	tail	Q9ZXK5	Pseudomonas_virus	53.9	8.5e-37
WP_039843304.1|2595509_2597900_-|tail	phage tail fiber protein	tail	Q9ZXK6	Pseudomonas_virus	88.6	0.0e+00
WP_015967199.1|2597901_2598438_-|tail	phage tail protein I	tail	Q9ZXK7	Pseudomonas_virus	100.0	1.4e-99
WP_071659027.1|2598437_2599352_-|plate	baseplate assembly protein	plate	Q9ZXK8	Pseudomonas_virus	98.4	1.0e-163
WP_033942401.1|2599348_2599693_-|plate	baseplate assembly protein	plate	Q9ZXK9	Pseudomonas_virus	96.5	2.3e-55
WP_048521465.1|2599689_2600262_-|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	98.4	3.0e-92
WP_153274382.1|2600439_2600868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039843367.1|2600877_2601336_-	phage virion morphogenesis protein	NA	Q9ZXL2	Pseudomonas_virus	88.7	3.2e-68
WP_016852031.1|2601328_2601865_-|tail	phage tail protein	tail	Q9ZXL3	Pseudomonas_virus	98.9	7.9e-95
WP_039843366.1|2601942_2602404_-|lysis	LysB family phage lysis regulatory protein	lysis	Q9ZXL5	Pseudomonas_virus	97.4	2.4e-71
WP_039843365.1|2602400_2603207_-	DUF3380 domain-containing protein	NA	Q9ZXL6	Pseudomonas_virus	97.4	4.2e-148
WP_016852027.1|2603203_2603476_-|holin	phage holin family protein	holin	Q9ZXL7	Pseudomonas_virus	98.9	1.2e-38
WP_003098379.1|2603477_2603831_-	hypothetical protein	NA	Q9ZXL8	Pseudomonas_virus	100.0	6.0e-59
WP_039843364.1|2603855_2604068_-|tail	tail protein X	tail	Q9ZXL9	Pseudomonas_virus	92.6	1.4e-31
WP_071659028.1|2604067_2604529_-|head	head completion/stabilization protein	head	Q9ZXM1	Pseudomonas_virus	99.3	3.6e-80
WP_071659029.1|2604632_2605334_-|terminase	terminase endonuclease subunit	terminase	Q9ZXM2	Pseudomonas_virus	98.7	8.1e-124
WP_071659030.1|2605339_2606356_-|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	99.1	5.0e-191
WP_015967183.1|2606391_2607213_-|capsid	GPO family capsid scaffolding protein	capsid	Q9ZXM4	Pseudomonas_virus	100.0	8.9e-130
WP_071659049.1|2607368_2609132_+|terminase	terminase ATPase subunit family protein	terminase	Q9ZXM5	Pseudomonas_virus	99.7	0.0e+00
WP_015967181.1|2609128_2610181_+|portal	phage portal protein	portal	Q9ZXM6	Pseudomonas_virus	100.0	2.7e-203
WP_039843228.1|2610375_2611236_-	ETX/MTX2 family pore-forming toxin	NA	Q787C9	Pseudomonas_virus	99.7	1.3e-163
2612224:2612253	attR	TGAGTTCGAATCTCACCGCCTCCGCCATAT	NA	NA	NA	NA
>prophage 4
NZ_CP013113	Pseudomonas aeruginosa strain Paer4_119 chromosome, complete genome	6504659	4410430	4419268	6504659	capsid,tRNA,integrase	Pseudomonas_phage(91.67%)	14	4408649:4408665	4415256:4415272
4408649:4408665	attL	GCTGGCCTTCTTCGGCG	NA	NA	NA	NA
WP_003082462.1|4410430_4411255_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	73.7	1.4e-106
WP_023088456.1|4411360_4412377_-|integrase	tyrosine-type recombinase/integrase	integrase	Q56VN7	Pseudomonas_phage	99.4	1.9e-190
WP_023090584.1|4412376_4413669_-	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	96.8	2.6e-253
WP_023127904.1|4413897_4415172_-	hypothetical protein	NA	Q56VN9	Pseudomonas_phage	88.7	6.1e-202
WP_003114150.1|4415175_4415532_-	DUF2523 domain-containing protein	NA	Q56VP0	Pseudomonas_phage	100.0	7.9e-59
4415256:4415272	attR	CGCCGAAGAAGGCCAGC	NA	NA	NA	NA
WP_048521242.1|4415536_4416811_-	hypothetical protein	NA	Q56VP1	Pseudomonas_phage	57.7	1.9e-54
WP_023127902.1|4416958_4417207_-|capsid	phage capsid protein	capsid	Q56VP2	Pseudomonas_phage	91.5	1.3e-31
WP_023127901.1|4417219_4417471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023127900.1|4417483_4417576_-	hypothetical protein	NA	Q56VP4	Pseudomonas_phage	96.7	1.2e-08
WP_023127899.1|4417592_4418027_-	hypothetical protein	NA	Q56VP5	Pseudomonas_phage	95.8	6.5e-63
WP_052156582.1|4418161_4418539_-	hypothetical protein	NA	Q56VP6	Pseudomonas_phage	99.2	4.8e-62
WP_034056811.1|4418542_4418830_-	DUF5447 family protein	NA	Q56VP7	Pseudomonas_phage	95.7	2.0e-52
WP_033863618.1|4418828_4419047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022581007.1|4419052_4419268_-	DNA-binding protein	NA	Q56VP9	Pseudomonas_phage	93.0	1.4e-34
>prophage 5
NZ_CP013113	Pseudomonas aeruginosa strain Paer4_119 chromosome, complete genome	6504659	4920681	4927943	6504659	integrase	Pseudomonas_phage(100.0%)	10	4919710:4919737	4932989:4933016
4919710:4919737	attL	GAGGGTTCGATTCCCTTCGCCCGCTCCA	NA	NA	NA	NA
WP_031672657.1|4920681_4921665_-|integrase	tyrosine-type recombinase/integrase	integrase	Q56VN7	Pseudomonas_phage	52.0	4.7e-93
WP_071659043.1|4921664_4922957_-	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	93.8	1.4e-246
WP_049290957.1|4923215_4924478_-	hypothetical protein	NA	Q56VN9	Pseudomonas_phage	55.2	1.0e-116
WP_003159569.1|4924479_4924830_-	DUF2523 domain-containing protein	NA	Q56VP0	Pseudomonas_phage	41.1	5.5e-20
WP_003163344.1|4924839_4925448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003124953.1|4926102_4926321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003115130.1|4926596_4926689_-	hypothetical protein	NA	Q56VP4	Pseudomonas_phage	100.0	7.3e-09
WP_003140508.1|4926705_4927140_-	hypothetical protein	NA	Q56VP5	Pseudomonas_phage	100.0	3.8e-63
WP_058129070.1|4927274_4927652_-	hypothetical protein	NA	Q56VP6	Pseudomonas_phage	97.6	4.4e-60
WP_042929587.1|4927655_4927943_-	DUF5447 family protein	NA	Q56VP7	Pseudomonas_phage	94.7	2.0e-52
4932989:4933016	attR	GAGGGTTCGATTCCCTTCGCCCGCTCCA	NA	NA	NA	NA
>prophage 6
NZ_CP013113	Pseudomonas aeruginosa strain Paer4_119 chromosome, complete genome	6504659	5448882	5456155	6504659	integrase	Pseudomonas_phage(85.71%)	9	5448307:5448366	5464169:5464250
5448307:5448366	attL	ATTCATAATGCTGATGTCCCAGGTTCAAGTCCCGGTGTAGCCACCATATTTTTCAAGGGG	NA	NA	NA	NA
WP_004352688.1|5448882_5449884_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	46.8	7.6e-75
WP_004352686.1|5449880_5451173_-	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	92.3	1.8e-241
WP_031632030.1|5451431_5452694_-	hypothetical protein	NA	Q56VN9	Pseudomonas_phage	54.7	7.8e-117
WP_003159569.1|5452695_5453046_-	DUF2523 domain-containing protein	NA	Q56VP0	Pseudomonas_phage	41.1	5.5e-20
WP_003163344.1|5453055_5453664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003124953.1|5454318_5454537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003115130.1|5454812_5454905_-	hypothetical protein	NA	Q56VP4	Pseudomonas_phage	100.0	7.3e-09
WP_046890062.1|5454921_5455356_-	hypothetical protein	NA	Q56VP5	Pseudomonas_phage	98.6	5.5e-62
WP_071659052.1|5455867_5456155_-	DUF5447 family protein	NA	Q56VP7	Pseudomonas_phage	95.7	1.2e-52
5464169:5464250	attR	ATTCATAATGCTGATGTCCCAGGTTCAAGTCCCGGTGTAGCCACCATATTTTTCAAGGGGTTAGCGCAAGCTAACCCCTTTT	NA	NA	NA	NA
