The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017952	Streptococcus iniae strain 89353 chromosome, complete genome	2098647	4321	71656	2098647	transposase,protease,tRNA	Bacillus_phage(28.57%)	48	NA	NA
WP_003100548.1|4321_4891_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_016355731.1|4893_8394_+	transcription-repair coupling factor	NA	A0A068EU29	Bacillus_phage	34.8	1.2e-05
WP_003100552.1|8356_9868_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_003100554.1|9896_10169_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_003100556.1|10155_10527_+	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_172952521.1|10530_10644_+	recombinase	NA	NA	NA	NA	NA
WP_003100558.1|10663_11950_+	serine hydrolase	NA	NA	NA	NA	NA
WP_071794715.1|11946_13230_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	R4TVK3	Phaeocystis_globosa_virus	25.0	3.7e-13
WP_003100560.1|13234_13777_+	hypoxanthine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	25.5	9.1e-06
WP_003100561.1|13798_15766_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	H8ZJI5	Ostreococcus_tauri_virus	48.6	2.3e-107
WP_089180041.1|18009_19115_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	48.7	7.7e-68
WP_003100568.1|20134_21526_+	amino acid permease	NA	NA	NA	NA	NA
WP_003100570.1|21704_21998_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_003100572.1|22030_22306_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	41.8	4.6e-06
WP_003099060.1|22430_23606_+|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	30.1	1.4e-27
WP_089180042.1|23695_24800_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	49.3	4.3e-71
WP_119773870.1|24788_25397_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	47.0	3.8e-37
WP_003098561.1|38814_39630_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_003098563.1|39629_40127_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_016355737.1|40225_41440_+	CHAP domain-containing protein	NA	NA	NA	NA	NA
WP_003098567.1|41709_42675_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	35.8	8.2e-42
WP_003098568.1|42816_43995_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_003098570.1|43984_44752_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_003098571.1|44875_45871_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_003098573.1|45876_46113_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_003098576.1|46317_47049_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003098577.1|47066_48242_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_016355738.1|48252_49233_+	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_003098581.1|49273_49993_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003098583.1|50153_51938_+	beta-galactosidase	NA	NA	NA	NA	NA
WP_003098584.1|51934_52420_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_003098588.1|52465_53347_+	PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC	NA	NA	NA	NA	NA
WP_003098592.1|53333_54143_+	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_003098595.1|54144_54549_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_003098599.1|54791_55928_-	SH3 domain-containing protein	NA	F8HGP2	Streptococcus_phage	30.5	4.1e-08
WP_016355739.1|56377_56989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003098601.1|57353_57578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016355740.1|57771_59064_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.7	1.1e-17
WP_016355741.1|59163_60066_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003098617.1|60283_61288_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	33.1	8.1e-08
WP_031239161.1|61537_61990_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_016355743.1|61998_62400_+	MORN repeat protein	NA	NA	NA	NA	NA
WP_003098625.1|62396_64175_+	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	25.6	6.0e-22
WP_003098627.1|64333_66982_+	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_155115666.1|67048_67192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003098628.1|67313_68798_+	threonine synthase	NA	NA	NA	NA	NA
WP_003098630.1|68840_70142_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_071794717.1|70489_71656_-|transposase	IS30-like element ISSag9 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP017952	Streptococcus iniae strain 89353 chromosome, complete genome	2098647	83943	133113	2098647	transposase,tRNA	Bacillus_phage(33.33%)	39	NA	NA
WP_003098612.1|83943_84897_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.8	3.8e-39
WP_001040189.1|85136_85355_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000868345.1|85380_85497_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_003098664.1|85514_85880_+	30S ribosomal protein S13	NA	NA	NA	NA	NA
WP_003098665.1|85897_86281_+	30S ribosomal protein S11	NA	NA	NA	NA	NA
WP_003098668.1|86330_87269_+	DNA-directed RNA polymerase subunit alpha	NA	NA	NA	NA	NA
WP_002986602.1|87283_87670_+	50S ribosomal protein L17	NA	NA	NA	NA	NA
WP_000562208.1|94981_95176_-	DUF3173 family protein	NA	NA	NA	NA	NA
WP_089180045.1|95492_96603_+|transposase	IS3-like element IS981 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.4	1.2e-49
WP_003098679.1|98167_98527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003098684.1|99136_99544_+	helix-turn-helix transcriptional regulator	NA	A0A139ZPK3	Marinitoga_camini_virus	42.6	4.7e-07
WP_016355751.1|99637_99832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089180044.1|99810_100137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003098714.1|100902_101856_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.8	3.8e-39
WP_080768721.1|101991_104514_+	Cna B-type domain-containing protein	NA	NA	NA	NA	NA
WP_003099060.1|104682_105858_+|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	30.1	1.4e-27
WP_037583616.1|106854_107622_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003098721.1|107940_108963_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.9	4.8e-40
WP_089180045.1|109587_110699_-|transposase	IS3-like element IS981 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.4	1.2e-49
WP_016355755.1|111235_111685_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_003098726.1|111786_112200_+	DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_003098727.1|112259_113279_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.2	2.1e-27
WP_003098729.1|114078_114432_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016355758.1|114468_114867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003098733.1|114979_115510_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003098764.1|117928_118459_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_003098766.1|118469_119093_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_016355761.1|119502_120402_+	prenyltransferase	NA	NA	NA	NA	NA
WP_003098771.1|120414_121626_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003098773.1|121712_123140_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_003098776.1|123141_124161_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016355762.1|124160_125879_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	24.8	1.9e-25
WP_003098779.1|125871_127617_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	24.1	3.8e-13
WP_003098781.1|127750_128728_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_003098783.1|128928_129780_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_003098785.1|129847_130291_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003098787.1|130295_130994_+	metal ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.9	7.6e-13
WP_003098790.1|130996_131812_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_003098791.1|131856_133113_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A1S6UA79	Serratia_phage	41.0	2.6e-72
>prophage 3
NZ_CP017952	Streptococcus iniae strain 89353 chromosome, complete genome	2098647	184796	244120	2098647	transposase,protease,holin	Bacillus_phage(27.27%)	55	NA	NA
WP_089180045.1|184796_185908_-|transposase	IS3-like element IS981 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.4	1.2e-49
WP_003098952.1|186737_189230_+	pneumococcal-type histidine triad protein	NA	NA	NA	NA	NA
WP_003098954.1|189542_190046_+	pneumococcal-type histidine triad protein	NA	NA	NA	NA	NA
WP_003098956.1|190196_191123_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003098957.1|191331_191973_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_003098958.1|191984_192992_-	sugar kinase	NA	NA	NA	NA	NA
WP_003098959.1|193014_193656_-	RpiB/LacA/LacB family sugar-phosphate isomerase	NA	NA	NA	NA	NA
WP_003098960.1|193669_194482_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_003098962.1|194811_195246_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_016355781.1|195245_196445_+	glycoside hydrolase family 88 protein	NA	NA	NA	NA	NA
WP_003098964.1|196481_196973_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_003098966.1|196993_197860_+	PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC	NA	NA	NA	NA	NA
WP_003098967.1|197846_198662_+	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
WP_016355782.1|198732_200649_+	alginate lyase family protein	NA	NA	NA	NA	NA
WP_003098969.1|200744_201746_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003098971.1|201805_205309_-	polysaccharide lyase 8 family protein	NA	NA	NA	NA	NA
WP_003098973.1|205574_206450_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.8	5.7e-18
WP_003098975.1|206449_207184_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003098977.1|207180_208269_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_003098979.1|208270_208867_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_017794719.1|209356_210232_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003098984.1|210668_210944_+	ethanolamine utilization microcompartment protein EutM	NA	NA	NA	NA	NA
WP_003098986.1|210998_211280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003098987.1|211298_211598_+	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_071794719.1|211609_211927_+	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_003098990.1|211942_213298_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003098992.1|213352_215899_+|holin	choline trimethylamine-lyase	holin	Q70BG9	Salmonella_phage	38.7	2.3e-06
WP_003098993.1|215964_216921_+|holin	choline TMA-lyase-activating enzyme	holin	A0A2P0VNQ0	Tetraselmis_virus	28.1	1.1e-14
WP_031239224.1|216952_217291_+	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_003098998.1|217287_217734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003099001.1|217730_218861_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_003099006.1|218926_219565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003099009.1|219557_220397_+	ethanolamine utilization protein EutJ	NA	NA	NA	NA	NA
WP_003099011.1|220408_220705_+	EutN/CcmL family microcompartment protein	NA	NA	NA	NA	NA
WP_003099015.1|221774_222350_+	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_003099017.1|222381_224043_+	acetaldehyde dehydrogenase (acetylating)	NA	A0A1X9I5D4	Streptococcus_phage	21.8	5.6e-06
WP_003099019.1|224053_224752_+	phosphate propanoyltransferase	NA	NA	NA	NA	NA
WP_003099021.1|224764_225040_+	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_003099022.1|225070_225346_+	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_003099024.1|225375_225651_+	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_003099026.1|225773_229409_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_003099028.1|229428_230463_+	DMT family transporter	NA	NA	NA	NA	NA
WP_003099030.1|230674_231745_+	fibronectin-binding SSURE repeat-containing protein	NA	NA	NA	NA	NA
WP_003099032.1|231878_232964_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003099034.1|232965_233643_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.4	3.6e-36
WP_003099036.1|233685_234375_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	40.6	2.0e-37
WP_003099038.1|234361_235423_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	31.7	3.1e-34
WP_003099040.1|235577_236174_-	phosphoribulokinase	NA	NA	NA	NA	NA
WP_003099042.1|236400_237270_+	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016355790.1|237347_238538_+	MFS transporter	NA	NA	NA	NA	NA
WP_003099045.1|238672_239128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003099047.1|239416_240778_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	75.1	3.3e-214
WP_003099048.1|240891_242334_-	FAD/NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_003099050.1|242415_242922_-	DNA topology modulation protein	NA	A0A097BYE2	Leuconostoc_phage	38.1	4.6e-28
WP_089180059.1|243014_244120_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	49.3	1.3e-70
>prophage 4
NZ_CP017952	Streptococcus iniae strain 89353 chromosome, complete genome	2098647	621567	688023	2098647	transposase,tRNA	Enterococcus_phage(21.43%)	56	NA	NA
WP_089180059.1|621567_622673_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	49.3	1.3e-70
WP_003100090.1|622814_623504_+	competence protein CoiA	NA	NA	NA	NA	NA
WP_003100091.1|623529_625332_+	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_003100092.1|625333_625987_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_003100094.1|626022_626667_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003100096.1|626837_627545_+	O-methyltransferase	NA	NA	NA	NA	NA
WP_003100098.1|627608_628550_+	peptidylprolyl isomerase PrsA	NA	NA	NA	NA	NA
WP_003100100.1|628847_631466_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	33.6	3.3e-61
WP_003100102.1|631593_632238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100103.1|632335_633028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100105.1|633418_634201_+	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
WP_003100106.1|634217_635393_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_003100107.1|635463_635844_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	9.8e-23
WP_003100108.1|636078_636273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100109.1|636479_636599_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_003100110.1|636677_637928_-	chloride channel protein	NA	NA	NA	NA	NA
WP_003100111.1|638021_638981_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	69.9	8.2e-127
WP_003100112.1|639444_641604_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	61.6	2.7e-258
WP_003100113.1|641633_641852_-	glutaredoxin-like protein NrdH	NA	A0A249XUR7	Enterococcus_phage	42.7	5.8e-12
WP_000146945.1|642375_642639_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_003100126.1|642643_644377_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_016355874.1|644513_645941_+	NADP-dependent glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_003100130.1|646087_647368_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_003100131.1|647557_648646_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.9	5.6e-31
WP_003100132.1|648798_649425_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	37.7	1.0e-32
WP_003100133.1|649433_649712_+	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_003100134.1|649810_650308_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_003100135.1|650307_651981_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	41.6	5.1e-47
WP_003100136.1|652031_652235_+	DUF3272 family protein	NA	NA	NA	NA	NA
WP_017794607.1|652215_653151_-	bifunctional biotin--[acetyl-CoA-carboxylase] synthetase/biotin operon repressor	NA	NA	NA	NA	NA
WP_016355875.1|653313_655593_+	pneumococcal-type histidine triad protein	NA	NA	NA	NA	NA
WP_003100140.1|655977_657165_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	66.8	3.6e-140
WP_003100141.1|657347_658607_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_003100142.1|658856_660401_+	MFS transporter	NA	NA	NA	NA	NA
WP_003100144.1|660459_661485_+	sugar kinase	NA	NA	NA	NA	NA
WP_003100145.1|661591_662275_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003100147.1|662386_663004_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_003100148.1|663014_664415_+	glucuronate isomerase	NA	NA	NA	NA	NA
WP_003100150.1|664437_665484_+	mannonate dehydratase	NA	NA	NA	NA	NA
WP_003100151.1|665534_666374_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_016355878.1|666440_667970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003100157.1|668093_668900_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003100159.1|668930_670721_+	beta-hexosamidase	NA	NA	NA	NA	NA
WP_003100161.1|670873_671425_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003100163.1|671417_672707_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_003100165.1|672733_673594_+	methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_003100167.1|673595_674549_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_003100169.1|674619_675903_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_003100171.1|675895_676414_+	shikimate kinase	NA	NA	NA	NA	NA
WP_003100173.1|676541_677978_+	LCP family protein	NA	NA	NA	NA	NA
WP_003100174.1|678059_679418_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	74.9	3.8e-194
WP_003100176.1|679687_680566_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_003100177.1|680543_681116_+	SLATT domain-containing protein	NA	NA	NA	NA	NA
WP_089180059.1|682899_684005_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	49.3	1.3e-70
WP_089180045.1|685000_686111_+|transposase	IS3-like element IS981 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.4	1.2e-49
WP_003099066.1|686847_688023_-|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	29.6	5.9e-26
>prophage 5
NZ_CP017952	Streptococcus iniae strain 89353 chromosome, complete genome	2098647	915880	924253	2098647		Bacillus_virus(16.67%)	8	NA	NA
WP_003099499.1|915880_916684_+	phosphate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.0	7.6e-17
WP_003099501.1|916695_917454_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.9	1.3e-18
WP_003099503.1|917508_918162_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_003099506.1|918223_920761_+	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	24.4	1.3e-67
WP_003099507.1|920881_921556_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.4	1.1e-27
WP_016355994.1|921635_922859_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	28.6	1.3e-12
WP_071794725.1|923030_923285_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_003099512.1|923332_924253_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	33.6	1.4e-30
>prophage 6
NZ_CP017952	Streptococcus iniae strain 89353 chromosome, complete genome	2098647	935802	984035	2098647	transposase,bacteriocin,tRNA	Streptococcus_phage(21.43%)	44	NA	NA
WP_071127661.1|935802_936039_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_003099526.1|936215_937931_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	83.0	1.4e-270
WP_003099527.1|938077_938647_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_003099529.1|938713_939259_-	phosphopantothenoylcysteine decarboxylase	NA	A0A1V0S7W6	Shearwaterpox_virus	32.8	2.0e-21
WP_017794671.1|939251_939941_-	phosphopantothenate--cysteine ligase	NA	NA	NA	NA	NA
WP_003099531.1|940116_940941_+	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_003099533.1|941054_942725_+	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
WP_003099534.1|942843_944433_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_016355996.1|944691_945771_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_016355997.1|945806_946736_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_017794672.1|946843_947182_+	hypothetical protein	NA	A0A248SK58	Salicola_phage	34.5	3.7e-05
WP_003099541.1|947204_948467_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	47.4	2.3e-100
WP_003099543.1|948646_950191_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.3	2.2e-49
WP_003099545.1|950308_950485_+|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_003099550.1|950889_951042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003099551.1|951051_951396_+	YtxH domain-containing protein	NA	NA	NA	NA	NA
WP_003099552.1|951401_952871_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	74.7	1.1e-210
WP_003099553.1|953141_954044_-	diacylglycerol kinase family lipid kinase	NA	NA	NA	NA	NA
WP_003099555.1|954119_954770_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_003099557.1|954766_955216_-	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_003099561.1|955564_956851_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003099563.1|956847_957687_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003099566.1|958156_959011_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_003099568.1|958994_959780_+	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	38.6	4.4e-25
WP_003099570.1|959792_960341_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_003099573.1|960406_961252_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_003099575.1|961348_963484_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	36.5	6.4e-103
WP_003099578.1|963577_964462_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003099589.1|964627_965686_+	PTS transporter subunit IIC	NA	NA	NA	NA	NA
WP_003099592.1|965704_966697_+	D-lactate dehydrogenase	NA	M1H502	Paramecium_bursaria_Chlorella_virus	33.4	2.3e-39
WP_003099599.1|966802_967468_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_003099603.1|968310_969645_+|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_003099606.1|969783_970269_-	PASTA domain-containing protein	NA	NA	NA	NA	NA
WP_003099060.1|970480_971656_+|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	30.1	1.4e-27
WP_003099608.1|971789_972542_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	3.3e-30
WP_003099611.1|972543_974499_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003099615.1|974541_975207_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003099619.1|976151_976487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003099620.1|976575_977646_-	tyrosine recombinase XerS	NA	NA	NA	NA	NA
WP_003099621.1|977859_978483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003099060.1|978870_980046_+|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	30.1	1.4e-27
WP_016356004.1|980070_981327_-	protein kinase	NA	A0A1S5V1U4	Saudi_moumouvirus	25.4	1.6e-08
WP_016356005.1|981340_982114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003099060.1|982859_984035_-|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	30.1	1.4e-27
>prophage 7
NZ_CP017952	Streptococcus iniae strain 89353 chromosome, complete genome	2098647	1021879	1143758	2098647	transposase,integrase,protease,tRNA	Bacillus_phage(15.62%)	111	1020894:1020915	1069776:1069797
1020894:1020915	attL	GTAATTTCTCAAAGTAAGTTCC	NA	NA	NA	NA
WP_089180041.1|1021879_1022984_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	48.7	7.7e-68
WP_003099686.1|1023761_1023947_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_016356012.1|1024018_1024930_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_142924914.1|1025013_1025457_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0N9SIX5	Staphylococcus_phage	61.6	8.7e-39
WP_003099691.1|1025541_1026810_-	purine permease	NA	Q9KX94	Enterobacteria_phage	28.0	5.2e-28
WP_003099696.1|1026809_1027391_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003099697.1|1027632_1028616_-	GMP reductase	NA	G3MBI2	Bacillus_virus	75.4	5.6e-139
WP_003099699.1|1028869_1030399_-	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_003099700.1|1030391_1031120_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	1.1e-27
WP_003099702.1|1031355_1032204_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003099704.1|1032359_1033049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003099705.1|1033236_1033995_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003099706.1|1034069_1035062_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_016356014.1|1035078_1035972_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_003099713.1|1035968_1036805_-	NAD kinase	NA	NA	NA	NA	NA
WP_003099716.1|1036779_1037451_-	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_003099718.1|1037544_1038117_+	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_003099722.1|1038230_1039202_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	35.5	4.2e-38
WP_003099723.1|1039205_1040321_+	cysteine desulfurase	NA	H7BUW1	unidentified_phage	35.8	2.3e-27
WP_003099725.1|1040322_1040670_+	DUF1831 domain-containing protein	NA	NA	NA	NA	NA
WP_003099727.1|1040738_1040951_+	DUF4649 family protein	NA	NA	NA	NA	NA
WP_003099729.1|1041125_1041770_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_003099731.1|1041778_1042480_+	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_016356016.1|1042476_1043157_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_003099737.1|1043199_1044324_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_003099738.1|1044426_1045866_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_003099739.1|1046004_1046604_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_003099740.1|1046715_1047333_-	lipase/acylhydrolase	NA	NA	NA	NA	NA
WP_003099741.1|1047413_1048901_-	family 1 glycosylhydrolase	NA	NA	NA	NA	NA
WP_003099742.1|1049159_1050092_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003099743.1|1050183_1052103_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_003099745.1|1052389_1053217_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_003099747.1|1053296_1054844_-	ClC family H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
WP_071794727.1|1055061_1059606_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_016356018.1|1059799_1060960_-	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
WP_003099752.1|1060982_1062290_-	2-hydroxycarboxylate transporter family protein	NA	A0A140XAH4	Dickeya_phage	56.1	3.0e-18
WP_003099759.1|1062450_1063971_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_003099762.1|1063972_1064644_+	response regulator	NA	NA	NA	NA	NA
WP_003099766.1|1064935_1066009_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003099768.1|1066001_1066778_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_016356019.1|1066774_1067569_-	ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	25.5	4.3e-12
WP_003099772.1|1067552_1068707_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	40.3	3.6e-36
WP_003099774.1|1068741_1069635_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_003099776.1|1069889_1071056_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
1069776:1069797	attR	GTAATTTCTCAAAGTAAGTTCC	NA	NA	NA	NA
WP_003099778.1|1071307_1071799_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_003099779.1|1071795_1072155_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_003099781.1|1072161_1072962_-	dihydropteroate synthase	NA	NA	NA	NA	NA
WP_003099782.1|1072971_1073535_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	51.6	1.0e-47
WP_003099784.1|1073563_1074823_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_003099786.1|1074906_1075767_-	homoserine kinase	NA	NA	NA	NA	NA
WP_016356020.1|1075768_1077055_-	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_003099793.1|1077239_1078160_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_003099056.1|1078419_1079595_+|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	29.6	1.6e-26
WP_089180059.1|1079939_1081045_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	49.3	1.3e-70
WP_003099798.1|1081112_1081553_-|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	36.8	5.4e-17
WP_003099800.1|1081775_1082141_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_003099802.1|1082204_1082705_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_003098612.1|1082968_1083922_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.8	3.8e-39
WP_003099809.1|1085481_1086195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003099810.1|1086302_1086902_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_003099812.1|1086911_1088141_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.9	9.5e-136
WP_003099817.1|1088365_1088863_-	dihydrofolate reductase	NA	A0A1L7N103	Ralstonia_phage	36.7	6.8e-16
WP_017794807.1|1088941_1089781_-	thymidylate synthase	NA	U5J9N5	Bacillus_phage	53.2	2.1e-81
WP_003099823.1|1089976_1091149_+	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_071794728.1|1091129_1092416_+	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_003099830.1|1092439_1093435_-	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_003099834.1|1093415_1094435_-	phosphomevalonate kinase	NA	NA	NA	NA	NA
WP_003099837.1|1094427_1095372_-	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_003099844.1|1095347_1096232_-	mevalonate kinase	NA	NA	NA	NA	NA
WP_003099847.1|1096362_1098105_-	ABC transporter ATP-binding protein	NA	A0A076FI99	Aureococcus_anophage	24.6	3.1e-23
WP_003099849.1|1098106_1099828_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.7	2.3e-39
WP_003099851.1|1102470_1102881_-	peptide deformylase	NA	NA	NA	NA	NA
WP_003099852.1|1102960_1104310_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_003099853.1|1104443_1106210_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.9	8.0e-51
WP_003099854.1|1106209_1107952_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.4	3.2e-36
WP_003099856.1|1108053_1108533_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003099861.1|1108534_1110421_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.5	8.2e-62
WP_003099863.1|1110417_1111626_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	43.6	2.1e-39
WP_003099866.1|1111622_1112390_-	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_016356025.1|1112406_1113258_-	DegV family protein	NA	NA	NA	NA	NA
WP_003099871.1|1113257_1113638_-	DUF1149 family protein	NA	NA	NA	NA	NA
WP_003099873.1|1113710_1114232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003099875.1|1114428_1114902_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_016356029.1|1115930_1116545_-	glycoside hydrolase family 73 protein	NA	NA	NA	NA	NA
WP_003099880.1|1116633_1118586_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_003099882.1|1118582_1119494_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_003099883.1|1119490_1120204_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_003099884.1|1120365_1121289_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_003099886.1|1122443_1123442_-	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	51.6	2.2e-26
WP_016356032.1|1123434_1124175_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_003099888.1|1124164_1124683_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_003099889.1|1124937_1126467_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_003082623.1|1126638_1126878_-	KH domain-containing protein	NA	NA	NA	NA	NA
WP_003099891.1|1126887_1127160_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_003099892.1|1127430_1128039_-	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	47.9	2.8e-40
WP_016356033.1|1128031_1129234_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_172952524.1|1129245_1129938_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	41.7	7.5e-37
WP_016356035.1|1129977_1131222_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_003099896.1|1131488_1132748_-	uracil transporter	NA	Q9KX94	Enterobacteria_phage	37.1	3.9e-60
WP_016356036.1|1132762_1133284_-	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
WP_003099901.1|1133487_1134387_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_003099904.1|1134387_1134834_-	signal peptidase II	NA	NA	NA	NA	NA
WP_003099906.1|1134830_1135745_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	28.5	1.8e-06
WP_003099908.1|1135889_1136183_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_016356038.1|1136210_1136534_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003099910.1|1136541_1136856_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_003098714.1|1137167_1138121_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.8	3.8e-39
WP_003099911.1|1138252_1139164_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_089180045.1|1139489_1140600_+|transposase	IS3-like element IS981 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.4	1.2e-49
WP_016356042.1|1141265_1142462_-	CapA family protein	NA	A0A2H4J434	uncultured_Caudovirales_phage	35.1	3.6e-39
WP_003099916.1|1142543_1143758_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP017952	Streptococcus iniae strain 89353 chromosome, complete genome	2098647	1351963	1406313	2098647	transposase,tRNA	Staphylococcus_phage(35.0%)	51	NA	NA
WP_003099060.1|1351963_1353139_-|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	30.1	1.4e-27
WP_003101330.1|1355928_1359474_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_003101331.1|1359474_1360167_-	ribonuclease III	NA	J2YAN1	Acanthamoeba_polyphaga_lentillevirus	33.8	9.5e-24
WP_003101333.1|1360269_1361079_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	34.8	3.1e-34
WP_003101335.1|1361082_1362441_-	cell wall metabolism sensor histidine kinase VicK	NA	W8CYF6	Bacillus_phage	34.8	8.0e-35
WP_003101337.1|1362433_1363144_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	40.7	1.5e-40
WP_003101338.1|1363400_1364198_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.5	1.3e-37
WP_016356082.1|1364194_1365025_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003101340.1|1365039_1365741_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003101341.1|1365756_1366404_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003101345.1|1366441_1367449_-	DUF3114 domain-containing protein	NA	NA	NA	NA	NA
WP_003101347.1|1367537_1368248_-	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	34.9	1.1e-32
WP_003101354.1|1368261_1368636_-	PTS-dependent dihydroxyacetone kinase phosphotransferase subunit DhaM	NA	NA	NA	NA	NA
WP_003101356.1|1368635_1369211_-	dihydroxyacetone kinase subunit L	NA	NA	NA	NA	NA
WP_003101359.1|1369220_1370210_-	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_003101362.1|1370364_1370910_+	dihydroxyacetone kinase transcriptional activator DhaS	NA	NA	NA	NA	NA
WP_003101364.1|1370912_1371902_+	DhaKLM operon coactivator DhaQ	NA	NA	NA	NA	NA
WP_089180045.1|1372494_1373605_+|transposase	IS3-like element IS981 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.4	1.2e-49
WP_003099060.1|1373814_1374990_-|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	30.1	1.4e-27
WP_183121571.1|1375056_1375515_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	1.5e-06
WP_003101367.1|1375847_1376633_-	ABC-2 family transporter protein	NA	NA	NA	NA	NA
WP_003101368.1|1376634_1377453_-	ABC-2 family transporter protein	NA	NA	NA	NA	NA
WP_003101369.1|1377454_1378447_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.7	4.0e-15
WP_003101370.1|1378722_1379187_-|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	36.8	3.4e-17
WP_003101371.1|1379379_1381320_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	38.3	1.5e-119
WP_003101376.1|1381704_1383042_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_003101378.1|1383043_1384042_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_003101380.1|1384170_1385172_-	catabolite control protein A	NA	NA	NA	NA	NA
WP_003101382.1|1385343_1386429_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_003101385.1|1386591_1386933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003101387.1|1387122_1387785_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003101389.1|1387795_1388176_+	VOC family protein	NA	NA	NA	NA	NA
WP_003101392.1|1388302_1389229_+	glycosyltransferase family 2 protein	NA	V5USA4	Oenococcus_phage	49.8	7.8e-82
WP_016356084.1|1389372_1390056_+	DUF969 domain-containing protein	NA	NA	NA	NA	NA
WP_003101395.1|1390055_1390982_+	DUF979 domain-containing protein	NA	NA	NA	NA	NA
WP_003099060.1|1391063_1392239_-|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	30.1	1.4e-27
WP_003101396.1|1392365_1393013_+	pyroglutamyl-peptidase I	NA	NA	NA	NA	NA
WP_003101397.1|1393163_1393880_-	glutaminyl-peptide cyclotransferase	NA	NA	NA	NA	NA
WP_003101398.1|1393889_1394357_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	56.3	1.1e-39
WP_003101399.1|1394356_1396672_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	40.8	2.1e-96
WP_003101400.1|1396758_1396995_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_016356085.1|1397040_1397187_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_003101401.1|1397428_1398910_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	40.9	2.0e-71
WP_003101409.1|1399009_1399648_-	membrane protein	NA	NA	NA	NA	NA
WP_003101412.1|1399655_1400267_-	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_003101415.1|1400224_1401064_-	DNA-formamidopyrimidine glycosylase	NA	G3MA33	Bacillus_virus	33.6	2.0e-28
WP_003101416.1|1401256_1402096_-	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_142924915.1|1402185_1402254_+	SHP2/SHP3 family peptide pheromone	NA	NA	NA	NA	NA
WP_003101417.1|1402372_1403995_+	transglutaminase	NA	NA	NA	NA	NA
WP_016356087.1|1404134_1404284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003099060.1|1405137_1406313_+|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	30.1	1.4e-27
>prophage 9
NZ_CP017952	Streptococcus iniae strain 89353 chromosome, complete genome	2098647	1453481	1469291	2098647	transposase	Streptococcus_phage(80.0%)	20	NA	NA
WP_003101503.1|1453481_1454309_+	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	79.9	2.9e-128
WP_003101504.1|1454310_1454970_+	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_003101505.1|1455117_1455492_+	glyoxalase/bleomycin resistance/extradiol dioxygenase family protein	NA	NA	NA	NA	NA
WP_003101507.1|1455516_1455933_+	VOC family protein	NA	NA	NA	NA	NA
WP_003101510.1|1456083_1456986_+	cation transporter	NA	M1Q1N9	Streptococcus_phage	49.3	4.2e-72
WP_003101511.1|1457111_1458794_+|transposase	IS1182 family transposase	transposase	A0A146ICT8	Staphylococcus_phage	41.0	1.7e-103
WP_003101512.1|1458785_1459142_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	66.1	1.0e-37
WP_003101518.1|1459138_1459633_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	53.5	1.9e-42
WP_003101520.1|1459702_1460878_-	3-phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	75.1	1.0e-166
WP_003101521.1|1460920_1461469_-	GNAT family N-acetyltransferase	NA	M1PSC3	Streptococcus_phage	59.6	2.1e-50
WP_031239202.1|1461492_1462584_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	76.8	4.0e-162
WP_003101523.1|1462703_1463336_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_003101524.1|1463515_1464382_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	72.5	3.5e-116
WP_003101525.1|1464386_1464719_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	56.5	2.3e-28
WP_016356097.1|1464708_1465509_-	PSP1 C-terminal domain protein	NA	NA	NA	NA	NA
WP_003101528.1|1465505_1466381_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	49.7	6.3e-73
WP_003101530.1|1466398_1467031_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	63.6	1.2e-70
WP_003101532.1|1467111_1467774_-	CBS domain-containing protein	NA	M1NSC5	Streptococcus_phage	59.4	5.2e-64
WP_003101534.1|1467816_1468527_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.1	3.6e-18
WP_003101535.1|1468526_1469291_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.0	1.6e-16
