The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018065	Enterococcus faecium strain E1 chromosome, complete genome	2933268	136916	242500	2933268	tRNA,head,transposase,tail,integrase,portal,plate,protease,holin,terminase	Enterococcus_phage(20.51%)	99	178135:178153	255657:255675
WP_002296127.1|136916_138464_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_002340542.1|138873_139488_+	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	34.6	1.3e-24
WP_002287365.1|139492_139798_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_002287367.1|140050_142459_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_002287369.1|142473_142965_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.2	7.9e-17
WP_002287372.1|142957_143896_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	29.7	5.2e-09
WP_002287374.1|143895_145254_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_002287376.1|145266_146007_+	Stp1/IreP family PP2C-type Ser/Thr phosphatase	NA	NA	NA	NA	NA
WP_002287377.1|146003_148073_+	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	A0A1V0SDC3	Indivirus	30.3	3.5e-21
WP_002287379.1|148237_149137_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_002287380.1|149149_149800_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_002287382.1|149800_150439_+	thiamine diphosphokinase	NA	NA	NA	NA	NA
WP_002296044.1|150593_151448_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_002287385.1|151451_151961_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_002287386.1|152215_153790_+	hypothetical protein	NA	B5LJD6	Mycobacterium_phage	50.5	2.3e-17
WP_002287387.1|153857_155657_-	M3 family oligoendopeptidase	NA	NA	NA	NA	NA
WP_002287389.1|155779_156286_+	membrane protein	NA	NA	NA	NA	NA
WP_002287391.1|156364_157087_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002287397.1|157164_158565_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_002287399.1|158734_159709_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_002287401.1|160061_160622_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_002287403.1|160638_164160_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_002287405.1|164174_165770_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_002287407.1|165780_166050_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_002287409.1|166116_166542_+	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_002287412.1|166587_167058_+	RNA-binding protein S1	NA	NA	NA	NA	NA
WP_002287414.1|167177_168623_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	E3T4I1	Cafeteria_roenbergensis_virus	24.5	6.8e-08
WP_002287415.1|168622_169168_+	hypoxanthine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	25.3	4.1e-06
WP_002287418.1|169257_171369_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	C7U047	Ostreococcus_tauri_virus	50.3	9.1e-110
WP_002296623.1|171562_172858_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_002296623.1|173042_174338_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_002296053.1|174607_175495_+	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_048946604.1|175495_176500_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_002301217.1|176610_178107_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	40.9	6.7e-91
178135:178153	attL	GGCTCTTTGTCAATAAGGA	NA	NA	NA	NA
WP_002326809.1|178216_179512_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	5.0e-10
WP_002289731.1|187939_189133_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	72.0	1.3e-150
WP_002295566.1|189262_190735_+	MFS transporter	NA	NA	NA	NA	NA
WP_002295567.1|190817_191606_+	esterase family protein	NA	NA	NA	NA	NA
WP_002285876.1|191672_192341_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_048946583.1|192455_194168_+	ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	25.4	1.2e-14
WP_002301355.1|194170_195943_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.4	1.2e-54
WP_033647077.1|196024_197146_-|integrase	site-specific integrase	integrase	C9E2L6	Enterococcus_phage	38.5	4.0e-64
WP_002304713.1|197217_198150_-	DUF4041 domain-containing protein	NA	M1NRY5	Streptococcus_phage	53.8	1.8e-57
WP_002297386.1|198588_199041_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_002297387.1|199053_199464_-	helix-turn-helix transcriptional regulator	NA	Q5YAA4	Bacillus_phage	51.4	2.8e-31
WP_002297388.1|199738_199951_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002297389.1|199953_200166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002299323.1|200305_200461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002304466.1|200457_200697_-	DUF2188 domain-containing protein	NA	E8ZD70	Streptococcus_phage	81.1	1.8e-27
WP_002330811.1|200759_200948_+	hypothetical protein	NA	D2IZW5	Enterococcus_phage	60.3	7.4e-08
WP_002303273.1|201273_201609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033646797.1|201841_202783_+	endonuclease	NA	D2IZK1	Enterococcus_phage	79.2	1.0e-145
WP_002301573.1|202784_203675_+	hypothetical protein	NA	D2IYT9	Enterococcus_phage	84.5	1.4e-136
WP_048946585.1|203717_204518_+	hypothetical protein	NA	B4XYS6	Lactobacillus_phage	54.9	3.0e-58
WP_002299339.1|204532_205384_+	AAA family ATPase	NA	A0A0P0I3L9	Lactobacillus_phage	30.2	2.3e-27
WP_002318210.1|205584_206046_+	class I SAM-dependent methyltransferase	NA	A0A2H4PBJ4	Lactobacillus_phage	67.1	1.1e-60
WP_033646791.1|206071_206524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048946597.1|206629_206824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048946598.1|206854_207148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002341971.1|207177_207618_+	transcriptional regulator	NA	D2IYV6	Enterococcus_phage	38.4	5.3e-20
WP_060763461.1|207692_208160_+	hypothetical protein	NA	D7RWH7	Brochothrix_phage	28.5	2.4e-07
WP_048946580.1|208906_209137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048946579.1|209295_210129_+|terminase	small subunit of terminase	terminase	D2IYW0	Enterococcus_phage	67.9	4.7e-78
WP_048946578.1|210121_211537_+	DEAD/DEAH box helicase family protein	NA	C9E2I7	Enterococcus_phage	79.4	1.4e-218
WP_002298062.1|211548_213078_+|portal	phage portal protein	portal	A0A0S2MVB2	Bacillus_phage	25.0	1.7e-28
WP_002298060.1|213169_214048_+|head	phage head morphogenesis protein	head	NA	NA	NA	NA
WP_002298058.1|214049_214367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002349163.1|214415_215117_+	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_002312521.1|215131_216022_+	DUF5309 domain-containing protein	NA	NA	NA	NA	NA
WP_002311614.1|216044_216260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002298050.1|216271_216613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002298048.1|216612_216984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048946577.1|216976_217372_+	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_002317765.1|217373_217751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303295.1|217751_218360_+|tail	tail protein	tail	NA	NA	NA	NA
WP_002303297.1|218359_218701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002349899.1|218942_221732_+	tape measure protein	NA	D7RWD8	Brochothrix_phage	38.9	5.4e-70
WP_002349898.1|221721_222462_+|tail	tail protein	tail	NA	NA	NA	NA
WP_049050347.1|222458_225221_+	CHAP domain-containing protein	NA	Q9AZX5	Lactococcus_phage	39.5	1.1e-139
WP_048946725.1|225233_226142_+|plate	phage baseplate upper protein	plate	A0A1P8BKW9	Lactococcus_phage	24.3	1.1e-08
WP_002303306.1|226141_226762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002298034.1|226765_227215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305897.1|227214_227709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347165.1|227722_228154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071974452.1|228155_228293_+	XkdX family protein	NA	NA	NA	NA	NA
WP_002318262.1|228330_228624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286683.1|228620_228845_+|holin	holin	holin	NA	NA	NA	NA
WP_002286484.1|228841_229867_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A139ZVY1	Enterococcus_phage	61.3	2.1e-64
WP_099097933.1|230805_231967_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	1.8e-80
WP_002286474.1|232890_233298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296902.1|233311_233713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286473.1|233714_234086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002337498.1|234121_234421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049052232.1|234426_234657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002285906.1|235092_235659_-	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	42.8	2.2e-34
WP_002285909.1|235658_236615_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	57.4	3.3e-43
WP_002285911.1|236614_237271_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_002301403.1|237640_239659_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXE4	Bacillus_phage	39.6	5.8e-13
WP_002285916.1|240085_242500_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	72.8	0.0e+00
255657:255675	attR	GGCTCTTTGTCAATAAGGA	NA	NA	NA	NA
>prophage 2
NZ_CP018065	Enterococcus faecium strain E1 chromosome, complete genome	2933268	377272	437533	2933268	transposase,protease,tRNA,bacteriocin	Bacillus_phage(21.43%)	60	NA	NA
WP_002296623.1|377272_378568_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_002289850.1|378657_379335_-	DsbA family protein	NA	NA	NA	NA	NA
WP_002289849.1|379452_380028_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_002289848.1|380158_380863_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_002289847.1|380840_381638_+	NAD kinase	NA	NA	NA	NA	NA
WP_002294562.1|381639_382539_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_002294561.1|382556_383918_+	magnesium transporter	NA	NA	NA	NA	NA
WP_002294560.1|383979_384621_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_002294559.1|384729_385596_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_002304784.1|385813_386320_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_002289593.1|386368_387028_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_002289594.1|387047_389636_+	ATP-dependent RecD-like DNA helicase	NA	A0A218KCE8	Bacillus_phage	29.2	8.6e-62
WP_002289596.1|389738_389966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289599.1|390690_391770_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_002324227.1|391886_392819_+	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	33.2	5.9e-21
WP_002294551.1|392832_393978_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002296167.1|393964_395137_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002294549.1|395235_396201_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_002294548.1|396797_397301_+	QueT transporter family protein	NA	E7DN70	Pneumococcus_phage	34.3	3.4e-07
WP_002294577.1|397356_398001_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_002294578.1|398162_398315_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002294579.1|398338_398509_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_002294580.1|398609_399155_+	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
WP_002294581.1|399231_400119_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_002294583.1|400291_401311_+	L-lactate oxidase	NA	NA	NA	NA	NA
WP_002294584.1|401401_402274_-	L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha	NA	NA	NA	NA	NA
WP_002294585.1|402286_402955_-	L-serine ammonia-lyase, iron-sulfur-dependent, subunit beta	NA	NA	NA	NA	NA
WP_002291638.1|403297_403720_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_002294587.1|403823_404513_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_002291634.1|404922_405426_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_002294588.1|405478_405847_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_002296327.1|405952_406642_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_002295743.1|407866_408775_+|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002290558.1|409164_410697_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.0	3.3e-45
WP_002287787.1|410930_411632_+	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_002287788.1|411885_412599_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	43.7	6.5e-20
WP_002287791.1|412907_414047_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_002287792.1|414135_415101_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	70.4	3.4e-128
WP_002287793.1|415150_417310_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	63.2	3.8e-265
WP_002287795.1|417468_417693_-	glutaredoxin-like protein NrdH	NA	A0A0M7REK7	Lactobacillus_phage	42.7	1.7e-11
WP_002287797.1|418093_418567_+	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_002287799.1|418563_420696_+	ferrous iron transport protein B	NA	NA	NA	NA	NA
WP_002290587.1|420697_420832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287801.1|420925_421570_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002287805.1|421756_422950_+	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.0	1.2e-29
WP_002287807.1|422942_424670_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002304799.1|425063_425261_+	enterocin	NA	NA	NA	NA	NA
WP_002287810.1|425262_425574_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_002321654.1|425677_425824_+|bacteriocin	EntF family bacteriocin induction factor	bacteriocin	NA	NA	NA	NA
WP_000222572.1|425820_426774_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002322652.1|427403_427973_+	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_002288847.1|427959_428820_+	DegV family protein	NA	A0A1X9I5J4	Streptococcus_phage	24.4	2.7e-12
WP_002288850.1|429009_429714_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	41.6	5.8e-45
WP_002288851.1|429718_431554_+	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	37.7	4.0e-37
WP_002288852.1|431550_432867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288853.1|432867_433737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288854.1|433791_434601_+	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	33.6	3.1e-34
WP_002288856.1|434703_435333_-	flavin reductase	NA	NA	NA	NA	NA
WP_002288858.1|435502_436795_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002288860.1|436870_437533_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 3
NZ_CP018065	Enterococcus faecium strain E1 chromosome, complete genome	2933268	606225	664202	2933268	tRNA,transposase,integrase,portal,capsid,terminase	Staphylococcus_phage(20.0%)	57	651125:651151	665933:665959
WP_002287955.1|606225_607437_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_002287954.1|608009_608657_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_002287953.1|609049_611695_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.9	4.0e-163
WP_002294071.1|612004_613318_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_002287951.1|613307_613961_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_002294069.1|614015_614708_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_002294067.1|614857_615058_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	71.2	3.7e-21
WP_002287947.1|616993_617206_-	DNA-dependent RNA polymerase auxiliary subunit epsilon family protein	NA	NA	NA	NA	NA
WP_002296290.1|617598_619329_+	multidrug efflux ABC transporter subunit EfrA	NA	W8CYL7	Bacillus_phage	27.6	2.1e-43
WP_002289400.1|619325_621086_+	multidrug efflux ABC transporter subunit EfrB	NA	W8CYL7	Bacillus_phage	28.6	2.5e-52
WP_002296291.1|621180_621378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289401.1|621530_622016_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002289402.1|622119_622713_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.6	8.9e-55
WP_002289403.1|622892_623420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289404.1|623510_624248_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	40.0	2.3e-12
WP_002289405.1|624251_625169_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_002289406.1|625170_626400_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000222572.1|626433_627387_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002287759.1|628037_629651_-	CoA-disulfide reductase	NA	NA	NA	NA	NA
WP_002296511.1|629791_630700_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002287757.1|630882_632007_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_002287756.1|632031_632211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287755.1|632233_633151_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002287754.1|633143_633977_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002287753.1|634059_635178_+	glycosyl hydrolase family 88	NA	NA	NA	NA	NA
WP_002321415.1|635171_637070_+	DUF2264 domain-containing protein	NA	NA	NA	NA	NA
WP_002321414.1|637063_638287_+	glucuronyl hydrolase	NA	NA	NA	NA	NA
WP_002287747.1|638372_640307_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	31.9	1.1e-58
WP_002287746.1|640532_641189_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_002287745.1|641262_641616_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_002287744.1|641807_642737_+	permease	NA	NA	NA	NA	NA
WP_002287743.1|642747_643584_+	TIGR03943 family protein	NA	NA	NA	NA	NA
WP_002287742.1|643831_644608_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002287741.1|644783_645527_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.9	3.6e-29
WP_002296509.1|645519_647100_+	ABC transporter	NA	NA	NA	NA	NA
WP_002289868.1|647350_647830_-	threonine/serine exporter	NA	NA	NA	NA	NA
WP_002289867.1|647845_648598_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_002296505.1|649145_649871_+	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_048946575.1|650125_650392_+	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_002296503.1|650388_650820_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_002290887.1|650844_651150_+	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
651125:651151	attL	CATTCATGGCGGAAGAAGAAGAATAGA	NA	NA	NA	NA
WP_002296502.1|651230_652376_-|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	33.3	2.0e-50
WP_002296501.1|652436_653084_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002296500.1|653277_653571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296499.1|653614_653926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296495.1|654846_655209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296494.1|655245_656094_+	DNA replication protein	NA	A0A222ZGI2	Arthrobacter_phage	28.3	5.2e-08
WP_002296493.1|656083_657559_+	helicase	NA	Q4ZD27	Staphylococcus_phage	34.9	7.3e-66
WP_002296492.1|657824_658232_+	DUF3206 domain-containing protein	NA	NA	NA	NA	NA
WP_002296491.1|658234_658450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002304527.1|658453_658834_+	endonuclease	NA	A0A2I7S865	Vibrio_phage	47.9	1.7e-11
WP_002296489.1|658967_659123_+	DUF2292 domain-containing protein	NA	NA	NA	NA	NA
WP_002296488.1|659191_659665_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_002296487.1|659661_661356_+|terminase	terminase large subunit	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	43.8	9.1e-129
WP_002317249.1|661321_661507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296486.1|661510_662686_+|portal	phage portal protein	portal	A0A2H4J5A4	uncultured_Caudovirales_phage	35.6	3.2e-64
WP_002296485.1|662678_664202_+|capsid	phage major capsid protein	capsid	A0A1W6JPR8	Staphylococcus_phage	37.4	1.4e-48
665933:665959	attR	CATTCATGGCGGAAGAAGAAGAATAGA	NA	NA	NA	NA
>prophage 4
NZ_CP018065	Enterococcus faecium strain E1 chromosome, complete genome	2933268	761716	885688	2933268	transposase,tRNA,holin,bacteriocin	Streptococcus_phage(30.43%)	110	NA	NA
WP_000997695.1|761716_762895_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002292763.1|763086_763944_+	phosphate ABC transporter substrate-binding protein PstS	NA	NA	NA	NA	NA
WP_002292761.1|764058_764979_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_002296590.1|764978_765863_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_002289486.1|765877_766684_+	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.4	1.8e-13
WP_002317877.1|766699_767458_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.8	3.1e-20
WP_002289490.1|767470_768148_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_048946545.1|768385_768685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080348882.1|768710_769418_+	YibE/F family protein	NA	NA	NA	NA	NA
WP_002294975.1|769414_770182_+	YibE/F family protein	NA	NA	NA	NA	NA
WP_002330768.1|770281_771850_+	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_002322015.1|772149_772467_+	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_002289566.1|772466_772817_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_002289568.1|772983_773922_+	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
WP_002289570.1|773936_774767_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_002294970.1|774810_775836_+	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002330048.1|775850_776789_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	51.5	8.5e-76
WP_002289575.1|776913_777354_+	DUF948 domain-containing protein	NA	NA	NA	NA	NA
WP_002294968.1|777356_777959_+	YtxH domain-containing protein	NA	NA	NA	NA	NA
WP_048946544.1|778026_779133_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_002291653.1|779342_780344_+	catabolite control protein A	NA	NA	NA	NA	NA
WP_002289443.1|780679_783025_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_002289444.1|783303_784206_+	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	30.7	1.2e-21
WP_048946543.1|784418_786194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002301843.1|786450_787668_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.4	6.5e-68
WP_002320293.1|788114_789701_-	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_002291670.1|789951_790176_+	YneF family protein	NA	NA	NA	NA	NA
WP_048946715.1|790317_792069_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.7	1.3e-56
WP_071974460.1|792068_793853_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.8	5.4e-47
WP_048946714.1|794310_795162_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_048946713.1|795258_797145_+	PTS beta-glucoside transporter subunit EIIBCA	NA	NA	NA	NA	NA
WP_002294948.1|797185_798088_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_048946712.1|798317_799721_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_010782557.1|799720_801154_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002291688.1|801298_802225_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	52.8	2.3e-89
WP_048946711.1|802437_804165_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	63.0	1.4e-209
WP_048946710.1|804237_804531_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002291694.1|804614_805475_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_002287322.1|805566_805995_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_002287321.1|806156_806333_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_002291695.1|806359_806806_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	38.8	1.6e-19
WP_002291696.1|806961_808341_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_002291698.1|809046_810018_+	PhoH family protein	NA	W8D063	Erwinia_phage	49.8	3.5e-48
WP_048946709.1|810041_812234_+	HDIG domain-containing protein	NA	NA	NA	NA	NA
WP_002288749.1|812250_812727_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_002296159.1|812704_813106_+	diacylglycerol kinase family protein	NA	NA	NA	NA	NA
WP_002288753.1|813120_814020_+	GTPase Era	NA	NA	NA	NA	NA
WP_002296160.1|814162_814975_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_002296161.1|815358_816276_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_002296162.1|816277_818353_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000997695.1|818797_819976_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002296753.1|820207_820411_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_002296756.1|820410_820761_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_002295743.1|820795_821704_-|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002296207.1|822130_822910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296209.1|822955_823900_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_002296211.1|823915_824695_+	tyrosine protein kinase	NA	NA	NA	NA	NA
WP_002296213.1|824706_825405_+	CpsD/CapB family tyrosine-protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	37.6	2.4e-27
WP_002296215.1|825432_826197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002317234.1|826240_827692_+	sugar transferase	NA	NA	NA	NA	NA
WP_048946718.1|827723_828860_+	glycosyltransferase family 4 protein	NA	A0A1V0SD18	Indivirus	24.5	5.9e-07
WP_002297170.1|828859_829966_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_002297169.1|829971_830994_+	polysaccharide biosynthesis protein	NA	A0A0N7KVT5	Yellowstone_lake_phycodnavirus	30.8	5.3e-07
WP_002297168.1|831015_832071_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002321991.1|832688_833924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002343622.1|834007_835096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297162.1|835092_836514_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_002297161.1|836606_837266_+	acylneuraminate cytidylyltransferase family protein	NA	NA	NA	NA	NA
WP_002297160.1|837284_838868_+	3-hydroxy-3-methylglutaryl-CoA lyase	NA	NA	NA	NA	NA
WP_071974461.1|839002_839581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002321992.1|839526_840045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002317228.1|840052_841093_+	sugar kinase	NA	NA	NA	NA	NA
WP_002297179.1|841335_842274_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	27.2	3.6e-10
WP_071974462.1|843824_844784_+|transposase	IS30-like element IS6770 family transposase	transposase	NA	NA	NA	NA
WP_077974463.1|845106_845223_+	DUF1972 domain-containing protein	NA	NA	NA	NA	NA
WP_000222572.1|845424_846378_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002347297.1|846301_846970_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002317192.1|847111_848044_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_002317191.1|848025_849489_+	PTS fructose transporter subunit IIC	NA	NA	NA	NA	NA
WP_002294893.1|849485_849944_+	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002311310.1|849940_850915_+	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002311311.1|851355_852084_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002311312.1|852101_853298_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002311313.1|853290_854286_+	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002311314.1|854282_855224_+	hexose kinase	NA	NA	NA	NA	NA
WP_002311317.1|855891_856782_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002311319.1|856768_857578_+	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002311321.1|857591_857993_+	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002296623.1|858150_859446_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_002317189.1|859549_860500_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_002289551.1|860939_861215_-	acylphosphatase	NA	NA	NA	NA	NA
WP_002294889.1|861322_862087_+	RNA methyltransferase	NA	A0A2D1A6G0	Rhodococcus_phage	26.1	1.7e-05
WP_002296302.1|862209_862713_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_002296301.1|863121_863763_+	elongation factor G-binding protein	NA	NA	NA	NA	NA
WP_002296300.1|863932_865201_+	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	32.3	4.4e-43
WP_002296299.1|865227_866427_-	YdcF family protein	NA	NA	NA	NA	NA
WP_002296298.1|866547_867855_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_002294874.1|868325_869444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296295.1|869946_870267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288762.1|870719_870920_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	74.2	2.5e-22
WP_002288763.1|871066_873856_+	DNA polymerase III subunit epsilon	NA	A0A1X9I5C8	Streptococcus_phage	30.9	1.4e-89
WP_002321579.1|873902_874430_+	peptidase	NA	NA	NA	NA	NA
WP_002296294.1|874450_875641_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_002288767.1|875680_876979_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.3	1.2e-59
WP_002288769.1|878154_878829_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_002319756.1|878825_879167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288776.1|879196_879556_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_002296577.1|880080_882165_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.7	4.9e-116
WP_002288779.1|882455_883922_+	amino acid permease	NA	NA	NA	NA	NA
WP_002326809.1|884392_885688_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	5.0e-10
>prophage 5
NZ_CP018065	Enterococcus faecium strain E1 chromosome, complete genome	2933268	898256	1117408	2933268	tRNA,head,transposase,tail,integrase,portal,capsid,protease,holin,terminase	Streptococcus_phage(29.21%)	226	888672:888687	1075297:1076637
888672:888687	attL	GGTGCTGGAATCAGCG	NA	NA	NA	NA
WP_002296536.1|898256_898523_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0P0I3D2	Lactobacillus_phage	56.5	1.4e-07
888672:888687	attL	GGTGCTGGAATCAGCG	NA	NA	NA	NA
WP_002294831.1|898517_899210_+	N-acetylmuramoyl-L-alanine amidase	NA	Q9MCC6	Lactobacillus_phage	43.4	2.3e-30
WP_008266934.1|899578_899992_+	DUF4231 domain-containing protein	NA	NA	NA	NA	NA
WP_002295273.1|900223_900481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287107.1|900766_902017_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002287105.1|902426_903401_+	choloylglycine hydrolase family protein	NA	M1HVK5	Paramecium_bursaria_Chlorella_virus	31.8	5.4e-25
WP_002326809.1|903556_904852_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	5.0e-10
WP_074394542.1|905461_905653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296840.1|905674_906862_+|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002326708.1|907122_907440_+	SdpI family protein	NA	NA	NA	NA	NA
WP_002289810.1|907530_907896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289809.1|908103_908586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289807.1|908782_909673_+	phosphate ABC transporter substrate-binding protein PstS family protein	NA	NA	NA	NA	NA
WP_002296623.1|910075_911371_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_071974463.1|911476_912745_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	36.1	6.5e-55
WP_002297196.1|913017_915489_+	cation-translocating P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	28.8	7.0e-45
WP_002297195.1|915591_917328_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	34.1	1.2e-27
WP_002293705.1|917324_918029_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.2	1.4e-38
WP_002297194.1|918159_918663_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_002293708.1|918622_918961_+	putative DNA-binding protein	NA	NA	NA	NA	NA
WP_002293709.1|918981_920400_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002293710.1|920511_921090_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_002297192.1|921093_921615_+	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_002293714.1|921693_922248_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	29.3	2.3e-12
WP_002290274.1|922500_922776_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_002290277.1|922787_923039_+	KH domain-containing protein	NA	NA	NA	NA	NA
WP_002297190.1|923163_923955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002293716.1|924124_924646_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002293717.1|924635_925397_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_002286913.1|925532_925880_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
925686:925701	attR	GGTGCTGGAATCAGCG	NA	NA	NA	NA
WP_002286921.1|926252_926915_+	hypothetical protein	NA	NA	NA	NA	NA
925686:925701	attR	GGTGCTGGAATCAGCG	NA	NA	NA	NA
WP_002286924.1|926993_930221_+	fibrinogen-binding MSCRAMM adhesin Fss3	NA	NA	NA	NA	NA
WP_002286925.1|930334_930649_+	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	53.4	1.7e-25
WP_002286926.1|930661_931036_+	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	62.9	1.1e-34
WP_074399752.1|931036_931390_+	damage-inducible protein J	NA	NA	NA	NA	NA
WP_002286930.1|931460_932813_+	DUF87 domain-containing protein	NA	A0A1S5SFB5	Streptococcus_phage	64.6	5.9e-163
WP_002286932.1|932872_934015_+	DNA cytosine methyltransferase	NA	A0A1S5SEK0	Streptococcus_phage	62.1	1.7e-126
WP_002286933.1|934039_934294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286934.1|934549_935734_+	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	60.8	1.9e-141
WP_002305703.1|935730_935868_+	DUF3789 domain-containing protein	NA	NA	NA	NA	NA
WP_002286940.1|936613_938524_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.8	7.1e-37
WP_033657400.1|938627_938852_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	83.8	8.8e-24
WP_071974464.1|938864_939365_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	59.6	1.2e-52
WP_002288935.1|939461_941309_+	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_002297208.1|941311_942208_+	AAA family ATPase	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	29.7	1.1e-16
WP_002288938.1|942257_942647_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	65.9	1.4e-40
WP_002321772.1|942633_944979_+	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	76.0	0.0e+00
WP_002296840.1|945071_946259_+|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002289059.1|946559_948689_+	FUSC family protein	NA	A0A1S5SF30	Streptococcus_phage	60.3	3.1e-182
WP_002289057.1|948685_949693_+	lipoprotein	NA	A0A1S5SEZ8	Streptococcus_phage	63.9	4.8e-117
WP_002289055.1|949709_950621_+	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	42.2	1.1e-59
WP_002289053.1|950748_951477_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	37.1	5.1e-36
WP_002321361.1|951473_952883_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_002289051.1|953210_954332_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_077828749.1|954751_954988_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000222572.1|954940_955894_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002305710.1|956232_956742_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_087040414.1|956834_957996_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	53.5	1.6e-79
WP_002296809.1|958276_959257_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_002296810.1|959378_960797_+	beta-fructofuranosidase	NA	NA	NA	NA	NA
WP_002289221.1|960867_962337_+	PTS glucose transporter subunit IIABC	NA	NA	NA	NA	NA
WP_002289220.1|962346_962814_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_048946680.1|962849_963722_+	ROK family protein	NA	NA	NA	NA	NA
WP_002289218.1|963802_966337_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_002289217.1|966492_967266_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002289216.1|967258_968050_+	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002289215.1|968059_968551_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002289214.1|968568_968979_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002296814.1|968982_970383_+	beta-fructofuranosidase	NA	NA	NA	NA	NA
WP_002289210.1|970405_970780_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_002285758.1|971268_971463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287659.1|971452_971806_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_002296127.1|971907_973455_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_071974465.1|973606_974035_+	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
WP_002288964.1|974021_974264_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002288966.1|974563_974779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002300928.1|974885_975200_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002288969.1|975303_976482_+|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	31.1	1.4e-30
WP_002288970.1|976884_977178_+	DUF2087 domain-containing protein	NA	NA	NA	NA	NA
WP_002296840.1|978119_979307_+|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002305732.1|979494_981822_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_002288982.1|984934_986107_+	class C sortase	NA	NA	NA	NA	NA
WP_048946670.1|986316_986763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002321037.1|986759_986954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288984.1|987348_987771_+	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_002288985.1|987936_989130_-	MFS transporter	NA	NA	NA	NA	NA
WP_002288986.1|989353_989731_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002321036.1|989718_990057_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002288989.1|990190_990634_+	LysR family transcriptional regulator substrate-binding protein	NA	NA	NA	NA	NA
WP_002303949.1|990895_991711_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002321035.1|991720_991936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|992019_993198_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002289620.1|993933_995598_+	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_002289619.1|995610_996321_+	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_002289618.1|996450_996948_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_002289617.1|997132_997393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002321266.1|997754_997994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|998330_999509_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002323892.1|999625_999940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|1001047_1002226_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002296623.1|1002454_1003750_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_002302293.1|1003940_1004243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288592.1|1004999_1005773_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002288595.1|1005916_1006267_+	SdpI family protein	NA	NA	NA	NA	NA
WP_002288590.1|1006247_1006964_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.7	1.0e-33
WP_002288588.1|1006963_1008412_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.3	1.7e-19
WP_002288586.1|1008482_1008992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296838.1|1008981_1009707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002326809.1|1010039_1011335_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	5.0e-10
WP_002297218.1|1011479_1012775_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002288584.1|1012973_1015094_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	58.1	2.8e-220
WP_002288581.1|1015323_1016502_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	48.9	3.9e-102
WP_002288579.1|1016517_1017276_+	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	36.4	1.9e-25
WP_002288577.1|1017298_1017784_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_002288576.1|1017854_1019108_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	55.3	7.7e-24
WP_002288575.1|1019224_1020574_+	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_002288574.1|1020685_1022032_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_002288573.1|1022339_1022726_-	YxeA family protein	NA	NA	NA	NA	NA
WP_080488818.1|1022949_1024413_-|transposase	IS1182-like element ISEfa7 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	47.8	1.3e-123
WP_002301399.1|1025449_1026409_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002297633.1|1027272_1027485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287775.1|1027762_1029562_-	glycerophosphoryl diester phosphodiesterase	NA	I6XE30	Staphylococcus_phage	26.5	5.3e-10
WP_002287776.1|1029685_1030282_-	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	41.7	8.7e-34
WP_000222572.1|1030473_1031427_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002296337.1|1031698_1032043_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_002296336.1|1032043_1032463_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_002296335.1|1032554_1032905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296334.1|1032870_1034202_-	DUF1576 domain-containing protein	NA	NA	NA	NA	NA
WP_002296332.1|1034457_1035024_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_048946570.1|1035307_1036513_-|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	37.4	3.3e-64
WP_002317583.1|1037625_1037826_-	hypothetical protein	NA	A0A097BY73	Enterococcus_phage	87.9	2.5e-25
WP_002353429.1|1037854_1038277_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0B5CTZ7	Listeria_phage	50.7	1.0e-33
WP_048946572.1|1038293_1038716_-	helix-turn-helix transcriptional regulator	NA	A0A0M4QX29	Bacillus_phage	54.0	1.5e-32
WP_010725712.1|1039006_1039198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002342110.1|1039208_1039475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048946573.1|1039715_1040195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048946619.1|1040239_1040947_+	antirepressor	NA	D2IYT0	Enterococcus_phage	56.5	2.6e-69
WP_048946618.1|1041125_1041467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002342540.1|1041459_1042206_+	DUF1071 domain-containing protein	NA	A0A1X9IGE5	Lactococcus_phage	47.0	1.4e-41
WP_060797470.1|1042211_1042898_+	hypothetical protein	NA	C9E2N1	Enterococcus_phage	69.5	2.9e-89
WP_002342029.1|1042904_1043738_+	hypothetical protein	NA	J7KBV5	Streptococcus_phage	75.4	1.7e-48
WP_002326804.1|1043754_1044606_+	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	28.7	4.7e-25
WP_002321420.1|1044602_1044962_+	DUF1064 domain-containing protein	NA	A0A1P8BKR1	Lactococcus_phage	48.3	1.1e-18
WP_048946632.1|1044976_1045138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071974467.1|1045134_1045440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048946630.1|1045439_1045754_+	DUF1140 family protein	NA	A0A2H4JAZ4	uncultured_Caudovirales_phage	36.4	1.3e-09
WP_048946629.1|1045930_1046242_+	hypothetical protein	NA	D2IZY1	Enterococcus_phage	73.7	7.0e-35
WP_048946628.1|1046238_1046457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048946627.1|1046469_1046751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048946626.1|1046747_1047074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048946625.1|1047070_1047268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048946624.1|1047264_1047474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048946623.1|1047470_1047758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060797571.1|1048349_1048817_+	ArpU family transcriptional regulator	NA	D7RWH7	Brochothrix_phage	28.5	3.2e-07
WP_002338895.1|1049115_1049457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047928277.1|1049449_1049629_-	YegP family protein	NA	NA	NA	NA	NA
WP_048946665.1|1049990_1050203_+	hypothetical protein	NA	D2IZF7	Enterococcus_phage	57.4	1.4e-07
WP_048946664.1|1050209_1050434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002342959.1|1050460_1050994_+|terminase	terminase small subunit	terminase	A0A059NT97	Lactococcus_phage	40.7	9.2e-19
WP_002343461.1|1050980_1052225_+|terminase	PBSX family phage terminase large subunit	terminase	D2IYW1	Enterococcus_phage	81.4	1.9e-200
WP_048946663.1|1052237_1053737_+|portal	phage portal protein	portal	A0A097BY86	Enterococcus_phage	78.5	4.0e-221
WP_002323698.1|1053741_1054668_+	hypothetical protein	NA	A0A1L2JXH2	Streptococcus_phage	58.7	9.8e-93
WP_048946662.1|1054794_1055397_+	DUF4355 domain-containing protein	NA	A0A0S2MYF0	Enterococcus_phage	51.2	4.2e-36
WP_048946661.1|1055409_1056333_+|capsid	phage major capsid protein	capsid	A0A1B1V000	Enterococcus_phage	77.5	2.4e-139
WP_002323699.1|1056350_1056614_+	hypothetical protein	NA	D2J062	Enterococcus_phage	75.0	6.5e-10
WP_048946660.1|1056625_1056955_+|head,tail	phage head-tail connector protein	head,tail	A0A0S2MYD5	Enterococcus_phage	75.5	3.8e-39
WP_002293014.1|1056951_1057278_+	hypothetical protein	NA	C9E2J7	Enterococcus_phage	70.2	1.2e-37
WP_002318275.1|1057261_1057600_+	HK97 gp10 family phage protein	NA	Q77K21	Lactococcus_phage	59.8	3.0e-31
WP_048946659.1|1057599_1057992_+	hypothetical protein	NA	Q77K20	Lactococcus_phage	73.8	9.0e-48
WP_002323702.1|1058002_1058515_+|tail	phage major tail protein, TP901-1 family	tail	D7RWD5	Brochothrix_phage	66.3	7.4e-58
WP_048946658.1|1058560_1058929_+	hypothetical protein	NA	Q77RZ7	Lactococcus_phage	54.8	3.8e-24
WP_002318903.1|1058982_1059270_+	hypothetical protein	NA	D7RWD7	Brochothrix_phage	44.3	2.4e-13
WP_048946656.1|1059286_1062406_+|tail	phage tail tape measure protein	tail	Q9G097	Lactococcus_phage	78.7	1.6e-166
WP_025479340.1|1062438_1063206_+|tail	phage tail protein	tail	D7RWD9	Brochothrix_phage	45.1	1.2e-59
WP_048946655.1|1063202_1066034_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A1P8BMB8	Lactococcus_phage	59.7	0.0e+00
WP_025478734.1|1066008_1067766_+	DUF2479 domain-containing protein	NA	Q9AZ56	Lactococcus_phage	46.1	3.2e-36
WP_048946654.1|1067782_1068565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048946653.1|1068564_1070751_+	DUF2479 domain-containing protein	NA	A0A096XSZ6	Enterococcus_phage	47.0	5.5e-86
WP_048946652.1|1070753_1071200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002342064.1|1071201_1071339_+	XkdX family protein	NA	NA	NA	NA	NA
WP_010725660.1|1071375_1071669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302122.1|1071691_1071889_+|holin	holin	holin	A0A0S2MYF6	Enterococcus_phage	85.9	7.8e-24
WP_060797528.1|1071899_1072919_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1G5SA77	Enterococcus_phage	66.7	2.2e-61
WP_071974468.1|1073175_1073823_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	J7KDP1	Streptococcus_phage	35.7	3.6e-25
WP_000997695.1|1075403_1076582_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_080488818.1|1077191_1078655_+|transposase	IS1182-like element ISEfa7 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	47.8	1.3e-123
WP_002288533.1|1078929_1080825_+	asparagine synthase (glutamine-hydrolyzing)	NA	F2Y2L7	Organic_Lake_phycodnavirus	26.2	6.0e-20
WP_002288531.1|1081019_1081466_-	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
WP_002296119.1|1081693_1081843_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002296121.1|1081930_1082449_+	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	39.1	7.1e-24
WP_002293906.1|1082525_1083482_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002293905.1|1083647_1084454_+	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	32.1	1.0e-13
WP_002320813.1|1084450_1085440_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002296124.1|1085436_1086441_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002289886.1|1086572_1087115_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_002289885.1|1087134_1087833_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_002293902.1|1087853_1088066_+	YqgQ family protein	NA	NA	NA	NA	NA
WP_002288462.1|1088065_1089028_+	ROK family glucokinase	NA	NA	NA	NA	NA
WP_002288461.1|1089045_1089441_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_002288459.1|1089603_1089969_+	DUF488 family protein	NA	NA	NA	NA	NA
WP_002288458.1|1089965_1091777_+	FAD/NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_002288457.1|1091838_1092006_-	DUF3042 family protein	NA	NA	NA	NA	NA
WP_002288452.1|1092253_1093243_+	UDP-glucose 4-epimerase GalE	NA	A0A1V0SG19	Hokovirus	36.8	2.1e-48
WP_002288451.1|1093254_1094739_+	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_002288449.1|1094762_1095743_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.9	5.8e-19
WP_002288447.1|1095831_1096656_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_002288446.1|1096639_1097182_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_002288445.1|1097188_1097653_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_002288444.1|1097649_1098666_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	41.0	7.1e-60
WP_002288442.1|1099274_1099976_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_002288439.1|1100436_1101666_+	arginine deiminase	NA	NA	NA	NA	NA
WP_002288437.1|1101756_1102776_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_002288434.1|1102890_1103838_+	carbamate kinase	NA	NA	NA	NA	NA
WP_002288432.1|1104256_1105948_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.6	2.9e-74
WP_002288430.1|1106401_1106947_-	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_002296514.1|1106950_1107079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002326698.1|1107071_1108163_-	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_002293881.1|1108379_1108859_-	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002293880.1|1109217_1110000_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_002293878.1|1110098_1110980_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_002293877.1|1111115_1111838_+	UMP kinase	NA	NA	NA	NA	NA
WP_002293875.1|1111840_1112398_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_002294134.1|1112592_1113405_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	46.8	2.0e-25
WP_002296531.1|1113401_1114202_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_002288494.1|1114362_1115631_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_002288495.1|1115698_1117408_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP018065	Enterococcus faecium strain E1 chromosome, complete genome	2933268	1161671	1287781	2933268	transposase,protease,tRNA,integrase	Bacillus_phage(17.24%)	110	1256616:1256633	1291306:1291323
WP_000222572.1|1161671_1162625_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002321467.1|1163197_1163449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287830.1|1163482_1163761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287812.1|1164357_1164615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002321468.1|1164727_1165339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287817.1|1165517_1166075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287818.1|1166773_1167295_-	DsbA family protein	NA	NA	NA	NA	NA
WP_002287819.1|1167493_1171186_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_002287821.1|1171374_1172262_+	TIGR00159 family protein	NA	NA	NA	NA	NA
WP_002287822.1|1172258_1173428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287824.1|1173451_1174807_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_002287825.1|1174878_1176684_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	38.8	9.8e-97
WP_002287827.1|1177092_1177383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296309.1|1177395_1178421_+	signal peptide peptidase SppA	NA	A0A2I6UH21	Salinibacter_virus	33.1	3.2e-20
WP_002296311.1|1178423_1179083_+	RDD family protein	NA	NA	NA	NA	NA
WP_002297218.1|1179222_1180518_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_071974470.1|1180761_1181694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002292069.1|1181847_1183137_+	trigger factor	NA	NA	NA	NA	NA
WP_002288492.1|1183383_1184634_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	62.8	1.1e-147
WP_002288491.1|1184716_1185304_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_002294422.1|1187006_1187216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288485.1|1187375_1188128_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002288484.1|1188124_1189039_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_002288483.1|1189056_1190988_+	PTS fructose transporter subunit IIC	NA	NA	NA	NA	NA
WP_086953915.1|1191458_1192797_+|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_002297218.1|1194111_1195407_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002288482.1|1195708_1197268_-	ClC family H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
WP_002296417.1|1197422_1199657_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	40.3	3.3e-126
WP_002303894.1|1199673_1201710_+	NAD-dependent DNA ligase LigA	NA	A0A289ZTZ3	Serratia_phage	37.1	4.8e-100
WP_002288477.1|1201815_1202121_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_002288475.1|1202120_1203593_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_002288473.1|1203589_1205020_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_002288471.1|1205029_1206085_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	27.4	3.2e-15
WP_002288467.1|1206195_1207569_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	D0R096	Streptococcus_phage	55.9	7.1e-140
WP_002295229.1|1207571_1207700_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002288466.1|1208139_1208328_+	hypothetical protein	NA	A0A218MNE0	uncultured_virus	50.9	2.6e-08
WP_002296415.1|1208405_1209419_+	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	23.3	7.9e-11
WP_002296414.1|1209485_1210520_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_002296412.1|1210634_1212860_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_002289518.1|1212877_1214761_+	glycoside hydrolase family 2	NA	L0N6M2	Herpes_simplex_virus	34.4	1.1e-98
WP_002289516.1|1214741_1215716_+	beta-galactosidase	NA	NA	NA	NA	NA
WP_002289144.1|1216374_1217397_+	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_002289143.1|1217429_1218494_+	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_002289142.1|1218495_1219662_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	35.3	1.6e-39
WP_002289140.1|1219678_1220770_+	prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_002289139.1|1220782_1222078_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_002289138.1|1222070_1222580_+	shikimate kinase	NA	NA	NA	NA	NA
WP_002289137.1|1222576_1223413_+	prephenate dehydratase	NA	NA	NA	NA	NA
WP_002289136.1|1223475_1225212_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	30.6	5.0e-21
WP_002289135.1|1225208_1226138_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002289134.1|1226137_1226716_-	response regulator	NA	NA	NA	NA	NA
WP_002289133.1|1226988_1228275_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002289132.1|1228411_1229281_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002289130.1|1229277_1230165_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002287522.1|1230559_1230964_+|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002287525.1|1230980_1232129_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	93.4	1.2e-204
WP_002296408.1|1232902_1233676_+	DUF1538 domain-containing protein	NA	NA	NA	NA	NA
WP_002295200.1|1233672_1234071_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_048946536.1|1234255_1234927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002322028.1|1234985_1235426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002295197.1|1235437_1236106_+	2,3-bisphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_002295196.1|1236169_1236793_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_002291995.1|1236848_1237235_+	DUF1149 family protein	NA	NA	NA	NA	NA
WP_002295194.1|1237447_1238839_+	L-cystine transporter	NA	NA	NA	NA	NA
WP_002296407.1|1239449_1239818_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_002296405.1|1239997_1240939_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_002296404.1|1241007_1241739_+	serine/threonine protein phosphatase	NA	A7KV25	Bacillus_phage	30.8	1.7e-15
WP_002296403.1|1241882_1244063_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_002296402.1|1244082_1244565_+	SprT family protein	NA	NA	NA	NA	NA
WP_002296401.1|1244580_1245342_+	YdcF family protein	NA	NA	NA	NA	NA
WP_002296400.1|1245472_1246807_+	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_002296398.1|1247113_1247599_+	dehydratase	NA	NA	NA	NA	NA
WP_002296397.1|1247591_1248275_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_002296395.1|1248400_1251046_+	DNA polymerase I	NA	F8WQ35	Bacillus_phage	35.7	3.0e-54
WP_002288323.1|1251090_1251927_+	DNA-formamidopyrimidine glycosylase	NA	A0A127AWE5	Bacillus_phage	30.2	1.8e-24
WP_002288324.1|1251890_1252520_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_002288325.1|1252571_1252904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288327.1|1253215_1253707_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_002288329.1|1253729_1255103_+	Replication initiation and membrane attachment	NA	NA	NA	NA	NA
WP_002288331.1|1255102_1256029_+	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	41.3	5.1e-33
WP_002288333.1|1256157_1256598_+	lipoprotein	NA	NA	NA	NA	NA
1256616:1256633	attL	AAAATAAGAAAATGTTGT	NA	NA	NA	NA
WP_002288335.1|1256741_1257443_+|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_002288338.1|1257439_1258561_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_002288340.1|1258575_1259808_+	peptidase T	NA	NA	NA	NA	NA
WP_002288343.1|1259939_1260848_+	YegS/Rv2252/BmrU family lipid kinase	NA	NA	NA	NA	NA
WP_002288344.1|1260882_1261155_+	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_002288347.1|1261165_1262212_+	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_002288348.1|1262462_1265072_+	ATP-dependent chaperone ClpB	NA	A0A2I7SAX5	Vibrio_phage	35.0	1.6e-132
WP_002288350.1|1265222_1265894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288352.1|1265886_1266381_-	nucleoside deoxyribosyltransferase	NA	A0A1W6JK28	Lactococcus_phage	56.5	7.2e-42
WP_002288353.1|1266400_1267621_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002288355.1|1267767_1269603_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.4	3.4e-20
WP_002326809.1|1269765_1271061_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	5.0e-10
WP_002288357.1|1271218_1272346_-|integrase	site-specific integrase	integrase	A0A2I7SCV1	Paenibacillus_phage	55.5	1.8e-109
WP_000222572.1|1272402_1273356_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_000997695.1|1273511_1274690_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002321532.1|1274935_1275226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002322258.1|1275343_1275604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289415.1|1275740_1276154_-	Hsp20/alpha crystallin family protein	NA	A0A1B2LRT2	Wolbachia_phage	31.5	2.1e-07
WP_002303864.1|1276609_1277095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289418.1|1277233_1277449_-	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_002289420.1|1277672_1278473_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	26.2	2.6e-09
WP_002289421.1|1278491_1280360_+	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_002289422.1|1280352_1280844_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002289423.1|1280831_1281386_+	PTS sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_002296760.1|1281403_1282399_+	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_002287107.1|1282540_1283791_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002296624.1|1284199_1284598_+	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_002296627.1|1285869_1286757_-	rotamase	NA	NA	NA	NA	NA
WP_002378019.1|1286941_1287781_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
1291306:1291323	attR	AAAATAAGAAAATGTTGT	NA	NA	NA	NA
>prophage 7
NZ_CP018065	Enterococcus faecium strain E1 chromosome, complete genome	2933268	1493927	1554160	2933268	transposase,tRNA	Lysinibacillus_phage(11.76%)	59	NA	NA
WP_002326809.1|1493927_1495223_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	5.0e-10
WP_002296094.1|1495436_1495724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289543.1|1495894_1497247_-	NADH dehydrogenase	NA	NA	NA	NA	NA
WP_002289542.1|1497519_1497966_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_002296093.1|1498201_1499128_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	57.2	2.7e-98
WP_002295819.1|1499267_1500155_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0K2CP65	Brevibacillus_phage	43.2	4.5e-18
WP_000222572.1|1500336_1501290_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002295818.1|1501467_1503465_-	transketolase	NA	NA	NA	NA	NA
WP_002295816.1|1503566_1503818_-	DUF896 family protein	NA	NA	NA	NA	NA
WP_002322319.1|1503955_1504588_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	59.4	2.3e-16
WP_002297436.1|1504767_1504986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002295813.1|1505274_1505787_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.6	2.4e-32
WP_002296571.1|1505800_1508098_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	33.9	1.3e-80
WP_002295811.1|1508239_1508674_-	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_002296573.1|1508683_1509472_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002295809.1|1509468_1510410_-	ribonuclease Z	NA	NA	NA	NA	NA
WP_002295807.1|1510586_1511174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296575.1|1511394_1512708_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_002289734.1|1512995_1514006_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002289735.1|1514090_1515026_-	alpha/beta hydrolase	NA	W5S4D8	Pithovirus	25.4	2.0e-05
WP_071974462.1|1515211_1516171_+|transposase	IS30-like element IS6770 family transposase	transposase	NA	NA	NA	NA
WP_002295800.1|1516256_1517351_-	DUF871 domain-containing protein	NA	NA	NA	NA	NA
WP_002296283.1|1517539_1518301_+	peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	38.0	6.7e-23
WP_002295797.1|1518415_1518856_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_002295795.1|1519075_1519831_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_002296282.1|1519940_1520954_-	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_002295791.1|1521118_1522039_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_002295789.1|1522318_1522819_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_002288030.1|1522925_1523444_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_002296875.1|1523444_1524800_-	ribonuclease PH	NA	A0A0P0A2M4	Ugandan_cassava_brown_streak_virus	30.8	9.2e-15
WP_002317207.1|1524802_1525624_-	glutamate racemase	NA	NA	NA	NA	NA
WP_002296876.1|1525785_1526442_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002288038.1|1526457_1527105_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002288041.1|1527117_1527933_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002296877.1|1527946_1528684_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.6	7.7e-32
WP_002288045.1|1528937_1529948_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002296881.1|1530117_1532538_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_002295783.1|1532542_1533586_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	33.6	1.9e-31
WP_002303789.1|1533894_1534236_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002296885.1|1534304_1538027_-	helicase-exonuclease AddAB subunit AddA	NA	S5MMD7	Bacillus_phage	23.3	2.7e-24
WP_002296887.1|1538023_1541551_-	ATP-dependent helicase	NA	NA	NA	NA	NA
WP_002297218.1|1541821_1543117_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002288052.1|1543251_1544718_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	38.6	3.4e-87
WP_002340376.1|1545104_1545701_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_002288056.1|1545758_1546241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288059.1|1546346_1546544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296421.1|1546838_1547597_+	peptidase C39	NA	NA	NA	NA	NA
WP_002295776.1|1547656_1548085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288062.1|1548352_1548724_-	YxeA family protein	NA	NA	NA	NA	NA
WP_002288064.1|1548938_1549124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288067.1|1549206_1549395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002292935.1|1549418_1549682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002321369.1|1549839_1550097_+	glucose uptake protein	NA	NA	NA	NA	NA
WP_002296424.1|1550167_1550359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002295768.1|1550499_1550820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296425.1|1550842_1551277_-	universal stress protein	NA	NA	NA	NA	NA
WP_002289111.1|1551611_1552250_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A249XZV3	Enterococcus_phage	53.6	4.9e-35
WP_002287522.1|1552590_1552995_+|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002287525.1|1553011_1554160_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	93.4	1.2e-204
>prophage 8
NZ_CP018065	Enterococcus faecium strain E1 chromosome, complete genome	2933268	1607701	1617244	2933268		Synechococcus_phage(16.67%)	9	NA	NA
WP_002288010.1|1607701_1608280_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	1.3e-26
WP_002378443.1|1608276_1609320_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.7	2.7e-62
WP_002288013.1|1609351_1610791_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.1	5.3e-53
WP_002288015.1|1610775_1612998_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.3	1.9e-150
WP_002288017.1|1612998_1613670_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_002295474.1|1613671_1613926_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_002288021.1|1613925_1614654_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	E3SPA9	Prochlorococcus_phage	41.4	4.6e-45
WP_002297115.1|1614909_1615287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002348948.1|1615855_1617244_+	group II intron reverse transcriptase/maturase	NA	H7BVW2	unidentified_phage	26.0	7.0e-10
>prophage 9
NZ_CP018065	Enterococcus faecium strain E1 chromosome, complete genome	2933268	1890268	1982166	2933268	head,transposase,tail,integrase,portal,capsid,plate,protease,holin,terminase	Streptococcus_phage(13.95%)	106	1904777:1904795	1984388:1984402
WP_000997695.1|1890268_1891447_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_000222572.1|1892519_1893473_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002296623.1|1893961_1895257_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_002289372.1|1895430_1896378_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SKV4	Klosneuvirus	37.7	2.8e-50
WP_002289370.1|1896382_1897135_-	acylneuraminate cytidylyltransferase family protein	NA	NA	NA	NA	NA
WP_002289368.1|1897135_1898044_-	dehydrogenase	NA	NA	NA	NA	NA
WP_002289366.1|1898043_1899021_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002326811.1|1899033_1900176_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A2K9L0G1	Tupanvirus	27.9	2.4e-24
WP_002289363.1|1900165_1900843_-	acetyltransferase	NA	NA	NA	NA	NA
WP_002289362.1|1900815_1901964_-	UDP-N-acetylglucosamine 2-epimerase (hydrolyzing)	NA	NA	NA	NA	NA
WP_002292874.1|1901960_1902965_-	N-acetylneuraminate synthase	NA	NA	NA	NA	NA
WP_002289359.1|1902976_1903984_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	35.9	1.2e-40
WP_002292875.1|1903996_1905418_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
1904777:1904795	attL	CCACTGTTTTTTATCAAAA	NA	NA	NA	NA
WP_002302730.1|1905404_1906475_-	hypothetical protein	NA	NA	NA	NA	NA
1904777:1904795	attL	CCACTGTTTTTTATCAAAA	NA	NA	NA	NA
WP_002292877.1|1906476_1907904_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_002289068.1|1907896_1908859_-	glycosyl transferase	NA	NA	NA	NA	NA
WP_002289069.1|1908891_1909977_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_002289071.1|1909995_1911036_-	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	35.3	2.4e-07
WP_002289073.1|1911051_1912443_-	sugar transferase	NA	NA	NA	NA	NA
WP_002289074.1|1912820_1913804_+	serine hydrolase	NA	NA	NA	NA	NA
WP_002289076.1|1914171_1916310_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002289078.1|1916348_1917935_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_002289079.1|1917924_1919145_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	1.1e-11
WP_002289081.1|1919156_1919963_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_042957143.1|1920172_1921453_-	EpaQ family protein	NA	NA	NA	NA	NA
WP_002302719.1|1921496_1923530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286428.1|1923563_1924415_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	39.0	1.7e-38
WP_002294532.1|1924512_1925541_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	42.9	6.4e-69
WP_002286442.1|1925562_1926135_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	49.2	8.3e-42
WP_002286449.1|1926148_1927015_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.5	3.7e-102
WP_002321540.1|1927114_1927849_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002286453.1|1927826_1928654_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_002286455.1|1928653_1929454_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_002286457.1|1929446_1930586_-	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_021391141.1|1930790_1931984_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5SEW7	Streptococcus_phage	64.1	8.4e-145
WP_032518109.1|1932062_1932269_-	excisionase	NA	A0A1S5SF07	Streptococcus_phage	88.9	3.9e-26
WP_021391143.1|1932261_1933404_-	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	36.2	4.8e-65
WP_153274509.1|1933620_1933773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008788621.1|1933915_1934551_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_022278536.1|1934892_1935528_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_022278535.1|1935634_1936873_+	MFS transporter	NA	NA	NA	NA	NA
WP_022278534.1|1937099_1937519_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_008788617.1|1937523_1937763_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002286461.1|1937987_1938911_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_002294533.1|1938942_1939707_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_002286465.1|1939864_1940305_+	flavodoxin	NA	NA	NA	NA	NA
WP_002286467.1|1940482_1941052_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002286469.1|1941306_1942539_+	aminopeptidase	NA	NA	NA	NA	NA
WP_086953915.1|1943011_1944350_+|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_002286470.1|1945784_1945985_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9AZR0	Lactococcus_phage	75.7	4.6e-08
WP_002302745.1|1946234_1946465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302747.1|1946470_1946770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060797500.1|1947547_1948567_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1G5SA77	Enterococcus_phage	66.1	2.4e-60
WP_002286683.1|1948563_1948788_-|holin	holin	holin	NA	NA	NA	NA
WP_002303476.1|1948784_1949078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303475.1|1949114_1949252_-	XkdX family protein	NA	NA	NA	NA	NA
WP_002347165.1|1949253_1949685_-	hypothetical protein	NA	NA	NA	NA	NA
1949539:1949557	attR	CCACTGTTTTTTATCAAAA	NA	NA	NA	NA
WP_002305897.1|1949698_1950193_-	hypothetical protein	NA	NA	NA	NA	NA
1949539:1949557	attR	CCACTGTTTTTTATCAAAA	NA	NA	NA	NA
WP_002298034.1|1950192_1950642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303523.1|1950645_1951263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002371974.1|1951262_1952171_-|plate	phage baseplate upper protein	plate	A0A1P8BLW0	Lactococcus_phage	25.2	7.8e-10
WP_002347164.1|1952183_1954943_-	CHAP domain-containing protein	NA	D7RWE0	Brochothrix_phage	55.7	1.6e-50
WP_002349218.1|1954939_1955644_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_002303051.1|1955655_1957965_-|tail	phage tail tape measure protein	tail	Q8W5Z7	Listeria_phage	50.1	5.5e-84
WP_002303049.1|1958159_1958624_-	hypothetical protein	NA	A0A2H4J956	uncultured_Caudovirales_phage	38.9	1.4e-15
WP_002303047.1|1958623_1959250_-|tail	tail protein	tail	A0A2H4JGN2	uncultured_Caudovirales_phage	34.5	5.7e-28
WP_002303045.1|1959256_1959622_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_002303043.1|1959611_1959950_-	hypothetical protein	NA	A0A1B1P7P2	Bacillus_phage	45.9	9.6e-22
WP_002303041.1|1959939_1960266_-|head	phage head closure protein	head	A0A0N7IRA3	Lactobacillus_phage	53.4	2.9e-23
WP_002301326.1|1960246_1960525_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1C8E967	Bacillus_phage	62.7	3.5e-22
WP_002303037.1|1960526_1961891_-|capsid	phage major capsid protein	capsid	A0A1B2APY9	Phage_Wrath	69.1	2.2e-125
WP_002349220.1|1961903_1962479_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1B2APW1	Phage_Wrath	71.7	3.6e-69
WP_002303034.1|1962444_1963674_-|portal	phage portal protein	portal	A0A2H4J9C7	uncultured_Caudovirales_phage	65.0	1.7e-145
WP_002303033.1|1963695_1965423_-|terminase	terminase large subunit	terminase	A0A2H4JDG5	uncultured_Caudovirales_phage	73.3	6.9e-265
WP_002303032.1|1965419_1965872_-	hypothetical protein	NA	A0A2H4JFK0	uncultured_Caudovirales_phage	66.2	6.8e-47
WP_002304435.1|1965983_1966364_-	HNH endonuclease	NA	A0A1B1P7N1	Bacillus_phage	64.0	4.7e-41
WP_002303030.1|1966360_1966747_-	hypothetical protein	NA	A0A1B1P7N8	Bacillus_phage	36.7	1.9e-10
WP_002303029.1|1966748_1967027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002349221.1|1967074_1967803_+	DUF4145 domain-containing protein	NA	A0A1X9I5M7	Streptococcus_phage	52.4	1.2e-58
WP_002303026.1|1967948_1968425_-	DUF1492 domain-containing protein	NA	A0A2H4JFW6	uncultured_Caudovirales_phage	50.8	2.2e-27
WP_002303025.1|1968718_1968904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303024.1|1968904_1969177_-	DUF3850 domain-containing protein	NA	C9E2N9	Enterococcus_phage	61.6	5.5e-20
WP_002304431.1|1969173_1969377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303022.1|1969501_1969714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347162.1|1969746_1969941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002369144.1|1969953_1970136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303018.1|1970762_1971128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303017.1|1971167_1971470_-	hypothetical protein	NA	D2IZY1	Enterococcus_phage	70.7	2.8e-33
WP_002303016.1|1971469_1971769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304429.1|1971931_1972201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286552.1|1972212_1972962_-	helix-turn-helix domain-containing protein	NA	A0A1L2BY83	Clostridium_phage	54.0	1.7e-31
WP_058825536.1|1972958_1973651_-	hypothetical protein	NA	C9E2N1	Enterococcus_phage	69.1	3.2e-88
WP_002286557.1|1973656_1974328_-	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	47.4	4.2e-29
WP_002286559.1|1974320_1974662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286562.1|1974839_1975538_-	phage regulatory protein	NA	D2IYT0	Enterococcus_phage	34.6	1.7e-25
WP_002286568.1|1975624_1976095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296610.1|1976137_1976317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286573.1|1976303_1976642_-	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_002296611.1|1976657_1976861_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002290310.1|1976875_1977652_-	phage antirepressor protein	NA	A0A1Q1PVU2	Staphylococcus_phage	53.8	1.1e-73
WP_002296612.1|1977950_1978271_+	helix-turn-helix transcriptional regulator	NA	A0A1S5SDR1	Streptococcus_phage	40.2	2.0e-13
WP_002296613.1|1978288_1978720_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_002303013.1|1978849_1979311_+	DUF4429 domain-containing protein	NA	A0A0F6N4L7	Staphylococcus_phage	34.8	4.5e-06
WP_002296616.1|1979344_1979980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296617.1|1980092_1980728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286587.1|1981026_1982166_+|integrase	site-specific integrase	integrase	Q9AZR0	Lactococcus_phage	47.1	2.6e-95
1984388:1984402	attR	AATATTTAATTTTTT	NA	NA	NA	NA
>prophage 10
NZ_CP018065	Enterococcus faecium strain E1 chromosome, complete genome	2933268	2053347	2061819	2933268		Streptococcus_phage(66.67%)	9	NA	NA
WP_002288083.1|2053347_2055537_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	66.6	1.8e-286
WP_002288081.1|2055851_2056454_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	58.6	1.7e-53
WP_002294035.1|2056507_2057629_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_002288078.1|2057737_2058610_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	60.4	3.1e-88
WP_002288076.1|2058678_2059026_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	41.1	5.1e-18
WP_002288073.1|2059018_2059843_-	stage 0 sporulation family protein	NA	NA	NA	NA	NA
WP_002288071.1|2059878_2060817_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	34.4	3.3e-35
WP_002292340.1|2060830_2061160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002294039.1|2061174_2061819_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.6	4.2e-58
>prophage 11
NZ_CP018065	Enterococcus faecium strain E1 chromosome, complete genome	2933268	2177468	2223488	2933268	transposase,protease	Lysinibacillus_phage(12.5%)	33	NA	NA
WP_002326809.1|2177468_2178764_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	5.0e-10
WP_002293834.1|2178935_2179637_-	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	48.6	7.8e-50
WP_002293607.1|2179652_2180093_-	nucleoside deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	50.7	8.9e-36
WP_002293608.1|2180092_2180668_-	TIGR00730 family Rossman fold protein	NA	A0A1D3SNB7	Enterococcus_phage	44.9	1.5e-35
WP_002293839.1|2182153_2182855_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002293840.1|2182962_2184372_-	family 1 glycosylhydrolase	NA	A0A0B5JD41	Pandoravirus	28.0	6.6e-32
WP_002296194.1|2184419_2186285_-	PTS beta-glucoside transporter subunit EIIBCA	NA	NA	NA	NA	NA
WP_002341672.1|2187567_2188281_-	class A sortase	NA	NA	NA	NA	NA
WP_002318717.1|2188348_2188675_-	nucleotide pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_002340341.1|2189345_2190599_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_002306055.1|2190659_2191400_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002321097.1|2191485_2192244_-	WxL domain-containing protein	NA	NA	NA	NA	NA
WP_002340340.1|2192240_2193269_-	DUF916 and DUF3324 domain-containing protein	NA	NA	NA	NA	NA
WP_002285758.1|2193979_2194174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287659.1|2194163_2194517_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_002296127.1|2194618_2196166_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_002321306.1|2196238_2198812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002321307.1|2199033_2199918_-	diacylglycerol kinase family lipid kinase	NA	NA	NA	NA	NA
WP_002321308.1|2200012_2200450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288548.1|2200666_2201578_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_002340338.1|2201954_2202593_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	32.8	3.1e-13
WP_094850595.1|2202596_2203367_-	DUF1430 domain-containing protein	NA	NA	NA	NA	NA
WP_123838299.1|2203784_2204201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002321312.1|2204758_2205424_+	helix-turn-helix domain-containing protein	NA	A0A2I7SCV6	Paenibacillus_phage	47.1	2.2e-06
WP_002321313.1|2205820_2207854_-|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
WP_002321314.1|2207971_2210494_-	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
WP_002340336.1|2210609_2214242_-	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	NA	NA	NA	NA
WP_002344971.1|2214305_2217977_-	BREX system P-loop protein BrxC	NA	NA	NA	NA	NA
WP_002321317.1|2218001_2218577_-	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
WP_002321318.1|2218576_2219176_-	DUF1819 family protein	NA	NA	NA	NA	NA
WP_002295743.1|2219304_2220213_-|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_000997695.1|2220433_2221612_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_080488818.1|2222024_2223488_-|transposase	IS1182-like element ISEfa7 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	47.8	1.3e-123
>prophage 12
NZ_CP018065	Enterococcus faecium strain E1 chromosome, complete genome	2933268	2516696	2543484	2933268	transposase,tRNA	Lysinibacillus_phage(50.0%)	25	NA	NA
WP_002326809.1|2516696_2517992_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	5.0e-10
WP_002287587.1|2518218_2519208_-	glyceraldehyde 3-phosphate reductase	NA	NA	NA	NA	NA
WP_002287588.1|2519287_2520121_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_002287590.1|2520295_2521930_-	membrane protein	NA	NA	NA	NA	NA
WP_002287592.1|2521916_2523323_-	membrane protein	NA	NA	NA	NA	NA
WP_000997695.1|2523392_2524571_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002321965.1|2524609_2525131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296909.1|2525096_2526734_+	membrane protein	NA	NA	NA	NA	NA
WP_002294728.1|2526878_2527619_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_002294730.1|2527809_2528445_-	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_002294732.1|2528591_2529833_-	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_025478783.1|2531042_2533091_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_002296623.1|2533137_2534433_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_002294735.1|2534631_2535348_-	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_000222572.1|2535446_2536400_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_000997695.1|2536523_2537702_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002296256.1|2537837_2538836_-	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_048946666.1|2538910_2539207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296258.1|2539199_2539493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296259.1|2539638_2540190_-	DUF1643 domain-containing protein	NA	NA	NA	NA	NA
WP_002296261.1|2540363_2540663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296262.1|2540689_2540956_-	DUF960 domain-containing protein	NA	NA	NA	NA	NA
WP_002340421.1|2541302_2541986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002295755.1|2542022_2542520_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002295743.1|2542575_2543484_-|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP018065	Enterococcus faecium strain E1 chromosome, complete genome	2933268	2653357	2718518	2933268	transposase,tRNA	Bacillus_phage(12.5%)	60	NA	NA
WP_000997695.1|2653357_2654536_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002289815.1|2654965_2655340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289814.1|2655456_2655939_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_002289813.1|2655990_2656569_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002289812.1|2656597_2657599_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.8	2.3e-07
WP_002290528.1|2657611_2658214_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_002294252.1|2658383_2658830_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_002294254.1|2658906_2659620_-	trehalose operon repressor	NA	A0A291LID1	Streptomyces_phage	39.7	1.2e-05
WP_002297133.1|2659842_2661831_+	PTS system trehalose-specific EIIBC component	NA	NA	NA	NA	NA
WP_002294256.1|2661915_2662476_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_048946608.1|2662497_2664606_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.1	1.8e-57
WP_002297135.1|2664623_2667269_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	26.1	3.6e-39
WP_002297137.1|2667252_2667666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297139.1|2667643_2668441_-	TIGR00282 family metallophosphoesterase	NA	NA	NA	NA	NA
WP_002294261.1|2668848_2669622_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002297142.1|2669641_2670277_-	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_002304049.1|2670304_2671102_-	formate/nitrite transporter	NA	NA	NA	NA	NA
WP_002294265.1|2671417_2672029_+	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_002297145.1|2672168_2672708_+	biotin transporter BioY	NA	NA	NA	NA	NA
WP_002297147.1|2672782_2673292_-	QueT transporter family protein	NA	NA	NA	NA	NA
WP_002297149.1|2673671_2674433_-	3-oxoacyl-ACP reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	31.7	5.5e-17
WP_002290506.1|2674429_2674651_-	DUF2829 domain-containing protein	NA	A0A0S2MV93	Bacillus_phage	33.3	1.1e-05
WP_002321200.1|2674669_2676256_-	M protein trans-acting positive regulator	NA	NA	NA	NA	NA
WP_002294273.1|2676255_2676957_-	LrgB family protein	NA	NA	NA	NA	NA
WP_002297153.1|2676949_2677360_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_002290500.1|2677686_2678421_+	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	31.4	1.4e-25
WP_000222572.1|2678573_2679527_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002326835.1|2679580_2680537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|2680661_2681840_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002287917.1|2681937_2682396_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_002311353.1|2682702_2683800_-	DUF916 and DUF3324 domain-containing protein	NA	NA	NA	NA	NA
WP_002287913.1|2683907_2685935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296745.1|2686079_2686811_-	WxL domain-containing protein	NA	NA	NA	NA	NA
WP_002287911.1|2687327_2688227_-	phosphohydrolase	NA	NA	NA	NA	NA
WP_002287910.1|2688236_2688593_-	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_002287909.1|2688947_2689244_+|tRNA	phenylalanyl-tRNA synthetase subunit alpha	tRNA	NA	NA	NA	NA
WP_002287908.1|2689887_2690841_-	siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002287907.1|2690863_2691619_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.0	2.2e-13
WP_002287906.1|2691615_2692575_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_002287905.1|2692567_2693518_-	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	40.5	3.6e-66
WP_002287902.1|2693667_2694120_+	YueI family protein	NA	NA	NA	NA	NA
WP_053084794.1|2694208_2696476_-	bifunctional glutamate--cysteine ligase GshA/glutathione synthetase GshB	NA	NA	NA	NA	NA
WP_002287900.1|2696662_2697661_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_002287898.1|2697671_2698481_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002296872.1|2698489_2702071_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_002287896.1|2702090_2702777_-	ribonuclease III	NA	K7YH73	Megavirus	32.3	9.1e-27
WP_002287894.1|2703124_2704906_-	oligopeptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002287893.1|2704931_2705846_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002287892.1|2705872_2706835_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002287891.1|2706834_2707779_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.1	3.9e-20
WP_002287889.1|2707779_2708784_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.2	5.1e-18
WP_002294295.1|2709051_2709294_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_002289721.1|2709415_2710417_-	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_002301167.1|2710465_2712502_-	ATP-dependent DNA helicase RecG	NA	A0A2H4JBQ0	uncultured_Caudovirales_phage	22.9	5.3e-06
WP_002301169.1|2712618_2714301_-	DAK2 domain-containing protein	NA	NA	NA	NA	NA
WP_002294298.1|2714352_2714715_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002290463.1|2714984_2715173_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_002287522.1|2715381_2715786_+|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002287525.1|2715802_2716951_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	93.4	1.2e-204
WP_002297218.1|2717222_2718518_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
>prophage 14
NZ_CP018065	Enterococcus faecium strain E1 chromosome, complete genome	2933268	2810750	2892862	2933268	tRNA,transposase,protease,integrase	uncultured_Mediterranean_phage(15.38%)	59	2804228:2804244	2887440:2887456
2804228:2804244	attL	TTCTTTCAACATTTGGC	NA	NA	NA	NA
WP_002295261.1|2810750_2812148_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_002295262.1|2812164_2814066_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_002288804.1|2814297_2815011_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_002288805.1|2815022_2815790_+	ParA family protein	NA	Q8JL10	Natrialba_phage	33.6	2.8e-29
WP_002288806.1|2815776_2816667_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	33.5	1.1e-16
WP_002293106.1|2816687_2816879_+	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_002293105.1|2816887_2817988_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_002295263.1|2818077_2818773_+	DUF1129 domain-containing protein	NA	NA	NA	NA	NA
WP_002295264.1|2819277_2820762_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	41.8	5.6e-98
WP_002295265.1|2821310_2822582_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	53.4	2.0e-88
WP_002295267.1|2822875_2824084_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	27.3	2.7e-26
WP_002295268.1|2824070_2824760_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.1	1.8e-38
WP_002289036.1|2831500_2831968_+	CtsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002289035.1|2831974_2834467_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A0A8J958	Klebsiella_phage	38.3	9.0e-125
WP_002289033.1|2834687_2835611_+	U32 family peptidase	NA	NA	NA	NA	NA
WP_021415055.1|2835628_2836870_+	U32 family peptidase	NA	Q6DW11	Phage_TP	32.9	1.2e-42
WP_002289031.1|2837003_2838350_+	glutathione-disulfide reductase	NA	NA	NA	NA	NA
WP_002289029.1|2839284_2840238_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_002294811.1|2840250_2841354_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_002289025.1|2841443_2842379_-	FMN-binding protein	NA	NA	NA	NA	NA
WP_002289023.1|2842680_2844615_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002294810.1|2845071_2845488_+	NusG domain II-containing protein	NA	NA	NA	NA	NA
WP_002304808.1|2845501_2846068_+	Gx transporter family protein	NA	NA	NA	NA	NA
WP_002289380.1|2846090_2847077_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_060809340.1|2847231_2849157_-	collagen-binding MSCRAMM adhesin Scm	NA	NA	NA	NA	NA
WP_002289384.1|2849443_2849968_+	DUF664 domain-containing protein	NA	NA	NA	NA	NA
WP_010706310.1|2850284_2851253_-	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_002289388.1|2851409_2852216_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.1	1.3e-08
WP_048946534.1|2852212_2853118_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002289394.1|2853135_2854104_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_025479755.1|2854822_2858449_+	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	24.6	4.5e-48
WP_002340553.1|2858527_2862181_+	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	24.9	1.1e-62
WP_002288139.1|2862775_2863801_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_002288137.1|2864075_2865761_+	sucrose phosphorylase	NA	NA	NA	NA	NA
WP_002288135.1|2865774_2867058_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002288134.1|2867127_2867997_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002288133.1|2867993_2868830_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002288131.1|2868855_2869923_+	zinc-binding alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_002288129.1|2869919_2870747_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_010706312.1|2870791_2871817_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002288124.1|2871813_2873997_+	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_002288121.1|2875121_2875799_+	beta-phosphoglucomutase	NA	A0A1D8KNV9	Synechococcus_phage	23.2	1.6e-07
WP_002288119.1|2875882_2876410_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_002288144.1|2876610_2877297_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_002288118.1|2877376_2878915_+	gluconokinase	NA	NA	NA	NA	NA
WP_002297290.1|2879034_2879502_+	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_002295975.1|2880020_2880464_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_002287505.1|2880479_2880872_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002303709.1|2880960_2882187_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_002302358.1|2882258_2882417_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071875986.1|2882958_2883210_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_002303710.1|2883838_2884747_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_002349178.1|2884754_2885129_-|transposase	transposase	transposase	Q9JMN8	Wolbachia_phage	34.6	1.2e-09
WP_002303713.1|2886472_2887273_+	TrmB family transcriptional regulator	NA	NA	NA	NA	NA
WP_002302368.1|2887288_2888167_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
2887440:2887456	attR	TTCTTTCAACATTTGGC	NA	NA	NA	NA
WP_002303714.1|2888179_2889160_+	ornithine cyclodeaminase family protein	NA	NA	NA	NA	NA
WP_002351803.1|2889900_2891220_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_002346694.1|2891191_2891389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002351803.1|2891542_2892862_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP018066	Enterococcus faecium strain E1 plasmid pE1_230, complete sequence	230049	25807	127137	230049	transposase,integrase	Streptococcus_phage(20.0%)	98	71064:71077	129139:129152
WP_002287107.1|25807_27058_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_010733686.1|27466_29839_+	hypothetical protein	NA	B5SP25	Lactococcus_phage	50.8	7.0e-10
WP_010733685.1|29899_31360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048946614.1|31370_33575_+	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	50.9	4.7e-117
WP_002296244.1|33814_34408_+	abortive infection protein	NA	NA	NA	NA	NA
WP_010733696.1|34420_35320_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_048946612.1|35322_35820_+	single-stranded DNA-binding protein	NA	Q938M7	Temperate_phage	59.4	2.2e-43
WP_002296240.1|36185_36446_+	hypothetical protein	NA	A0A0S2MYI8	Enterococcus_phage	51.4	3.4e-11
WP_002325537.1|36890_37097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110300627.1|37144_37348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002332738.1|37363_37801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002332739.1|37793_38501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305761.1|38880_39060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287514.1|39384_39648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002321032.1|39641_39992_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_002318230.1|40015_40630_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	31.9	2.6e-17
WP_002288787.1|40943_41366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002299573.1|41375_41579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002299575.1|41789_42374_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.7	5.9e-43
WP_086322086.1|42657_43344_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	98.7	2.9e-126
WP_002305879.1|43656_44529_-	ROK family protein	NA	NA	NA	NA	NA
WP_002352509.1|44792_46739_-	PTS beta-glucoside transporter subunit IIBCA	NA	NA	NA	NA	NA
WP_002302078.1|46923_48363_+	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	25.1	1.4e-16
WP_002324511.1|48364_49327_+	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.8	3.0e-20
WP_071974497.1|50323_51277_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.1	1.6e-34
WP_002305082.1|51911_52805_+	ROK family protein	NA	NA	NA	NA	NA
WP_002305084.1|52878_54318_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	31.5	1.7e-51
WP_002305086.1|54365_54668_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002305087.1|54686_56051_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002305088.1|56106_56421_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002319287.1|56754_57801_+	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.4	1.8e-26
WP_002305090.1|57782_58019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305092.1|58412_58910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000222572.1|59293_60247_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.8	3.7e-34
WP_002336899.1|60406_61495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079994595.1|61951_62119_-	hypothetical protein	NA	M1PSQ0	Streptococcus_phage	53.7	2.5e-07
WP_002301591.1|63906_64992_+	tyrosine recombinase XerS	NA	NA	NA	NA	NA
WP_000222572.1|65099_66053_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.8	3.7e-34
WP_002301126.1|66183_67434_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002298736.1|67452_68379_-	PEP phosphonomutase	NA	NA	NA	NA	NA
WP_002301128.1|68457_69453_-	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002301130.1|69468_70638_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002301131.1|70653_71388_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
71064:71077	attL	TCTTCTTGAAGGCC	NA	NA	NA	NA
WP_086956687.1|72158_73321_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_086953915.1|73579_74918_+|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_002301811.1|75309_76602_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	41.0	6.1e-32
WP_002313174.1|76875_77136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|77386_78565_+|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.6	3.0e-30
WP_002300493.1|78727_79897_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_002300494.1|80221_81541_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_002285815.1|81537_82191_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.2	4.0e-24
WP_002348630.1|82900_83617_-	aminotransferase class V-fold PLP-dependent enzyme	NA	Q2XUY6	environmental_halophage	50.0	4.5e-45
WP_016922460.1|83740_83926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002302261.1|85532_86564_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	1.8e-26
WP_002313180.1|86570_87401_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002302265.1|87397_88204_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002302267.1|88209_89034_-	type I phosphodiesterase/nucleotide pyrophosphatase	NA	NA	NA	NA	NA
WP_002302268.1|89023_90124_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_002302270.1|90301_91087_+	histidinol phosphate phosphatase	NA	NA	NA	NA	NA
WP_002330694.1|91119_91503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077828694.1|91578_91710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002322470.1|91678_91915_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_002302275.1|91992_92964_-	radical SAM protein	NA	NA	NA	NA	NA
WP_071974499.1|93615_95238_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	47.8	1.4e-123
WP_002298085.1|95523_96900_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002298083.1|96899_97556_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	1.3e-22
WP_002301194.1|97565_98843_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_111944785.1|99092_100254_+|transposase	IS3-like element ISEfa8 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	1.8e-80
WP_010706480.1|100891_101242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099097933.1|101708_102870_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	1.8e-80
WP_002305939.1|103826_104786_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.9	4.5e-32
WP_002305121.1|104772_105378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002330559.1|105617_106766_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	91.0	1.0e-200
WP_002287522.1|106782_107187_-|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002303574.1|107435_107990_-|integrase	tyrosine-type recombinase/integrase	integrase	W8CYP1	Bacillus_phage	46.7	6.6e-36
WP_000222572.1|108454_109408_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.8	3.7e-34
WP_002319817.1|110383_111064_-|transposase	IS6-like element ISS1N family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.1	2.5e-109
WP_002351514.1|111124_111721_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	31.4	2.9e-13
WP_002351513.1|111717_112668_-	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_002351512.1|113186_113600_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A0N9SKD8	Staphylococcus_phage	39.6	1.3e-15
WP_002351511.1|113596_113833_-	addiction module antitoxin	NA	NA	NA	NA	NA
WP_002351509.1|114187_114790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002340535.1|115861_116074_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002340534.1|116063_116459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155118813.1|116551_117232_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.1	8.5e-110
WP_002340528.1|117229_117508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002339787.1|117666_117933_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002339788.1|117922_118279_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002340527.1|118361_119141_-	abortive infection family protein	NA	NA	NA	NA	NA
WP_002340526.1|119154_119871_-	Fic family protein	NA	NA	NA	NA	NA
WP_002340525.1|119919_120519_-|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	35.6	4.2e-28
WP_002351732.1|121470_122067_-	YdhK family protein	NA	NA	NA	NA	NA
WP_002307659.1|122087_122294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002351733.1|122308_123358_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	32.8	4.2e-39
WP_002340523.1|123354_123702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086956687.1|124057_125220_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_002301358.1|125730_126273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002307628.1|126585_127137_-|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	41.7	2.9e-31
129139:129152	attR	GGCCTTCAAGAAGA	NA	NA	NA	NA
>prophage 2
NZ_CP018066	Enterococcus faecium strain E1 plasmid pE1_230, complete sequence	230049	146710	199094	230049	transposase	Streptococcus_phage(55.17%)	61	NA	NA
WP_002292680.1|146710_147568_-	ParA family protein	NA	F0PIG8	Enterococcus_phage	30.7	8.1e-33
WP_002300557.1|147853_148141_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002292678.1|148130_148460_-	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_101495052.1|148734_149421_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	1.7e-126
WP_010708525.1|149442_149838_-	zeta-toxin	NA	NA	NA	NA	NA
WP_002331065.1|149839_150112_-	antitoxin	NA	A0A1X9I6E5	Streptococcus_phage	96.7	5.4e-07
WP_000527318.1|150128_150338_-	peptide-binding protein	NA	A0A1X9I6D5	Streptococcus_phage	98.6	1.4e-31
WP_002334978.1|150436_151333_-	ParA family protein	NA	A0A1X9I765	Streptococcus_phage	97.2	9.0e-152
WP_086953915.1|151444_152784_-|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_078154339.1|153050_153266_-	WYL domain-containing protein	NA	E4ZFP5	Streptococcus_phage	98.6	3.4e-33
WP_001096887.1|153898_154693_-	aminoglycoside O-phosphotransferase APH(3')-IIIa	NA	E4ZFP6	Streptococcus_phage	100.0	2.3e-154
WP_000627290.1|154785_155328_-	streptothricin N-acetyltransferase Sat4	NA	A0A1B0RXL7	Streptococcus_phage	100.0	8.9e-94
WP_001255866.1|155324_156233_-	aminoglycoside nucleotidyltransferase ANT(6)-Ia	NA	E4ZFP8	Streptococcus_phage	100.0	2.8e-177
WP_000662263.1|156265_157000_-	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	100.0	1.5e-141
WP_000228166.1|156980_157850_-	hypothetical protein	NA	A0A1X9I6C9	Streptococcus_phage	95.8	4.3e-159
WP_000567888.1|157952_158198_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000085862.1|159355_159487_-	hypothetical protein	NA	E4ZFP9	Streptococcus_phage	100.0	7.9e-17
WP_001038792.1|159491_160229_-	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	99.2	7.0e-134
WP_001814874.1|160353_160437_-	23S rRNA methyltransferase attenuation leader peptide	NA	NA	NA	NA	NA
WP_002368882.1|160457_160727_-	peptide-binding protein	NA	A0A1X9I6D5	Streptococcus_phage	81.5	7.6e-22
WP_000343406.1|161416_164404_-|transposase	Tn3 family transposase	transposase	A0A125RQ78	Bacillus_phage	38.3	7.3e-206
WP_002321606.1|164528_165134_+	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	33.2	1.2e-19
WP_000824191.1|165178_165346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000366408.1|165379_165679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001224538.1|165719_166337_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	33.1	5.1e-13
WP_002304891.1|166661_167057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000344083.1|167136_169488_-	DUF1906 domain-containing protein	NA	NA	NA	NA	NA
WP_000718009.1|169612_170302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000751236.1|170315_170768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001015311.1|170898_171579_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_002332580.1|171700_172318_-	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	36.1	4.5e-17
WP_002369922.1|172785_173310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002369923.1|173311_173722_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_080116671.1|173723_175388_-	ATP-binding cassette domain-containing protein	NA	A0A2H4UU96	Bodo_saltans_virus	24.7	2.0e-11
WP_010730645.1|175471_175786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002368126.1|175877_177023_-	glycosyltransferase family 2 protein	NA	S5WBE2	Pseudomonas_phage	37.5	1.5e-05
WP_002368123.1|177101_177296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002368121.1|177510_177855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002368120.1|178113_178773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002368118.1|179271_179661_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_002368116.1|180025_181486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153246012.1|181589_181748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002368112.1|181876_182536_-	DUF2786 domain-containing protein	NA	A0A172JHR5	Bacillus_phage	31.7	8.4e-14
WP_002369929.1|182750_183089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002368107.1|183174_183585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002368105.1|183795_184524_-	hypothetical protein	NA	B5SP25	Lactococcus_phage	54.1	2.9e-63
WP_002368103.1|185173_186433_-	hypothetical protein	NA	A8ATM0	Listeria_phage	40.5	2.4e-89
WP_002368102.1|186432_187212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002368101.1|187442_187589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002368099.1|187610_187796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002360769.1|188598_188874_-	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_002369771.1|188866_189133_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_002368095.1|189243_189828_-	thermonuclease family protein	NA	O64020	Bacillus_phage	54.7	2.8e-37
WP_002368093.1|189851_190268_-	single-stranded DNA-binding protein	NA	A0A1S5S8L6	Streptococcus_phage	50.5	9.1e-22
WP_002368092.1|190365_190860_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_002368091.1|190892_191159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002368088.1|191750_192239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077143786.1|192244_193003_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002368081.1|193551_195810_-	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_002354485.1|196440_197127_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_002296840.1|197906_199094_+|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
