The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009653	Francisella tularensis subsp. novicida strain AL97-2214, complete genome	1916455	94327	103785	1916455	tRNA	Staphylococcus_phage(42.86%)	9	NA	NA
WP_003032762.1|94327_96112_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	42.6	4.2e-23
WP_076730772.1|96059_97205_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_003032766.1|97224_98217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003032769.1|98300_98825_-	peptide deformylase	NA	A0A067XQZ3	Caulobacter_phage	37.5	7.2e-16
WP_003032771.1|98821_99265_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	45.7	2.9e-26
WP_003032773.1|99274_100486_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.1	8.1e-87
WP_003022624.1|100478_101084_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	35.1	2.7e-27
WP_003032774.1|101076_102144_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	36.1	5.7e-52
WP_032729719.1|102534_103785_+	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	34.3	2.1e-29
>prophage 2
NZ_CP009653	Francisella tularensis subsp. novicida strain AL97-2214, complete genome	1916455	276824	345536	1916455	transposase,tRNA	Burkholderia_phage(40.0%)	59	NA	NA
WP_032729772.1|276824_277388_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032729776.1|277446_280572_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	31.1	7.2e-71
WP_003035420.1|280977_281679_+	activator of osmoprotectant transporter prop	NA	NA	NA	NA	NA
WP_032729778.1|281701_282247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003032928.1|282261_283716_-	potassium transporter	NA	NA	NA	NA	NA
WP_003019565.1|283827_284031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032729780.1|284427_285045_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_032729782.1|285045_287547_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	50.1	8.8e-88
WP_003032934.1|287668_288337_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_003032936.1|288583_290038_+	amino acid permease	NA	NA	NA	NA	NA
WP_003032937.1|290046_290685_+	alpha hydrolase	NA	NA	NA	NA	NA
WP_003022558.1|290704_291691_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_003032688.1|291992_292985_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	24.3	2.4e-12
WP_003032938.1|293208_294675_+	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_003032939.1|294745_296425_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003032940.1|296435_297743_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_003024914.1|297813_298161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003032941.1|298144_299071_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_032729785.1|299067_300474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003032944.1|300484_301105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003032948.1|301215_301893_+	type II secretion system protein	NA	NA	NA	NA	NA
WP_003032950.1|301911_302832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003032951.1|302844_304653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003032952.1|304676_306482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003017134.1|306549_307944_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2L2DK39	Acanthamoeba_polyphaga_mimivirus	30.6	6.7e-53
WP_003017136.1|307947_308892_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_003032953.1|308947_310138_+	MFS transporter	NA	NA	NA	NA	NA
WP_003032954.1|310151_310643_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003032955.1|310722_311688_-	alanine racemase	NA	NA	NA	NA	NA
WP_003032688.1|313054_314047_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	24.3	2.4e-12
WP_003032957.1|314192_314369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003032959.1|314370_314652_-	DUF4282 domain-containing protein	NA	NA	NA	NA	NA
WP_003032962.1|314664_316167_-	APC family permease	NA	NA	NA	NA	NA
WP_032729790.1|316299_316536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003032964.1|316532_317276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003032966.1|317278_317974_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	A0A1X9I669	Streptococcus_phage	33.6	5.6e-08
WP_032729794.1|318114_319215_+	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_032729796.1|320339_322628_-	chitinase	NA	NA	NA	NA	NA
WP_003032971.1|322973_323921_-|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	44.9	1.9e-54
WP_003032973.1|324350_325343_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032730090.1|326375_327833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003032977.1|327893_331304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003032688.1|331688_332681_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	24.3	2.4e-12
WP_032730091.1|333704_334385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003032984.1|335525_335762_-	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_003014804.1|335778_336072_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_003014805.1|336071_336740_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003014807.1|336808_337342_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_003032986.1|337341_338106_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003032988.1|338109_338913_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.4	9.9e-17
WP_003014812.1|338930_339203_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_003014814.1|339205_340030_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_003032990.1|340069_340756_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_003014820.1|340790_340946_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_003014822.1|340972_341209_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_003032993.1|341342_341687_-	lipoprotein	NA	NA	NA	NA	NA
WP_032729804.1|341816_343856_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_003024150.1|343859_344057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003032688.1|344543_345536_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	24.3	2.4e-12
>prophage 3
NZ_CP009653	Francisella tularensis subsp. novicida strain AL97-2214, complete genome	1916455	409561	419160	1916455		Enterococcus_phage(16.67%)	9	NA	NA
WP_003033095.1|409561_410410_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	38.4	1.4e-29
WP_003033096.1|410572_410863_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_003033099.1|411080_412124_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SQF5	Cyanophage	36.6	4.1e-55
WP_003033101.1|412123_414436_+	phosphoribosylamine--glycine ligase	NA	A0A0M4JBD3	Mollivirus	30.6	5.2e-26
WP_003017844.1|414439_415015_+	phosphoribosylglycinamide formyltransferase	NA	Q58MV3	Prochlorococcus_phage	34.7	2.2e-18
WP_003033103.1|415131_415623_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	40.1	7.7e-20
WP_003033106.1|415625_416723_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_003033109.1|416719_417073_-	YraN family protein	NA	NA	NA	NA	NA
WP_003033112.1|417153_419160_-	M3 family metallopeptidase	NA	A0A1V0SID3	Klosneuvirus	26.2	2.8e-52
>prophage 4
NZ_CP009653	Francisella tularensis subsp. novicida strain AL97-2214, complete genome	1916455	655118	717209	1916455	protease,transposase,integrase,tRNA	Paenibacillus_phage(15.79%)	50	666751:666810	688145:688992
WP_003033409.1|655118_655862_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	35.0	2.8e-13
WP_003033410.1|656316_658905_+	chitinase	NA	I6LMN1	Fathead_minnow_nidovirus	26.3	3.4e-10
WP_003020526.1|659083_659728_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003033411.1|659811_660645_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	33.0	2.4e-13
WP_003033412.1|660735_661080_+	5-carboxymethyl-2-hydroxymuconate Delta-isomerase	NA	NA	NA	NA	NA
WP_080542476.1|661137_662361_+	MFS transporter	NA	NA	NA	NA	NA
WP_003033415.1|662344_663670_-	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_003033416.1|663773_665999_-	catalase/peroxidase HPI	NA	NA	NA	NA	NA
666751:666810	attL	TAGGTTCTGTGCACAAAAAACTTAAATTATATTGAAAATAGCTAAACCGCTGTTATTTAA	NA	NA	NA	NA
WP_003033417.1|666845_667589_+|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	35.0	1.1e-12
WP_071659898.1|667599_667713_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_003033418.1|667890_669066_-	MFS transporter	NA	NA	NA	NA	NA
WP_003033419.1|669829_670822_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	24.3	5.3e-12
WP_003033420.1|671052_671841_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	26.9	2.7e-14
WP_003033421.1|671834_673229_-	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_003033422.1|673244_674561_-	MFS transporter	NA	NA	NA	NA	NA
WP_003033423.1|674667_675702_-	glycerophosphoryl diester phosphodiesterase	NA	A0A075KJS1	Lactobacillus_phage	25.3	6.6e-13
WP_032729877.1|675839_676811_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_003033427.1|676807_677740_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	5.0e-20
WP_003033429.1|677736_678855_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003033433.1|678951_680496_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	38.1	3.4e-82
WP_003033435.1|680495_680876_+	RidA family protein	NA	NA	NA	NA	NA
WP_003033437.1|681014_682265_+	C4-dicarboxylate transporter DctA	NA	NA	NA	NA	NA
WP_003033438.1|682266_683916_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A076FI99	Aureococcus_anophage	25.1	2.8e-21
WP_003033439.1|683912_685694_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	A0A1V0SE00	Indivirus	35.0	1.5e-28
WP_003033440.1|686070_686580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003023908.1|686607_686808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003033442.1|686811_688071_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_003033417.1|688239_688983_+|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	35.0	1.1e-12
WP_003033443.1|689011_689911_-	ROK family protein	NA	NA	NA	NA	NA
688145:688992	attR	TAGGTTCTGTGCACAAAAAACTTAAATTATATTGAAAATAGCTAAACCGCTGTTATTTAAGAGTTGAAAAGCAATAAATATCAATGGTTTAGCAAATGAATTATCATATAAAAGAAGTATTCTGGTCAAGTATTTTATCATTTTTAAAATCACAAAAAGGTATACATACCAATGATGAAGCCAAATTAAGATTGTTTATTGAAGCTGTATTTTATGTGTTACGTACAGGCTGTCAATGGAGAATGTTACCATTTTATTATGGTAAATATAGATCAATACATAAGCGCTTTAAAGATTGGTGTGATAAAGGCATATTCTCTAGATTATTTAAATCAGTACAAAACCCTGATTTACAAGAAGTCATGCTTGATTCAACAATAGCAAGAGCACATGCTTGTGCTACAGGATATGATAAAGATGATAATCAAGCAATTGGTAGATCAGTTGGTGGGATAACCACTAAAATCCATGCTATGACTGATGCTTTAGGTAATCCAATAGAAATATTGTTGTCAGAAGGTAAAACTCATGATAGTAAAGTAGCTATAGATTTACTACAAAATGTATATAAAACAAAAGTTATCGCTGATAGAGCATATCATTCTAATGAAATCAGGCAGCATATTCAAAGTATATCCTCTGAAGCTGTTATCCCTTGTAAATCAAATACTCTAAACCATATACCTTTTGATAGTCATGTATATAAAGAAAGACATTTGATAGAGAATTTCTTTTCTAAAATTAAGCATTTTAGAAGAGTATTCTCTAGGTTTGATAAAACCATTTCCGTATATCTAGGCATGATAAAACTAGCTTGTACTTTTATTTGGTTACGATGAATATTAATT	NA	NA	NA	NA
WP_003042030.1|690020_691301_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	56.2	8.2e-98
WP_003033449.1|691315_692854_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_003033450.1|693072_696105_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_003033452.1|696301_696703_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_003033454.1|696723_697527_-	uridine phosphorylase	NA	NA	NA	NA	NA
WP_003022063.1|697642_698254_+|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_003019364.1|698300_698951_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_003016791.1|698984_699563_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_003033456.1|699563_700787_-	insulinase family protein	NA	A0A2K9V7S4	Bandra_megavirus	23.0	6.2e-10
WP_003033458.1|700794_702048_-	insulinase family protein	NA	G3MBJ8	Bacillus_virus	25.9	1.4e-28
WP_003033461.1|702055_703117_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_003033462.1|703116_704199_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_003033464.1|704364_705804_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.4	1.3e-54
WP_003022051.1|705905_707366_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.1	2.1e-97
WP_003019355.1|707431_708085_+	thiamine diphosphokinase	NA	NA	NA	NA	NA
WP_003033471.1|708071_709694_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_003016775.1|709694_710279_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_003016773.1|710312_710795_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_003033473.1|710833_713656_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	1.5e-309
WP_003033475.1|713661_715050_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_003033477.1|715292_717209_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	E5ESM9	Bathycoccus_sp._RCC1105_virus	42.5	1.2e-113
>prophage 5
NZ_CP009653	Francisella tularensis subsp. novicida strain AL97-2214, complete genome	1916455	1101614	1137327	1916455	protease,transposase,tRNA	Burkholderia_phage(27.27%)	34	NA	NA
WP_003032688.1|1101614_1102607_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	24.3	2.4e-12
WP_003034100.1|1103485_1104529_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_003015556.1|1104556_1104874_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003034103.1|1104878_1106576_-	biosynthetic-type acetolactate synthase large subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	30.2	1.3e-58
WP_032730004.1|1106722_1108405_-	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_003034109.1|1108428_1110225_-	threonine synthase	NA	NA	NA	NA	NA
WP_003034112.1|1110367_1110961_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_003034115.1|1110957_1111443_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_003018795.1|1111443_1112370_-|protease	protease modulator HflC	protease	A0A2K9KZA2	Tupanvirus	21.9	7.5e-08
WP_003018791.1|1112371_1113439_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_003034119.1|1113623_1114802_+	FAD-binding domain	NA	NA	NA	NA	NA
WP_003034122.1|1114812_1116120_-	GTPase HflX	NA	NA	NA	NA	NA
WP_003015654.1|1116171_1116501_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_003034124.1|1116611_1117538_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_003034126.1|1117538_1118972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003034128.1|1119084_1119357_-	HU family DNA-binding protein	NA	Q6QIE5	Burkholderia_phage	58.9	6.5e-21
WP_003026287.1|1119443_1121768_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	47.3	3.6e-192
WP_003034130.1|1121792_1123046_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	1.1e-126
WP_003015534.1|1123069_1123675_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.8	1.1e-55
WP_003034132.1|1123700_1125017_-	trigger factor	NA	NA	NA	NA	NA
WP_003034133.1|1125171_1125636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003018771.1|1125682_1126276_-	thymidine kinase	NA	E3SFJ8	Shigella_phage	48.2	1.1e-44
WP_003034136.1|1126292_1127042_-	haloacid dehalogenase	NA	NA	NA	NA	NA
WP_154806602.1|1127045_1127213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003034138.1|1127221_1127857_-	O-methyltransferase	NA	NA	NA	NA	NA
WP_003023392.1|1128117_1129446_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_003034141.1|1129449_1130433_+	PhoH family protein	NA	W8D063	Erwinia_phage	42.5	1.5e-43
WP_003034144.1|1130407_1130914_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_003018757.1|1130885_1131746_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_003034147.1|1131745_1133236_+	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_003032688.1|1133415_1134408_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	24.3	2.4e-12
WP_003034150.1|1134693_1135116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003034153.1|1135267_1136443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003033606.1|1136583_1137327_+|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	35.0	6.2e-13
