The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018074	Streptomyces venezuelae strain NRRL B-65442 chromosome	8222198	1565075	1572267	8222198		Bacillus_virus(16.67%)	8	NA	NA
WP_015032601.1|1565075_1565768_+	nucleotidyltransferase domain-containing protein	NA	G3M9V9	Bacillus_virus	27.9	3.6e-15
WP_015032602.1|1565859_1566633_-	nucleotidyltransferase domain-containing protein	NA	K4K696	Caulobacter_phage	37.1	1.4e-07
WP_015032603.1|1566636_1567659_-	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_015032604.1|1567655_1568423_-	NUDIX hydrolase	NA	A0A0E3JJF3	Streptomyces_phage	46.7	3.7e-21
WP_015032605.1|1568419_1569499_-	AAA family ATPase	NA	A0A2K8HHU5	Bacteriophage	31.1	8.9e-29
WP_041662201.1|1569495_1570149_-	nicotinamide mononucleotide transporter	NA	A0A0F6YPU8	Sinorhizobium_phage	31.2	4.9e-14
WP_041662202.1|1570294_1571653_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_015032608.1|1571652_1572267_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	29.4	3.4e-09
>prophage 2
NZ_CP018074	Streptomyces venezuelae strain NRRL B-65442 chromosome	8222198	2287502	2295540	8222198		Mycobacterium_phage(28.57%)	17	NA	NA
WP_015033288.1|2287502_2288342_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0R8VB90	Thermobifida_phage	44.3	8.7e-56
WP_015033289.1|2288338_2289307_+	AAA family ATPase	NA	E7EJT5	Mycobacterium_phage	39.3	3.1e-49
WP_015033290.1|2289335_2289707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078508645.1|2289789_2290260_+	WhiB family transcriptional regulator	NA	A0A2P1N2X5	Mycobacterium_phage	41.8	3.2e-07
WP_015033292.1|2290256_2290673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015033293.1|2290710_2291574_+	hypothetical protein	NA	A0A1J0MCR8	Streptomyces_phage	32.5	8.2e-09
WP_015033294.1|2291576_2292314_+	ATP-binding protein	NA	A0A1B1P7U2	Bacillus_phage	31.2	4.4e-11
WP_015033295.1|2292310_2292595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015033296.1|2292587_2292926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015033297.1|2292922_2293231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015033298.1|2293227_2293479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015033299.1|2293601_2293853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015033300.1|2293930_2294248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051025861.1|2294141_2294561_+	ATP-binding protein	NA	A0A1B1P8D0	Bacillus_phage	43.1	5.4e-06
WP_015033302.1|2294557_2294776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015033303.1|2294801_2295092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015033304.1|2295174_2295540_+	hypothetical protein	NA	A0A0K0N7I1	Gordonia_phage	43.8	7.2e-23
>prophage 3
NZ_CP018074	Streptomyces venezuelae strain NRRL B-65442 chromosome	8222198	2314970	2322901	8222198	capsid,portal,terminase	Streptomyces_phage(33.33%)	9	NA	NA
WP_015033339.1|2314970_2315837_+	NAD-dependent epimerase/dehydratase family protein	NA	M1NML0	Moumouvirus	27.6	9.1e-08
WP_015033340.1|2315854_2316052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015033342.1|2316341_2316617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106433832.1|2316945_2317392_+	hypothetical protein	NA	A0A2H5BLH4	Streptomyces_phage	47.9	3.2e-25
WP_015033345.1|2317384_2319115_+|terminase	phage terminase large subunit protein	terminase	K4NXE0	Streptomyces_phage	49.8	1.2e-136
WP_015033346.1|2319111_2320539_+|portal	phage portal protein	portal	A0A2H4JAT8	uncultured_Caudovirales_phage	41.5	1.6e-73
WP_015033347.1|2320519_2321290_+	hypothetical protein	NA	A0A2P1CI11	Mycobacterium_phage	27.2	6.0e-11
WP_015033348.1|2321344_2321932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015033349.1|2321944_2322901_+|capsid	phage major capsid protein	capsid	V5R986	Arthrobacter_phage	36.1	4.9e-39
>prophage 4
NZ_CP018074	Streptomyces venezuelae strain NRRL B-65442 chromosome	8222198	2327586	2338597	8222198		Streptomyces_phage(100.0%)	8	NA	NA
WP_015033359.1|2327586_2331930_+	hypothetical protein	NA	A0A2H5BLS1	Streptomyces_phage	52.6	3.2e-125
WP_015033360.1|2331933_2334165_+	hypothetical protein	NA	Q6VY41	Streptomyces_phage	50.8	1.9e-198
WP_015033361.1|2334166_2335258_+	DUF5047 domain-containing protein	NA	Q6VY40	Streptomyces_phage	60.9	2.3e-117
WP_041663828.1|2335461_2335938_+	hypothetical protein	NA	Q6VY39	Streptomyces_phage	75.7	3.3e-60
WP_015033363.1|2335950_2336544_+	hypothetical protein	NA	Q6VY38	Streptomyces_phage	61.9	1.8e-63
WP_015033364.1|2336557_2336809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015033366.1|2337820_2338174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015033367.1|2338174_2338597_+	hypothetical protein	NA	Q6VY36	Streptomyces_phage	38.3	1.5e-11
>prophage 5
NZ_CP018074	Streptomyces venezuelae strain NRRL B-65442 chromosome	8222198	3115017	3150791	8222198	capsid,portal,head,integrase,terminase,tail	Streptomyces_phage(98.11%)	54	3114817:3114841	3149559:3149583
3114817:3114841	attL	TGGTGCCCGGAACCGGACTCGAACC	NA	NA	NA	NA
WP_110014473.1|3115017_3115428_-	hypothetical protein	NA	A0A142K659	Streptomyces_phage	100.0	5.9e-66
WP_015034041.1|3115622_3115841_+	helix-turn-helix transcriptional regulator	NA	A0A142K660	Streptomyces_phage	100.0	8.6e-32
WP_015034042.1|3115837_3116080_+	hypothetical protein	NA	A0A142K661	Streptomyces_phage	100.0	2.6e-37
WP_015034043.1|3116156_3116381_+	hypothetical protein	NA	A0A142K662	Streptomyces_phage	100.0	9.1e-37
WP_015034044.1|3116487_3116979_+	hypothetical protein	NA	A0A142K664	Streptomyces_phage	100.0	4.1e-90
WP_015034045.1|3116978_3117353_+	hypothetical protein	NA	A0A142K665	Streptomyces_phage	100.0	1.3e-75
WP_015034046.1|3117349_3117799_+	hypothetical protein	NA	A0A142K666	Streptomyces_phage	100.0	5.6e-78
WP_145953706.1|3117795_3118386_+	hypothetical protein	NA	A0A142K667	Streptomyces_phage	100.0	2.7e-112
WP_015034048.1|3118378_3118663_+	hypothetical protein	NA	A0A142K668	Streptomyces_phage	100.0	6.5e-48
WP_041662475.1|3118659_3118866_+	hypothetical protein	NA	A0A142K669	Streptomyces_phage	100.0	7.6e-38
WP_015034049.1|3118869_3119277_+	MarR family transcriptional regulator	NA	A0A142K670	Streptomyces_phage	100.0	6.2e-76
WP_041662476.1|3119347_3120430_+	hypothetical protein	NA	A0A142K671	Streptomyces_phage	100.0	3.1e-170
WP_015034051.1|3120467_3120779_+	hypothetical protein	NA	A0A142K672	Streptomyces_phage	100.0	5.7e-53
WP_015034052.1|3120775_3121432_+	helix-turn-helix transcriptional regulator	NA	A0A142K673	Streptomyces_phage	99.5	1.1e-111
WP_015034053.1|3121456_3121717_+	WhiB family transcriptional regulator	NA	A0A142K674	Streptomyces_phage	100.0	9.6e-46
WP_051025877.1|3121752_3122745_+	hypothetical protein	NA	A0A142K675	Streptomyces_phage	100.0	1.4e-177
WP_015034055.1|3122741_3123434_+	hypothetical protein	NA	A0A142K676	Streptomyces_phage	100.0	5.9e-135
WP_015034056.1|3123430_3123958_+	HTH domain-containing protein	NA	A0A142K677	Streptomyces_phage	100.0	5.8e-90
WP_015034057.1|3124073_3124334_+	hypothetical protein	NA	A0A142K678	Streptomyces_phage	100.0	2.3e-39
WP_145953707.1|3124428_3124611_+	hypothetical protein	NA	A0A142K679	Streptomyces_phage	100.0	2.2e-28
WP_015034059.1|3124607_3124814_+	hypothetical protein	NA	A0A142K680	Streptomyces_phage	100.0	3.5e-35
WP_078508881.1|3124999_3125182_+	hypothetical protein	NA	A0A142K681	Streptomyces_phage	98.3	3.9e-30
WP_015034061.1|3125330_3125813_+|terminase	phage terminase small subunit P27 family	terminase	A0A142K627	Streptomyces_phage	100.0	3.1e-90
WP_069202201.1|3125904_3127641_+|terminase	terminase large subunit	terminase	A0A142K628	Streptomyces_phage	100.0	0.0e+00
WP_015034063.1|3127658_3127841_+	hypothetical protein	NA	A0A142K629	Streptomyces_phage	100.0	1.3e-09
WP_015034064.1|3127843_3129856_+|portal	phage portal protein	portal	A0A142K630	Streptomyces_phage	100.0	0.0e+00
WP_041662478.1|3130042_3130744_+	hypothetical protein	NA	A0A142K631	Streptomyces_phage	100.0	1.3e-129
WP_015034066.1|3130800_3132030_+|capsid	phage major capsid protein	capsid	A0A142K632	Streptomyces_phage	100.0	1.3e-230
WP_015034067.1|3132080_3132458_+	hypothetical protein	NA	A0A142K633	Streptomyces_phage	100.0	1.3e-59
WP_015034068.1|3132543_3132903_+	hypothetical protein	NA	A0A142K634	Streptomyces_phage	100.0	1.4e-42
WP_015034069.1|3132902_3133487_+	hypothetical protein	NA	A0A142K635	Streptomyces_phage	100.0	5.8e-107
WP_015034070.1|3133483_3133816_+|head,tail	head-tail adaptor protein	head,tail	A0A142K636	Streptomyces_phage	100.0	9.0e-57
WP_015034071.1|3133817_3134192_+	HK97 gp10 family phage protein	NA	A0A142K637	Streptomyces_phage	100.0	2.3e-61
WP_041663926.1|3134215_3134614_+	DUF3168 domain-containing protein	NA	A0A142K638	Streptomyces_phage	100.0	6.3e-73
WP_015034073.1|3134680_3135019_+	hypothetical protein	NA	A0A142K639	Streptomyces_phage	100.0	1.0e-47
WP_015034074.1|3135020_3135452_+	hypothetical protein	NA	A0A142K640	Streptomyces_phage	100.0	2.7e-77
WP_015034075.1|3135468_3135882_+	hypothetical protein	NA	A0A142K641	Streptomyces_phage	100.0	2.5e-72
WP_015034076.1|3135902_3136205_+	hypothetical protein	NA	A0A142K642	Streptomyces_phage	100.0	2.3e-51
WP_015034077.1|3136201_3138238_+|tail	phage tail tape measure protein	tail	A0A142K643	Streptomyces_phage	100.0	4.7e-273
WP_015034078.1|3138240_3141009_+	hypothetical protein	NA	A0A142K644	Streptomyces_phage	100.0	0.0e+00
WP_015034079.1|3141020_3141458_+	hypothetical protein	NA	A0A142K645	Streptomyces_phage	100.0	2.1e-77
WP_015034080.1|3141528_3142404_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A142K646	Streptomyces_phage	100.0	4.5e-172
WP_015034081.1|3142416_3142644_+	hypothetical protein	NA	A0A142K647	Streptomyces_phage	100.0	1.2e-33
WP_051025879.1|3142607_3142886_+	hypothetical protein	NA	A0A142K648	Streptomyces_phage	98.8	2.3e-37
WP_015034083.1|3142930_3143143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015034085.1|3143404_3144628_+	helix-turn-helix domain-containing protein	NA	A0A142K650	Streptomyces_phage	100.0	1.2e-231
WP_015034086.1|3144746_3145190_+	hypothetical protein	NA	A0A142K651	Streptomyces_phage	100.0	5.2e-76
WP_015034087.1|3145328_3145808_+	hypothetical protein	NA	A0A142K652	Streptomyces_phage	100.0	2.2e-88
WP_078508664.1|3146069_3146228_-	helix-turn-helix transcriptional regulator	NA	A0A142K654	Streptomyces_phage	100.0	2.4e-20
WP_015034090.1|3146422_3147373_-	putative regulatory protein	NA	A0A142K655	Streptomyces_phage	100.0	6.6e-177
WP_158506259.1|3147536_3147698_+	hypothetical protein	NA	A0A142K656	Streptomyces_phage	98.1	3.3e-20
WP_041662481.1|3147825_3148092_+	hypothetical protein	NA	A0A142K657	Streptomyces_phage	100.0	2.6e-38
WP_015034093.1|3148174_3149461_-|integrase	site-specific integrase	integrase	A0A142K658	Streptomyces_phage	100.0	1.7e-252
WP_015034094.1|3150020_3150791_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	31.1	7.3e-17
3149559:3149583	attR	TGGTGCCCGGAACCGGACTCGAACC	NA	NA	NA	NA
>prophage 6
NZ_CP018074	Streptomyces venezuelae strain NRRL B-65442 chromosome	8222198	4697734	4716058	8222198	tail	Streptomyces_phage(72.73%)	14	NA	NA
WP_041662771.1|4697734_4701217_+	DNA-directed RNA polymerase subunit beta	NA	G8DH04	Emiliania_huxleyi_virus	22.2	2.0e-29
WP_015035542.1|4701324_4705224_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.4	6.5e-53
WP_015035543.1|4705289_4705553_-	hypothetical protein	NA	A0A1J0MCA5	Streptomyces_phage	78.2	2.8e-29
WP_015035544.1|4705539_4705785_-	hypothetical protein	NA	A0A142K647	Streptomyces_phage	69.3	1.1e-19
WP_015035545.1|4705808_4706720_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A2P1N078	Streptomyces_phage	59.8	1.1e-101
WP_015035546.1|4706797_4707208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015035547.1|4707266_4707836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015035548.1|4707835_4708966_-	hypothetical protein	NA	A0A2H5BLE2	Streptomyces_phage	45.3	2.7e-84
WP_015035549.1|4708977_4710123_-	hypothetical protein	NA	A0A1J0MCI7	Streptomyces_phage	38.5	6.3e-57
WP_015035550.1|4710154_4711348_-	hypothetical protein	NA	A0A1V0E646	Streptomyces_phage	44.1	1.4e-43
WP_015035551.1|4711385_4712579_-	hypothetical protein	NA	A0A2H5BLD9	Streptomyces_phage	48.2	3.2e-43
WP_015035552.1|4712628_4713561_-|tail	phage tail family protein	tail	A0A1J0MCE5	Streptomyces_phage	43.1	7.7e-53
WP_015035553.1|4713608_4714856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015035554.1|4714852_4716058_-|tail	phage tail protein	tail	Q8SBP1	Clostridium_phage	45.1	1.1e-08
>prophage 7
NZ_CP018074	Streptomyces venezuelae strain NRRL B-65442 chromosome	8222198	6319947	6372584	8222198	plate,tail,protease	uncultured_Caudovirales_phage(25.0%)	40	NA	NA
WP_015036990.1|6319947_6323112_+|protease	serine protease	protease	NA	NA	NA	NA
WP_015036991.1|6323146_6324676_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	A0A2H4JC96	uncultured_Caudovirales_phage	37.3	8.0e-07
WP_041664323.1|6324727_6325084_-	extradiol dioxygenase	NA	NA	NA	NA	NA
WP_015036993.1|6325342_6328075_+	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_051025952.1|6328191_6329103_-	VCBS repeat-containing protein	NA	NA	NA	NA	NA
WP_015036995.1|6329632_6331078_+	carbohydrate ABC transporter, N-acetylglucosamine/diacetylchitobiose-binding protein	NA	NA	NA	NA	NA
WP_015036996.1|6331179_6332109_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_015036997.1|6332108_6333047_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_015036998.1|6333272_6334493_+	ROK family transcriptional regulator	NA	NA	NA	NA	NA
WP_015036999.1|6334614_6335679_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_015037000.1|6335952_6336741_+	sugar ABC transporter ATP-binding protein	NA	A0A076FI99	Aureococcus_anophage	30.7	2.3e-10
WP_015037001.1|6336737_6338057_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_015037002.1|6338312_6340271_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_015037003.1|6340393_6341908_+	amino acid permease	NA	NA	NA	NA	NA
WP_015037004.1|6342016_6343111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015037005.1|6343181_6345320_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_041663019.1|6345316_6346531_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_015037007.1|6346871_6348155_-	ribonuclease D	NA	NA	NA	NA	NA
WP_015037008.1|6348237_6348903_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_041663020.1|6349141_6349843_-	DUF3000 domain-containing protein	NA	NA	NA	NA	NA
WP_015037010.1|6349934_6351011_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_015037011.1|6351105_6352479_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_051025953.1|6352488_6353502_-	DUF4349 domain-containing protein	NA	NA	NA	NA	NA
WP_015037013.1|6353637_6355137_+	protoporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_041663021.1|6355154_6355868_+	chlorite dismutase family protein	NA	NA	NA	NA	NA
WP_041664326.1|6356062_6357109_-	TIGR04222 domain-containing membrane protein	NA	NA	NA	NA	NA
WP_015037016.1|6357116_6358517_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_181399509.1|6358627_6359329_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_015037018.1|6360359_6360938_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_015037019.1|6360934_6362896_-|plate	putative baseplate assembly protein	plate	NA	NA	NA	NA
WP_015037020.1|6362895_6363318_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	44.9	1.9e-06
WP_015037021.1|6363317_6363635_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_015037022.1|6363646_6365464_-	VgrG-related protein	NA	NA	NA	NA	NA
WP_015037023.1|6365460_6366183_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_015037024.1|6366289_6366715_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_071892231.1|6366784_6369904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015037026.1|6369908_6370067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015037027.1|6370063_6370558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015037028.1|6370554_6370995_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_015037029.1|6371030_6372584_-|tail	phage tail sheath family protein	tail	J9PVC2	Bacillus_phage	33.9	4.7e-71
