The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018076	Sulfitobacter sp. AM1-D1 chromosome, complete genome	3840209	828920	837038	3840209		Tetraselmis_virus(16.67%)	9	NA	NA
WP_071970557.1|828920_829409_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	40.0	3.0e-16
WP_071970560.1|829489_829714_-	DUF465 domain-containing protein	NA	NA	NA	NA	NA
WP_071970562.1|829874_830288_+	Hsp20 family protein	NA	A0A0E3HCM0	Synechococcus_phage	40.5	8.7e-17
WP_071970564.1|830291_830510_+	DUF1150 family protein	NA	NA	NA	NA	NA
WP_071970566.1|830604_831495_+	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_071970568.1|831491_832352_+	hypothetical protein	NA	A0A1V0SAK9	Catovirus	33.6	5.1e-11
WP_071970570.1|832408_834124_-	bifunctional sulfate adenylyltransferase/adenylylsulfate kinase	NA	A0A2P1ELS9	Moumouvirus	43.1	1.5e-118
WP_071970572.1|834265_835957_-	adenylate/guanylate cyclase domain-containing protein	NA	M1HLN3	Pelagibacter_phage	29.4	5.3e-12
WP_071970574.1|836027_837038_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.6	2.7e-67
>prophage 2
NZ_CP018076	Sulfitobacter sp. AM1-D1 chromosome, complete genome	3840209	1669153	1710231	3840209	capsid,terminase,tRNA,portal,head,protease,tail,integrase	Emiliania_huxleyi_virus(15.38%)	50	1687973:1687988	1694125:1694140
WP_071971698.1|1669153_1671817_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L3D8	Tupanvirus	41.9	1.4e-78
WP_071971699.1|1671821_1672109_+	DUF1330 domain-containing protein	NA	NA	NA	NA	NA
WP_071971700.1|1672105_1672453_+	DMT family protein	NA	NA	NA	NA	NA
WP_071971701.1|1672455_1672779_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_071971702.1|1672775_1674593_-	translational GTPase TypA	NA	A0A2K5B2A5	Erysipelothrix_phage	46.3	6.5e-24
WP_071973718.1|1674718_1675048_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_172839567.1|1675064_1675526_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_071971704.1|1675636_1675843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071971705.1|1675845_1676640_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_172839514.1|1676715_1678044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071971707.1|1678305_1679520_-	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_071971708.1|1679662_1680256_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_071971709.1|1680252_1680492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071971710.1|1680503_1681157_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_071971711.1|1681905_1683003_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_071971712.1|1683018_1684554_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_071971713.1|1684640_1685588_+	FkbM family methyltransferase	NA	NA	NA	NA	NA
WP_071971714.1|1685638_1686394_+	Fe-S cluster assembly ATPase SufC	NA	G3M9Y6	Bacillus_virus	29.1	1.3e-10
WP_071971715.1|1686393_1687674_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_071971716.1|1687673_1688165_+	YIP1 family protein	NA	NA	NA	NA	NA
1687973:1687988	attL	CTTCGGGGCCCGGATC	NA	NA	NA	NA
WP_071971717.1|1688161_1688740_+	YIP1 family protein	NA	NA	NA	NA	NA
WP_071971718.1|1688739_1689960_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	41.2	8.7e-97
WP_071971719.1|1689993_1691520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172839515.1|1691792_1692854_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_172839516.1|1693173_1693329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071971723.1|1693806_1695672_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	35.0	4.1e-82
1694125:1694140	attR	GATCCGGGCCCCGAAG	NA	NA	NA	NA
WP_156874892.1|1695709_1695997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071971724.1|1695993_1696215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071971725.1|1696205_1696517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071971726.1|1696516_1696732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071971727.1|1696728_1696929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071971728.1|1696925_1697351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071971729.1|1697578_1697884_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_071971730.1|1698295_1698742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071971731.1|1699202_1699883_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071971732.1|1699903_1700521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071971733.1|1700517_1701177_+	hypothetical protein	NA	G8DGC1	Emiliania_huxleyi_virus	44.4	3.8e-46
WP_071971734.1|1701276_1701636_+	hypothetical protein	NA	I3ULZ4	Rhodobacter_phage	43.5	1.6e-14
WP_071971735.1|1701710_1702175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071971736.1|1702174_1703881_+|terminase	terminase large subunit	terminase	I3ULZ6	Rhodobacter_phage	48.3	1.8e-137
WP_071971737.1|1703880_1705137_+|portal	phage portal protein	portal	Q6JIM9	Burkholderia_virus	37.6	2.5e-62
WP_071971738.1|1705114_1705966_+|protease	Clp protease ClpP	protease	A0A141GEW1	Brucella_phage	46.6	2.6e-63
WP_071971739.1|1705976_1707269_+|capsid	phage major capsid protein	capsid	A0A141GEW2	Brucella_phage	39.6	4.4e-83
WP_071971740.1|1707353_1707740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071973720.1|1707800_1708382_+|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_071971741.1|1708378_1708714_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_071971742.1|1708713_1709127_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_071971743.1|1709126_1709546_+	hypothetical protein	NA	B4UTQ0	Rhizobium_phage	41.1	7.7e-21
WP_071971744.1|1709595_1709784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071971745.1|1709787_1710231_+	hypothetical protein	NA	B4UTQ3	Rhizobium_phage	28.8	5.7e-06
>prophage 3
NZ_CP018076	Sulfitobacter sp. AM1-D1 chromosome, complete genome	3840209	1952390	1987988	3840209	head,transposase	Pelagibaca_phage(33.33%)	49	NA	NA
WP_083545489.1|1952390_1953056_-	helix-turn-helix transcriptional regulator	NA	A0A1B0T6H5	Thiobacimonas_phage	37.6	1.5e-39
WP_071971953.1|1953143_1953395_+	hypothetical protein	NA	A0A1B0T6N5	Pelagibaca_phage	50.0	1.1e-09
WP_071971954.1|1953391_1953646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071971955.1|1953642_1953954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071971956.1|1953953_1954193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071971957.1|1954230_1955106_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_071971958.1|1955105_1957229_+|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A1B1P6Z4	Rhodovulum_phage	50.3	3.6e-191
WP_071971959.1|1957296_1958040_+	ATP-binding protein	NA	A0A1B0T6H3	Thiobacimonas_phage	44.4	1.1e-46
WP_156874903.1|1958036_1958591_+	hypothetical protein	NA	A0A1B0T6J7	Thiobacimonas_phage	36.4	1.5e-16
WP_071971961.1|1958587_1958962_+	hypothetical protein	NA	A0A1B0T6M5	Pelagibaca_phage	44.3	1.8e-21
WP_071971962.1|1958958_1959294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071971963.1|1959286_1959502_+	hypothetical protein	NA	M4SPT8	Rhodobacter_phage	47.6	2.5e-07
WP_071971964.1|1959505_1960156_+	DUF3164 family protein	NA	A0A1B0T6L8	Pelagibaca_phage	64.7	8.2e-78
WP_071971965.1|1960159_1960399_+	hypothetical protein	NA	A0A2H4JCC5	uncultured_Caudovirales_phage	47.4	2.3e-09
WP_071971966.1|1960395_1961031_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_071971967.1|1961027_1961207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071971968.1|1961206_1961620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071971969.1|1961616_1962060_+	regulatory protein GemA	NA	A0A1B0T6H1	Thiobacimonas_phage	61.9	1.9e-46
WP_071971970.1|1962059_1962311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071971971.1|1962307_1962733_+	hypothetical protein	NA	A0A1B1P702	Rhodovulum_phage	55.4	9.9e-32
WP_071971972.1|1962857_1963721_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0T6G1	Thiobacimonas_phage	61.9	1.2e-97
WP_083545492.1|1963748_1963958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071971973.1|1963961_1964378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071971974.1|1964353_1964731_+	DUF2730 family protein	NA	NA	NA	NA	NA
WP_071971975.1|1964727_1965045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071971976.1|1965049_1965610_+	DUF3486 family protein	NA	A0A219VH75	Ochrobactrum_phage	43.1	5.3e-33
WP_071971978.1|1967255_1967549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156874904.1|1967548_1967689_+	hypothetical protein	NA	A0A1B0T6K1	Pelagibaca_phage	71.7	6.1e-15
WP_071971979.1|1967685_1968027_+	hypothetical protein	NA	M4T564	Rhodobacter_phage	55.4	6.5e-26
WP_071971980.1|1968026_1968230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071971981.1|1968239_1969790_+	DUF935 domain-containing protein	NA	A0A1B0T6K0	Pelagibaca_phage	53.6	5.8e-146
WP_071971982.1|1969791_1971168_+	hypothetical protein	NA	A0A1B1P712	Rhodovulum_phage	43.5	4.0e-82
WP_071971983.1|1971486_1972554_+	hypothetical protein	NA	A0A1B0T6J6	Pelagibaca_phage	42.6	1.0e-56
WP_071971984.1|1972557_1972947_+	hypothetical protein	NA	A0A1B1P739	Rhodovulum_phage	59.2	1.4e-29
WP_071971985.1|1972962_1973856_+|head	Mu-like prophage major head subunit gpT family protein	head	A0A1B0T6J4	Pelagibaca_phage	72.1	2.9e-118
WP_071971986.1|1973928_1974210_+	hypothetical protein	NA	A0A1B0T6K3	Pelagibaca_phage	62.5	1.3e-08
WP_071971987.1|1974351_1974783_+	DUF1320 domain-containing protein	NA	A0A1B1P724	Rhodovulum_phage	52.4	1.2e-32
WP_083545494.1|1974782_1975280_+	phage virion morphogenesis protein	NA	A0A1B0T6K4	Pelagibaca_phage	53.6	1.4e-40
WP_071971988.1|1975276_1975735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071971989.1|1975746_1976679_+	hypothetical protein	NA	A0A1B1P723	Rhodovulum_phage	42.0	3.9e-57
WP_071971990.1|1976690_1977056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071971991.1|1977103_1977418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071971992.1|1977414_1980021_+	hypothetical protein	NA	A0A1B0T6I6	Pelagibaca_phage	26.4	1.7e-09
WP_071971993.1|1980017_1980437_+	hypothetical protein	NA	A0A1B0T6E0	Thiobacimonas_phage	57.9	5.5e-27
WP_071971994.1|1980433_1980958_+	hypothetical protein	NA	A0A1B0T6D7	Thiobacimonas_phage	61.5	8.4e-57
WP_071971995.1|1981021_1981441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071971996.1|1981518_1981935_+	C40 family peptidase	NA	A0A1B0T6D9	Thiobacimonas_phage	47.6	1.9e-27
WP_083545496.1|1981931_1985243_+	hypothetical protein	NA	A0A1B0T6D1	Thiobacimonas_phage	47.8	1.3e-288
WP_071971997.1|1985252_1987988_+	exo-alpha-sialidase	NA	A0A166YA50	Gordonia_phage	43.9	2.8e-10
>prophage 4
NZ_CP018076	Sulfitobacter sp. AM1-D1 chromosome, complete genome	3840209	2139608	2168421	3840209	tail,capsid,head,tRNA	uncultured_Mediterranean_phage(22.22%)	29	NA	NA
WP_071972131.1|2139608_2140673_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_071972132.1|2140682_2144051_-	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_071972133.1|2144146_2144608_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_071972134.1|2144604_2145414_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_071972135.1|2145608_2146937_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A1P8BKT8	Lactococcus_phage	47.3	7.9e-19
WP_071972136.1|2146926_2147436_+	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_156874907.1|2147808_2148693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071972137.1|2148905_2149457_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	56.2	4.9e-39
WP_071972138.1|2149449_2149956_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	52.5	8.4e-38
WP_071972139.1|2150085_2151273_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_071972140.1|2151332_2152115_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_071972141.1|2152202_2152502_+	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_071973764.1|2152654_2153674_+	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	NA	NA	NA	NA
WP_071972142.1|2153851_2155252_+	pyruvate dehydrogenase complex E1 component subunit beta	NA	NA	NA	NA	NA
WP_071972143.1|2155261_2155519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071972144.1|2155518_2156901_+	pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase	NA	NA	NA	NA	NA
WP_071972145.1|2157002_2157815_-	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_071972147.1|2158210_2162140_-|tail	glycoside hydrolase/phage tail family protein	tail	A0A0B5A7K5	Paracoccus_phage	37.0	6.0e-224
WP_071972148.1|2162139_2162574_-	C40 family peptidase	NA	A0A1V0DYB6	Dinoroseobacter_phage	52.6	3.5e-32
WP_071972149.1|2162570_2163458_-	DUF2163 domain-containing protein	NA	A0A0K0PVK1	Roseobacter_phage	39.0	2.9e-57
WP_071972150.1|2163457_2164090_-	DUF2460 domain-containing protein	NA	A0A0B5A2K3	Paracoccus_phage	49.8	2.9e-56
WP_071972151.1|2164105_2164762_-|tail	phage tail tape measure protein	tail	C0LP53	Escherichia_virus	36.1	1.4e-08
WP_071973765.1|2164754_2164931_-|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_071972152.1|2164963_2165278_-	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_071972153.1|2165280_2165715_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_071972154.1|2165750_2166161_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_071972155.1|2166157_2166496_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_071972156.1|2166492_2167086_-|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_071972157.1|2167257_2168421_-|capsid	phage major capsid protein	capsid	A0A2D1GNH4	Pseudomonas_phage	40.3	2.2e-73
>prophage 5
NZ_CP018076	Sulfitobacter sp. AM1-D1 chromosome, complete genome	3840209	2534283	2588366	3840209	capsid,tRNA,portal,head,protease,tail,integrase	Tupanvirus(25.0%)	49	2581507:2581553	2591692:2591738
WP_071972456.1|2534283_2535996_+|tRNA	methionine--tRNA ligase	tRNA	A0A2K9KZR3	Tupanvirus	34.3	1.4e-84
WP_071972457.1|2536042_2538631_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	62.3	1.7e-09
WP_071972458.1|2538781_2539696_-	hydrogen peroxide-inducible genes activator	NA	NA	NA	NA	NA
WP_071972459.1|2539791_2542020_+	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_071972460.1|2542116_2543121_+	phosphotransferase	NA	NA	NA	NA	NA
WP_071972461.1|2543133_2544534_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_071972462.1|2544530_2545742_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_071972463.1|2545738_2546545_-	creatininase family protein	NA	NA	NA	NA	NA
WP_071972464.1|2546714_2547107_+	RidA family protein	NA	NA	NA	NA	NA
WP_071972465.1|2547137_2547734_-	Isoquinoline 1-oxidoreductase subunit	NA	NA	NA	NA	NA
WP_071972466.1|2547737_2549897_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_071972467.1|2549901_2550360_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_071973805.1|2550660_2551215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071972468.1|2551245_2551722_-	Lrp/AsnC ligand binding domain-containing protein	NA	NA	NA	NA	NA
WP_071973806.1|2551830_2555253_+	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_071972469.1|2555257_2555905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071972470.1|2555974_2556718_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_156874922.1|2556714_2557113_+	GFA family protein	NA	NA	NA	NA	NA
WP_071972471.1|2557109_2557895_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_071972472.1|2558048_2559089_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_071972473.1|2559144_2560050_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071972474.1|2560147_2561014_+	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
WP_071972475.1|2561076_2561559_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_083545517.1|2561576_2562617_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_071972476.1|2562594_2564892_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_071972477.1|2565352_2568286_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	34.9	1.7e-130
WP_071972478.1|2568374_2569163_-	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_071972479.1|2569271_2570375_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_071972480.1|2570426_2570609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071972481.1|2570636_2571845_-	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_071972482.1|2571986_2573843_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.3	1.3e-40
WP_071972483.1|2574595_2575360_+	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_071972484.1|2575432_2575996_-	elongation factor P	NA	NA	NA	NA	NA
WP_071972485.1|2576215_2576536_+	elongation factor P	NA	NA	NA	NA	NA
WP_071972486.1|2576678_2578136_+	cobyric acid synthase	NA	NA	NA	NA	NA
WP_071972487.1|2578144_2578738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071972488.1|2578734_2579127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071972489.1|2579200_2580628_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_071972490.1|2580683_2581337_-	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
2581507:2581553	attL	GGATTGCAAATCCGTGTACACCGGTTCGATTCCGGTACTCGCCTCCA	NA	NA	NA	NA
WP_071973809.1|2581627_2582446_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_071972491.1|2582666_2582873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071972492.1|2582875_2583526_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071972493.1|2583625_2584057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156874923.1|2584383_2584632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071973810.1|2584767_2585832_-|portal	phage portal protein	portal	NA	NA	NA	NA
WP_071972495.1|2585834_2586413_-|head,protease	HK97 family phage prohead protease	head,protease	NA	NA	NA	NA
WP_071972496.1|2586412_2587687_-|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
WP_071972497.1|2587671_2588028_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_071972498.1|2588024_2588366_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
2591692:2591738	attR	GGATTGCAAATCCGTGTACACCGGTTCGATTCCGGTACTCGCCTCCA	NA	NA	NA	NA
>prophage 6
NZ_CP018076	Sulfitobacter sp. AM1-D1 chromosome, complete genome	3840209	3622275	3631625	3840209		Synechococcus_phage(33.33%)	9	NA	NA
WP_071973376.1|3622275_3623394_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	65.3	2.4e-133
WP_071973378.1|3623397_3624327_+	GDP-L-fucose synthase	NA	M4R1H4	Synechococcus_phage	38.6	2.4e-54
WP_071973379.1|3624323_3625490_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A0E3I7L6	Synechococcus_phage	33.0	7.4e-45
WP_071973380.1|3625666_3627106_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.2	3.1e-53
WP_071973381.1|3627132_3628005_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	57.6	6.6e-91
WP_071973382.1|3628001_3628853_-	dTDP-4-dehydrorhamnose reductase	NA	A0A140G5S3	Enterobacteria_phage	39.4	3.6e-33
WP_071973383.1|3628876_3629917_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	52.0	1.9e-92
WP_172839557.1|3629913_3630483_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	47.0	3.8e-39
WP_071973384.1|3630593_3631625_-	DUF2793 domain-containing protein	NA	F4YXU6	Roseobacter_phage	35.5	8.5e-29
>prophage 1
NZ_CP018079	Sulfitobacter sp. AM1-D1 plasmid unnamed3, complete sequence	15811	0	4206	15811		Caldibacillus_phage(50.0%)	2	NA	NA
WP_071974167.1|2395_3148_+	hypothetical protein	NA	A0A290FZK7	Caldibacillus_phage	52.8	4.8e-29
WP_071974168.1|3321_4206_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	41.1	5.6e-53
>prophage 2
NZ_CP018079	Sulfitobacter sp. AM1-D1 plasmid unnamed3, complete sequence	15811	9694	12548	15811	integrase	Rhodobacter_phage(33.33%)	4	3892:3904	12703:12715
3892:3904	attL	GTTCTCGTCCTCG	NA	NA	NA	NA
WP_067267019.1|9694_10729_+	replication initiator protein A	NA	A0A0K1LLD0	Rhodobacter_phage	47.2	7.1e-84
WP_067267018.1|10840_11509_+	ParA family protein	NA	A0A0A8IL09	Aurantimonas_phage	42.5	2.1e-36
WP_071974170.1|11492_11765_+	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_083545778.1|11918_12548_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J6I5	uncultured_Caudovirales_phage	30.5	2.3e-08
12703:12715	attR	CGAGGACGAGAAC	NA	NA	NA	NA
