The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013185	Escherichia coli strain FORC_029 chromosome, complete genome	5189944	843514	929323	5189944	protease,plate,integrase,tRNA,transposase	Escherichia_phage(13.33%)	63	883384:883401	928322:928339
WP_001390300.1|843514_845317_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_001173975.1|845307_846240_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000198270.1|846252_848235_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	35.6	2.2e-12
WP_000005080.1|848245_848713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001390299.1|848722_849022_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_001033155.1|849025_850102_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000152746.1|850109_850661_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_001154665.1|850679_852092_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001028113.1|852430_853021_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000914956.1|853026_856431_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_000029846.1|856434_858984_+	type VI secretion system ATPase TssH	NA	A0A1C3S747	Escherichia_phage	33.8	4.6e-92
WP_000169527.1|861528_861828_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000878218.1|861824_862691_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_001391950.1|863763_863982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000359994.1|864460_865615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000555380.1|866929_868063_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_077577697.1|868102_868465_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	62.5	6.4e-40
WP_000555401.1|869046_870180_+|transposase	IS110-like element ISEc45 family transposase	transposase	NA	NA	NA	NA
WP_000624688.1|871888_872239_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	6.2e-40
WP_001309734.1|872235_872670_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	1.5e-19
WP_001045649.1|873641_877760_-|protease	serine protease autotransporter toxin Pic	protease	Q9LA54	Enterobacteria_phage	45.8	0.0e+00
WP_000227970.1|878546_879623_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001189118.1|880164_881673_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	6.2e-44
WP_001254936.1|882835_883987_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	3.4e-42
883384:883401	attL	CCTGAATATACAGCATCT	NA	NA	NA	NA
WP_000747051.1|883906_884257_-|transposase	transposase	transposase	Q716C1	Shigella_phage	98.9	1.8e-39
WP_001091149.1|884326_884620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000081335.1|884708_887579_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_000105162.1|887581_889210_-	site-specific DNA-methyltransferase	NA	A0A0K1LNZ9	Escherichia_phage	42.6	4.6e-85
WP_000126413.1|889219_891607_-	S8 family peptidase	NA	NA	NA	NA	NA
WP_001273465.1|891616_892597_-	ATP-binding protein	NA	A0A1B2RW50	Lymphocystis_disease_virus	30.2	4.2e-17
WP_000286652.1|892622_895472_-	DEAD/DEAH box helicase	NA	A0A2H4J643	uncultured_Caudovirales_phage	39.6	2.2e-183
WP_001218809.1|898455_899718_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	43.1	6.9e-81
WP_000234526.1|900096_900804_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_000839766.1|901201_903337_+	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_001049791.1|903386_904643_-	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_001298916.1|904844_905924_-	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_000091700.1|905988_906264_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001297399.1|906291_907344_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000786911.1|907504_908224_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001107564.1|908223_908550_+	YggL family protein	NA	NA	NA	NA	NA
WP_000984796.1|908733_909453_+	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_000394125.1|909628_910675_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000745217.1|910791_911799_+	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000239939.1|911953_913090_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_001174743.1|913082_913676_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_001277222.1|913683_913974_-	YggU family protein	NA	NA	NA	NA	NA
WP_001094831.1|913970_914537_-	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_000997795.1|914554_915259_-	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001349546.1|915276_916257_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000017106.1|916432_916849_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_000126441.1|916848_917484_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000593273.1|917520_918471_-	glutathione synthase	NA	NA	NA	NA	NA
WP_001222508.1|918483_919215_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000286500.1|919294_920002_-	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_000858396.1|920096_920594_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_001112301.1|920670_922065_-	galactose/proton symporter	NA	NA	NA	NA	NA
WP_001062128.1|922500_923655_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001303650.1|923958_924174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297406.1|924309_924441_+	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001295380.1|924449_926426_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_000758915.1|926571_927303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000105559.1|927438_928359_+	agmatinase	NA	NA	NA	NA	NA
928322:928339	attR	AGATGCTGTATATTCAGG	NA	NA	NA	NA
WP_000701841.1|928564_929323_-|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
>prophage 2
NZ_CP013185	Escherichia coli strain FORC_029 chromosome, complete genome	5189944	1161088	1168228	5189944		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|1161088_1161727_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|1161723_1162986_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|1162982_1163891_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001272549.1|1164056_1164854_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	5.9e-70
WP_001141316.1|1164904_1165561_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.8	1.5e-50
WP_001272924.1|1165666_1168228_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 3
NZ_CP013185	Escherichia coli strain FORC_029 chromosome, complete genome	5189944	1769177	1778619	5189944		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569326.1|1769177_1770104_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|1770108_1770840_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1770820_1770928_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1770987_1771719_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1771940_1773626_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1773622_1774342_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1774388_1774859_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1774899_1775361_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001351453.1|1775485_1777486_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.3	0.0e+00
WP_001292767.1|1777482_1778619_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	4.6e-161
>prophage 4
NZ_CP013185	Escherichia coli strain FORC_029 chromosome, complete genome	5189944	1992843	2074842	5189944	terminase,holin,portal,tail,head,plate,capsid,integrase,transposase	Enterobacteria_phage(70.0%)	101	2038631:2038690	2074949:2075072
WP_032212789.1|1992843_1993698_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.4	1.2e-68
WP_001254922.1|1993801_1994953_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.3	9.8e-42
WP_001386868.1|1996899_1997265_+	permease	NA	NA	NA	NA	NA
WP_000365556.1|1997304_1998000_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	26.9	3.6e-07
WP_001157246.1|1998066_1999485_+	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.6	1.4e-101
WP_000786004.1|1999465_1999936_+	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
WP_001212216.1|1999924_2000845_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000922679.1|2001017_2001935_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_000009307.1|2002013_2002196_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000491522.1|2004057_2004873_-	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_000844800.1|2005171_2005399_-	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_071527558.1|2005507_2005750_+	protein DsrB	NA	NA	NA	NA	NA
WP_000103987.1|2005793_2006417_-	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_000983976.1|2006706_2007492_-	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000187358.1|2007500_2007770_-	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_001253441.1|2007779_2008517_-	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_001059114.1|2008516_2008882_-	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001282098.1|2008884_2009298_-	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_001295641.1|2009294_2010299_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_000133106.1|2010303_2010768_-	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_000620097.1|2010872_2012000_-	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000807584.1|2011996_2012440_-	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000213294.1|2012458_2013832_-	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_001282706.1|2013831_2014518_-	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000067950.1|2014510_2015506_-	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_000994471.1|2015498_2017157_-	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_001301376.1|2017371_2017686_+	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_001070440.1|2018029_2018362_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001386867.1|2018530_2019082_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000879825.1|2019091_2019889_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015674555.1|2020045_2020570_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.0	2.2e-33
WP_001336494.1|2020592_2020922_+	helix-turn-helix domain-containing protein	NA	A0A1B0VCD8	Salmonella_phage	86.6	8.1e-42
WP_000334575.1|2020803_2021301_-	hypothetical protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	64.5	3.8e-51
WP_000790504.1|2021409_2021643_-	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_000118890.1|2021639_2022845_-	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_001295642.1|2023031_2023445_+	lipoprotein	NA	NA	NA	NA	NA
WP_001245699.1|2023478_2024966_-	alpha-amylase	NA	NA	NA	NA	NA
WP_001057844.1|2025043_2025409_-	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_000270663.1|2025408_2025819_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_000146830.1|2025834_2027250_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_000079759.1|2027497_2028547_+	flagellin FliC	NA	NA	NA	NA	NA
WP_001087467.1|2028710_2029430_+	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_001386865.1|2029475_2030027_+	flagella biosynthesis regulatory protein FliZ	NA	NA	NA	NA	NA
WP_001317901.1|2030114_2030915_+	cystine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001128215.1|2031019_2032006_+	D-cysteine desulfhydrase	NA	NA	NA	NA	NA
WP_001158220.1|2032020_2032689_+	cystine ABC transporter permease	NA	NA	NA	NA	NA
WP_088888689.1|2032685_2033438_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	2.9e-26
WP_001152713.1|2033667_2034390_+	transcriptional regulator SdiA	NA	NA	NA	NA	NA
WP_000106474.1|2034457_2034682_-	DUF2594 family protein	NA	NA	NA	NA	NA
WP_000590344.1|2034668_2034845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000611335.1|2035140_2035797_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_001283421.1|2035793_2037626_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_001160187.1|2037682_2038231_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
2038631:2038690	attL	TTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGA	NA	NA	NA	NA
WP_001303543.1|2039223_2039505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000078920.1|2039693_2039834_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_000488112.1|2040025_2040286_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000132776.1|2040328_2041438_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	98.1	4.1e-202
WP_000005414.1|2041595_2042780_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.0	3.8e-222
WP_000290443.1|2042779_2043292_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	98.8	2.7e-92
WP_001391627.1|2043736_2043865_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	95.2	1.5e-15
WP_001390260.1|2043851_2046659_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	92.5	0.0e+00
WP_000979946.1|2046671_2047160_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	8.8e-85
WP_000954195.1|2047316_2047889_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000144016.1|2047932_2048511_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.0	7.7e-96
WP_032251415.1|2048510_2050643_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	66.0	8.0e-130
WP_001430423.1|2050645_2051176_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.8	2.1e-92
WP_032251416.1|2051168_2052065_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.3	5.7e-154
WP_000213447.1|2052068_2052419_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_032251417.1|2052415_2052997_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.9	4.3e-102
WP_032251418.1|2052993_2053629_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.1	7.6e-113
WP_000921128.1|2053621_2054089_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	96.1	2.1e-83
WP_000202135.1|2054112_2055993_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	81.0	3.8e-301
WP_000780558.1|2056131_2056539_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	1.2e-63
WP_000072317.1|2056535_2056928_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	97.7	6.4e-70
WP_032251421.1|2056924_2057248_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	95.3	2.0e-48
WP_000864893.1|2057250_2057451_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	98.5	3.0e-31
WP_000063103.1|2057450_2057945_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	1.2e-89
WP_000632318.1|2058046_2058847_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.4	6.6e-130
WP_001055094.1|2058892_2059945_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.3	3.2e-188
WP_032251422.1|2059968_2060805_-|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.6	7.9e-150
WP_000613754.1|2060959_2062711_+|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	98.3	0.0e+00
WP_000087814.1|2062710_2063757_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	2.2e-202
WP_000236495.1|2063771_2064296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000224227.1|2064882_2065146_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_032251424.1|2065147_2065618_-	hypothetical protein	NA	Q8HAA7	Salmonella_phage	40.0	3.2e-15
WP_000211293.1|2065637_2065952_-	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	51.9	3.5e-18
WP_032251426.1|2065956_2066916_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	98.7	3.5e-178
WP_000123437.1|2066992_2069815_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	96.7	0.0e+00
WP_000599403.1|2069821_2070187_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	95.9	2.1e-59
WP_000153684.1|2070328_2070574_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	91.4	3.4e-37
WP_000985145.1|2070570_2070774_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	86.6	2.3e-26
WP_000021668.1|2070860_2070974_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	1.2e-08
WP_000514281.1|2070970_2071213_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	4.4e-37
WP_000159462.1|2071224_2071503_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	81.5	3.6e-35
WP_000739029.1|2071513_2071864_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|2071885_2072089_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|2072160_2072298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786769.1|2072387_2072792_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
WP_000290355.1|2072807_2073458_+	membrane protein	NA	NA	NA	NA	NA
WP_000865208.1|2073487_2073835_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001300279.1|2073840_2074842_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
2074949:2075072	attR	TTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGAAAGATAAGAATAAAATCAAAGCAATAAGCAGTGTCGTGAAACCACCTTCGGGTGGTTTTTTTGT	NA	NA	NA	NA
>prophage 5
NZ_CP013185	Escherichia coli strain FORC_029 chromosome, complete genome	5189944	2104245	2168307	5189944	terminase,holin,portal,tail,head,capsid,integrase,tRNA,transposase,lysis	Enterobacteria_phage(51.67%)	74	2106790:2106805	2133392:2133407
WP_001025327.1|2104245_2105979_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	6.8e-87
WP_001326063.1|2106194_2106761_+	VOC family protein	NA	NA	NA	NA	NA
WP_001185740.1|2106774_2107521_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
2106790:2106805	attL	ATTTGCTGTTACAGCA	NA	NA	NA	NA
WP_001214304.1|2107908_2109009_+	cytochrome c	NA	NA	NA	NA	NA
WP_000176815.1|2109033_2111463_+	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_000399648.1|2111732_2112713_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000564745.1|2112906_2113878_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000019588.1|2113874_2114618_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252979.1|2114658_2115054_-	membrane protein	NA	NA	NA	NA	NA
WP_044713004.1|2115106_2115877_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.1e-72
WP_000362003.1|2115858_2117169_-|integrase	site-specific integrase	integrase	Q8W658	Enterobacteria_phage	95.4	3.0e-244
WP_000528718.1|2117224_2117461_-	excisionase family protein	NA	Q8W657	Enterobacteria_phage	100.0	6.4e-41
WP_001030156.1|2117469_2117616_-	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	93.8	1.6e-21
WP_000457723.1|2117619_2117862_-	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	87.5	4.3e-32
WP_000628772.1|2117946_2118705_-	phage protein	NA	A0A1U9AJ59	Stx1_converting_phage	82.0	2.7e-109
WP_000065512.1|2119218_2119767_-	ead/Ea22-like family protein	NA	A0A1I9LJM5	Stx_converting_phage	97.5	1.4e-59
WP_000476207.1|2119763_2120003_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	96.2	9.1e-35
WP_000111289.1|2119995_2120199_-	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	98.5	1.0e-31
WP_001242713.1|2120195_2120558_-	phage protein	NA	K7PH61	Enterobacteria_phage	97.5	6.8e-66
WP_000008178.1|2120548_2121085_-	5'-deoxynucleotidase	NA	A0A0P0ZCH9	Stx2-converting_phage	99.4	2.2e-100
WP_000081306.1|2121212_2122037_-	DUF2303 family protein	NA	K7PJQ6	Enterobacteria_phage	98.9	1.1e-148
WP_000179185.1|2122102_2122465_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	94.2	7.5e-57
WP_001387485.1|2123167_2123860_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.1	6.4e-121
WP_001191669.1|2123957_2124218_+	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_000526669.1|2124210_2124768_+	hypothetical protein	NA	Q8SBF4	Shigella_phage	94.1	5.3e-94
WP_001087340.1|2124764_2125910_+	peptidase	NA	A5LH69	Enterobacteria_phage	83.5	3.1e-173
WP_000620687.1|2125906_2126131_+	hypothetical protein	NA	A5LH70	Enterobacteria_phage	95.9	2.4e-37
WP_000061508.1|2126127_2126946_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	88.1	2.8e-123
WP_001387484.1|2126942_2127437_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	96.3	1.5e-84
WP_000066917.1|2127436_2128090_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_000210143.1|2128086_2128413_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	98.1	2.7e-53
WP_000767110.1|2128409_2128805_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	5.7e-66
WP_001072669.1|2128967_2129783_+	KilA-N domain-containing protein	NA	U5P4K5	Shigella_phage	99.3	8.5e-149
WP_001358491.1|2129790_2130780_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	4.7e-194
WP_001205470.1|2130797_2131154_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	92.0	2.3e-58
WP_000150292.1|2131133_2132348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000355468.1|2132350_2133526_-	hypothetical protein	NA	NA	NA	NA	NA
2133392:2133407	attR	ATTTGCTGTTACAGCA	NA	NA	NA	NA
WP_000917737.1|2133792_2133990_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
WP_000301785.1|2134124_2134838_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000874454.1|2135604_2137566_+	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	64.2	3.9e-240
WP_000142785.1|2137701_2137896_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	86.7	9.4e-22
WP_001289722.1|2137921_2138191_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	74.2	8.2e-08
WP_000284510.1|2138266_2138482_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000731267.1|2138486_2138831_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	97.4	7.2e-57
WP_001092883.1|2138881_2139415_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	4.8e-100
WP_001082546.1|2139713_2140181_+|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	99.4	3.4e-78
WP_000347013.1|2140531_2140672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015674556.1|2140804_2140990_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	81.4	4.1e-19
WP_000867568.1|2141384_2141933_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_001390579.1|2141904_2143833_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.6	7.4e-260
WP_000259002.1|2143816_2144023_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831738.1|2144019_2145612_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	4.2e-184
WP_001254006.1|2145601_2147107_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.2e-100
WP_000256796.1|2147143_2147491_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	57.0	4.4e-22
WP_000522645.1|2147548_2148577_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	1.1e-113
WP_001390684.1|2148629_2148998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204567.1|2148990_2149344_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
WP_000975015.1|2149359_2149938_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	90.6	4.9e-74
WP_000683112.1|2149934_2150330_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	2.2e-70
WP_001401350.1|2150337_2151078_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	99.2	5.0e-132
WP_000479153.1|2151093_2151516_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_000459468.1|2151497_2151932_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.3	1.7e-63
WP_000840228.1|2151924_2154486_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	99.6	0.0e+00
WP_000847379.1|2154482_2154812_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152493.1|2154811_2155510_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.8e-132
WP_000194780.1|2155514_2156258_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_000090891.1|2156194_2156827_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_000515636.1|2156887_2160367_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.0	0.0e+00
WP_001580506.1|2160434_2161034_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	95.5	1.0e-106
WP_000216489.1|2161185_2164356_+	hypothetical protein	NA	X2KTY7	Enterobacteria_phage	59.1	1.3e-83
WP_000885566.1|2164355_2164940_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	4.3e-102
WP_001217553.1|2165055_2165304_-	DinI family protein	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
WP_000891610.1|2165658_2166225_-	hydrolase	NA	NA	NA	NA	NA
WP_001258662.1|2166534_2168307_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP013185	Escherichia coli strain FORC_029 chromosome, complete genome	5189944	2401471	2538613	5189944	terminase,holin,protease,portal,tail,head,capsid,integrase,tRNA,lysis	Escherichia_phage(34.41%)	156	2433364:2433379	2493697:2493714
WP_001339629.1|2401471_2402746_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
WP_000789751.1|2402807_2403668_+	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_000765749.1|2403711_2404317_-	glutathione transferase GstA	NA	NA	NA	NA	NA
WP_000100951.1|2404422_2405925_-	dipeptide/tripeptide permease DtpA	NA	NA	NA	NA	NA
WP_001030339.1|2406535_2407171_-	endonuclease III	NA	NA	NA	NA	NA
WP_001289657.1|2407170_2407866_-	electron transport complex subunit RsxE	NA	NA	NA	NA	NA
WP_000920778.1|2407869_2408490_-	electron transport complex subunit RsxG	NA	NA	NA	NA	NA
WP_000231922.1|2408493_2409552_-	electron transport complex subunit RsxD	NA	NA	NA	NA	NA
WP_000915770.1|2409552_2411679_-	electron transport complex subunit RsxC	NA	NA	NA	NA	NA
WP_000991809.1|2411671_2412250_-	electron transport complex subunit RsxB	NA	NA	NA	NA	NA
WP_000133193.1|2412249_2412831_-	electron transport complex subunit RsxA	NA	NA	NA	NA	NA
WP_000214176.1|2412907_2413348_-	DUF2569 domain-containing protein	NA	NA	NA	NA	NA
WP_000217950.1|2413433_2413649_-	transcription modulator YdgT	NA	NA	NA	NA	NA
WP_001300888.1|2413921_2414047_-	division septum protein Blr	NA	NA	NA	NA	NA
WP_001282516.1|2414289_2415330_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000567490.1|2415364_2416366_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_000459416.1|2416469_2417642_-	bifunctional maltose regulon transcriptional repressor/cystathionine beta-lyase MalY	NA	NA	NA	NA	NA
WP_000125609.1|2417651_2419244_-	PTS maltose transporter subunit IICB	NA	NA	NA	NA	NA
WP_000179513.1|2419418_2420447_+	mal regulon transcriptional regulator MalI	NA	NA	NA	NA	NA
WP_000483362.1|2420558_2421326_+	7-alpha-hydroxysteroid dehydrogenase	NA	NA	NA	NA	NA
WP_000969095.1|2421554_2422145_+	DNA-binding transcriptional regulator UidR	NA	NA	NA	NA	NA
WP_000945924.1|2422533_2424345_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.7	0.0e+00
WP_001075893.1|2424341_2425715_+	glucuronide transporter	NA	NA	NA	NA	NA
WP_001227018.1|2425753_2427019_+	glucuronide uptake porin UidC	NA	NA	NA	NA	NA
WP_001043342.1|2427063_2428572_-	YdgA family protein	NA	NA	NA	NA	NA
WP_001170701.1|2428672_2429848_-	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000066636.1|2430046_2431693_+	class I fumarate hydratase	NA	NA	NA	NA	NA
WP_001099102.1|2431835_2433239_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_001387709.1|2433235_2434165_-	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
2433364:2433379	attL	CATTATCCCGATTAAT	NA	NA	NA	NA
WP_000732487.1|2434240_2435542_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	7.2e-17
2433364:2433379	attL	CATTATCCCGATTAAT	NA	NA	NA	NA
WP_001092504.1|2435545_2436265_-	two-component system response regulator RstA	NA	NA	NA	NA	NA
WP_000524868.1|2436393_2436729_+	GlpM family protein	NA	NA	NA	NA	NA
WP_000513673.1|2436725_2437448_-	dihydromonapterin reductase	NA	NA	NA	NA	NA
WP_000412392.1|2437484_2438867_-	amino acid permease	NA	NA	NA	NA	NA
WP_000769322.1|2439052_2439997_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001295398.1|2440520_2442053_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_000014036.1|2442063_2443452_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_000085276.1|2444558_2445788_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.4	1.6e-130
WP_000953272.1|2446153_2446342_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_088888692.1|2446399_2447425_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_032346737.1|2447417_2447879_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000076671.1|2447875_2448106_+	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	49.1	4.5e-07
WP_000336138.1|2448095_2448317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551751.1|2448309_2448675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204078.1|2448667_2448901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088888693.1|2448893_2449127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770179.1|2449132_2449432_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000761836.1|2449428_2451183_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.0	3.2e-92
WP_000557476.1|2451471_2451750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126693.1|2451746_2452157_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233313.1|2452169_2452442_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001137337.1|2452729_2453887_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	1.3e-137
WP_000504056.1|2453926_2454499_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.0	3.6e-61
WP_000267605.1|2454500_2455712_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.5	1.9e-189
WP_001020662.1|2455708_2456047_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	1.7e-31
WP_000134109.1|2456043_2456340_+	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	64.3	6.9e-32
WP_001145905.1|2456339_2456780_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	2.5e-62
2456582:2456597	attR	CATTATCCCGATTAAT	NA	NA	NA	NA
WP_000174068.1|2456763_2456946_+	hypothetical protein	NA	NA	NA	NA	NA
2456582:2456597	attR	CATTATCCCGATTAAT	NA	NA	NA	NA
WP_000113645.1|2457068_2457425_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_001560954.1|2457408_2459070_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.7	8.9e-278
WP_000133423.1|2459083_2459365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000276149.1|2460639_2461005_+	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_000046661.1|2460991_2461321_+	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_001260841.1|2461359_2462181_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2462280_2462364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743951.1|2462456_2462792_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091806.1|2463188_2464442_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019532.1|2464548_2465442_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2465576_2466797_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2466921_2467617_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071820512.1|2467632_2468862_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2469020_2469635_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526492.1|2469677_2470532_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000254426.1|2470533_2471088_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	57.7	1.4e-62
WP_001387389.1|2471125_2472289_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	99.7	3.8e-227
WP_126502590.1|2472144_2472591_-	helix-turn-helix domain-containing protein	NA	S5FM74	Shigella_phage	73.9	1.9e-41
WP_000497817.1|2472550_2472802_-	DUF4222 domain-containing protein	NA	G9L6F5	Escherichia_phage	91.6	3.9e-36
WP_000186783.1|2472853_2473531_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	99.1	3.0e-131
WP_000100829.1|2473527_2474313_-	phage recombination protein Bet	NA	A0A088CBI3	Shigella_phage	97.3	9.4e-145
WP_000995032.1|2474318_2474615_-	host-nuclease inhibitor protein Gam	NA	V5URU8	Shigella_phage	93.9	5.8e-47
WP_001271587.1|2474611_2476684_-	exodeoxyribonuclease VIII	NA	V5UQJ3	Shigella_phage	87.2	0.0e+00
WP_000660961.1|2476791_2477178_-	hypothetical protein	NA	V5USC5	Shigella_phage	78.9	9.5e-50
WP_000560214.1|2477261_2477483_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	94.4	1.1e-34
WP_000189938.1|2477939_2478149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001005964.1|2478117_2478477_-	hypothetical protein	NA	A0A088CBI5	Shigella_phage	73.5	2.7e-38
WP_001140061.1|2478508_2478694_-	hypothetical protein	NA	V5URU3	Shigella_phage	97.8	1.9e-16
WP_000256291.1|2478904_2479210_-	hypothetical protein	NA	C6ZCW1	Enterobacteria_phage	83.5	1.4e-35
WP_000502040.1|2479543_2479765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000846393.1|2479918_2480626_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C1P9	Escherichia_phage	99.6	7.9e-127
WP_001054988.1|2480736_2480961_+	helix-turn-helix domain-containing protein	NA	A0A0N7C1T6	Escherichia_phage	100.0	1.2e-36
WP_000084293.1|2481077_2481374_+	hypothetical protein	NA	A0A088CBI6	Shigella_phage	99.0	1.2e-47
WP_000438870.1|2481388_2481607_+	hypothetical protein	NA	A0A088CC17	Shigella_phage	100.0	1.1e-21
WP_001390692.1|2481627_2482710_+	hypothetical protein	NA	V5URT9	Shigella_phage	96.7	1.8e-199
WP_000790392.1|2482716_2483457_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	87.4	2.3e-121
WP_000450864.1|2483482_2484253_+	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	82.4	8.1e-109
WP_001118163.1|2484268_2484664_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	52.9	2.0e-31
WP_000206792.1|2484720_2485305_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	83.5	5.5e-33
WP_001278450.1|2485420_2485525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887482.1|2485713_2485926_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	62.9	8.4e-16
WP_000119356.1|2486135_2486315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000818160.1|2486333_2486819_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_000042397.1|2486869_2487187_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000290554.1|2487892_2488558_+	hypothetical protein	NA	A0A088CD42	Shigella_phage	79.2	1.9e-90
WP_001076834.1|2488612_2489023_+	recombination protein NinB	NA	A0A088CBP6	Shigella_phage	98.5	3.9e-70
WP_001254267.1|2489019_2489202_+	NinE family protein	NA	A0A0P0ZDL7	Stx2-converting_phage	91.7	2.4e-27
WP_000211434.1|2489476_2490160_+	phage antirepressor Ant	NA	Q8HA19	Enterobacteria_phage	85.7	2.3e-107
WP_001004035.1|2490234_2490957_+	DNA-binding protein	NA	A0A0N7KZI6	Stx2-converting_phage	97.5	1.7e-124
WP_000002252.1|2490956_2491247_+	DUF1364 domain-containing protein	NA	A0A088CE53	Shigella_phage	96.9	9.3e-50
WP_001008115.1|2491243_2491606_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A088CBJ1	Shigella_phage	98.3	9.2e-63
WP_000992060.1|2491605_2491800_+	protein ninH	NA	A0A088CC23	Shigella_phage	100.0	1.4e-30
WP_001204886.1|2491792_2492227_+	antitermination protein	NA	G9L695	Escherichia_phage	98.6	2.4e-81
WP_000874467.1|2492992_2494903_+	SASA family carbohydrate esterase	NA	A0A0N7CGH9	Escherichia_phage	74.8	4.9e-280
WP_000142783.1|2495042_2495225_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	91.7	1.6e-23
WP_001290235.1|2495250_2495496_+	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	86.4	9.1e-14
WP_000284506.1|2495572_2495788_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087450.1|2495792_2496326_+	lysozyme	NA	A0A088CC28	Shigella_phage	91.5	5.6e-93
WP_000675931.1|2496546_2496660_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_077627825.1|2496881_2497067_+|lysis	lysis protein	lysis	A0A0P0ZDR7	Stx2-converting_phage	96.7	2.8e-23
WP_000934362.1|2497200_2497782_-	lipopolysaccharide core heptose(II)-phosphate phosphatase	NA	A0A2L1IV13	Escherichia_phage	100.0	6.7e-47
WP_001086085.1|2498384_2499200_+|terminase	terminase	terminase	A0A2L1IV66	Escherichia_phage	99.6	6.6e-125
WP_001387707.1|2499180_2500887_+|terminase	terminase	terminase	A0A2L1IV76	Escherichia_phage	99.1	0.0e+00
WP_032188285.1|2500886_2503031_+	hypothetical protein	NA	A0A088CE71	Shigella_phage	100.0	0.0e+00
WP_000345000.1|2503188_2504196_+	hypothetical protein	NA	A0A2L1IV47	Escherichia_phage	92.8	1.3e-167
WP_000214481.1|2504218_2505433_+|capsid	N4-gp56 family major capsid protein	capsid	A0A088CC32	Shigella_phage	97.0	4.7e-228
WP_001140435.1|2505487_2505877_+	hypothetical protein	NA	V5UT93	Shigella_phage	97.7	1.9e-61
WP_001290746.1|2505927_2506389_+	hypothetical protein	NA	A0A2L1IV43	Escherichia_phage	96.7	1.1e-68
WP_000829400.1|2506372_2506936_+	hypothetical protein	NA	A0A2L1IV64	Escherichia_phage	99.5	8.3e-103
WP_000207928.1|2506935_2507586_+	hypothetical protein	NA	A0A0P0ZG46	Escherichia_phage	98.6	1.2e-118
WP_000117972.1|2507582_2509598_+|tail	tail fiber protein	tail	V5USF3	Shigella_phage	63.8	1.3e-78
WP_000537686.1|2509680_2510226_+	hypothetical protein	NA	A0A088CD67	Shigella_phage	99.4	2.0e-93
WP_000276176.1|2510238_2510466_+	hypothetical protein	NA	A0A088CBQ7	Shigella_phage	98.7	2.6e-39
WP_001146334.1|2510806_2512432_+	hypothetical protein	NA	A0A1I9LJT3	Stx_converting_phage	97.0	0.0e+00
WP_000038923.1|2512428_2513703_+	host specificity protein J	NA	A0A0N7C124	Escherichia_phage	92.2	5.3e-206
WP_000455632.1|2513717_2513996_+	hypothetical protein	NA	A0A2L1IV69	Escherichia_phage	98.9	9.9e-49
WP_000274301.1|2514001_2514619_+	hypothetical protein	NA	A0A2L1IV83	Escherichia_phage	99.5	5.7e-121
WP_032179509.1|2514745_2515483_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2L1IV31	Escherichia_phage	100.0	1.2e-136
WP_000078907.1|2515715_2515856_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_050487963.1|2515912_2516314_+	hypothetical protein	NA	A0A088CC37	Shigella_phage	99.2	3.5e-71
WP_088888694.1|2516405_2517062_+	hypothetical protein	NA	A0A0H4IPM7	Shigella_phage	99.1	9.7e-103
WP_000455654.1|2517064_2517511_+	hypothetical protein	NA	V5UT82	Shigella_phage	97.3	9.9e-75
WP_000540392.1|2517520_2517772_+	hypothetical protein	NA	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000012440.1|2517782_2519048_+	hypothetical protein	NA	A0A2L1IV65	Escherichia_phage	94.5	8.2e-191
WP_000331665.1|2519116_2527471_+	hypothetical protein	NA	Q08J70	Stx2-converting_phage	95.6	0.0e+00
WP_000481379.1|2527594_2527786_+	hypothetical protein	NA	A0A088CD78	Shigella_phage	95.2	8.0e-26
WP_000628749.1|2527872_2528601_-	DUF551 domain-containing protein	NA	A0A088CE95	Shigella_phage	55.1	6.1e-82
WP_001289973.1|2529114_2529600_-	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	86.1	1.1e-42
WP_088888695.1|2529596_2530283_-	ead/Ea22-like family protein	NA	A5VWB1	Enterobacteria_phage	68.2	1.8e-38
WP_001390689.1|2530269_2530584_-	hypothetical protein	NA	B1GS43	Salmonella_phage	84.9	4.0e-38
WP_001024845.1|2530537_2530855_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	96.7	2.2e-44
WP_000763353.1|2530851_2531073_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C094	Escherichia_phage	100.0	1.3e-35
WP_000107181.1|2531120_2531753_-	hypothetical protein	NA	A0A088CBR4	Shigella_phage	68.2	7.3e-47
WP_000211519.1|2532007_2532637_-	phage antirepressor Ant	NA	A0A0P0ZCA2	Stx2-converting_phage	86.6	4.5e-97
WP_000184487.1|2532886_2533171_-	phage antirepressor Ant	NA	G9L6G2	Escherichia_phage	85.1	4.0e-45
WP_000213043.1|2533578_2533692_-	4Fe-4S binding protein	NA	A0A077SL61	Escherichia_phage	72.0	2.1e-05
WP_001342404.1|2533702_2536126_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	9.8e-209
WP_000041536.1|2536186_2538613_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	2.3e-213
>prophage 7
NZ_CP013185	Escherichia coli strain FORC_029 chromosome, complete genome	5189944	2826489	2887959	5189944	terminase,holin,protease,portal,tail,head,capsid,integrase	Enterobacteria_phage(41.18%)	73	2876803:2876817	2895558:2895572
WP_000422045.1|2826489_2827539_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559283.1|2827758_2828517_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	8.8e-07
WP_001278904.1|2828513_2829104_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|2829143_2830016_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001295575.1|2830116_2830737_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285661.1|2830733_2831615_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001386774.1|2831752_2831797_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194599.1|2831888_2833451_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763511.1|2833450_2835046_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001344826.1|2835049_2836408_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
WP_000209520.1|2836419_2837613_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443069.1|2837612_2838419_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2838799_2838979_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|2839064_2839565_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079509.1|2839610_2840117_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000926528.1|2840890_2841160_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	77.8	2.7e-19
WP_000240999.1|2841216_2841885_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000885576.1|2841939_2842524_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.4	1.7e-103
WP_000216502.1|2842523_2845358_-|tail	tail fiber protein	tail	X2KTY7	Enterobacteria_phage	59.1	5.7e-83
WP_001228314.1|2845509_2846109_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	97.0	9.1e-108
WP_000515776.1|2846176_2849656_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
WP_001332187.1|2849722_2850061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000090879.1|2850134_2850737_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	6.2e-88
WP_000140761.1|2850673_2851417_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	1.8e-145
WP_001152522.1|2851421_2852120_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	3.4e-130
WP_000847402.1|2852119_2852449_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	91.7	2.3e-52
WP_000082358.1|2852445_2855019_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.9	0.0e+00
WP_000533402.1|2854999_2855413_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479095.1|2855439_2855871_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	6.2e-42
WP_000235040.1|2855884_2856637_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	97.6	6.7e-132
WP_000683079.1|2856644_2857040_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000974999.1|2857036_2857612_-|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.3	9.2e-49
WP_001204198.1|2857626_2857980_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	3.0e-42
WP_000201506.1|2857972_2858341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522596.1|2858392_2859421_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	60.4	2.8e-112
WP_000256823.1|2859478_2859826_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_001253926.1|2859862_2861368_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	52.8	3.0e-99
WP_001387697.1|2861357_2862950_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	3.8e-185
WP_000259002.1|2862946_2863153_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_088888698.1|2863136_2865107_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	67.5	1.6e-262
WP_000867569.1|2865036_2865585_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_000240372.1|2865985_2866390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000343118.1|2866843_2867131_-	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	58.9	4.0e-29
WP_001390467.1|2867209_2867362_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	98.0	2.8e-21
WP_001228710.1|2867390_2867597_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	95.6	2.9e-29
WP_032159578.1|2867818_2867905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001092853.1|2868459_2868993_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.2	8.7e-102
WP_000731197.1|2869035_2869842_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	94.8	3.3e-145
WP_000284510.1|2869846_2870062_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000874307.1|2870212_2872066_-	SASA family carbohydrate esterase	NA	Q08JA2	Stx2-converting_phage	90.5	0.0e+00
WP_000871291.1|2872326_2872662_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_001438304.1|2872942_2873074_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	96.4	1.1e-05
WP_000935536.1|2873872_2874922_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.7	8.8e-199
WP_000917746.1|2875072_2875270_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	96.9	1.4e-28
WP_000762880.1|2875496_2876318_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	8.5e-80
WP_000904106.1|2876314_2876689_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	5.8e-36
WP_001265083.1|2876701_2877748_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.0	5.9e-110
2876803:2876817	attL	GCTCGTTGTGATGCT	NA	NA	NA	NA
WP_001329966.1|2877749_2878022_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	5.5e-12
WP_000018429.1|2878189_2878402_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	5.2e-26
WP_000150294.1|2878582_2879248_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_001151211.1|2879422_2879848_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	1.3e-63
WP_000095671.1|2879888_2880851_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
WP_000693888.1|2880873_2881299_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001072337.1|2881295_2881550_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
WP_000233320.1|2881629_2882049_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_000379548.1|2882345_2882498_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	6.0e-08
WP_000394541.1|2882509_2882848_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	51.0	2.5e-06
WP_012601410.1|2882836_2883103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2883597_2883786_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|2883782_2883974_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048530.1|2884066_2886538_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	59.2	1.8e-56
WP_000113189.1|2886602_2886851_+	excisionase	NA	NA	NA	NA	NA
WP_000113684.1|2886828_2887959_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	4.4e-103
2895558:2895572	attR	GCTCGTTGTGATGCT	NA	NA	NA	NA
>prophage 8
NZ_CP013185	Escherichia coli strain FORC_029 chromosome, complete genome	5189944	3123762	3190100	5189944	transposase,protease,integrase	Acinetobacter_phage(33.33%)	56	3172756:3172770	3190465:3190479
WP_001182418.1|3123762_3124842_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	6.2e-38
WP_000797370.1|3124841_3125798_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_000506892.1|3125808_3127017_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_001176769.1|3127034_3127502_+	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_001388628.1|3127965_3128604_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000116682.1|3128626_3129265_+	TerD family protein	NA	NA	NA	NA	NA
WP_001253658.1|3129264_3129903_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000081058.1|3131027_3132665_+	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_001284316.1|3132690_3134190_+	protein kinase	NA	NA	NA	NA	NA
WP_000624688.1|3136805_3137156_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	6.2e-40
WP_001309734.1|3137152_3137587_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	1.5e-19
WP_000179883.1|3138325_3138502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001333359.1|3139484_3140429_-	hypochlorite stress DNA-binding transcriptional regulator HypT	NA	NA	NA	NA	NA
WP_000677243.1|3140773_3141493_+	amino acid racemase	NA	NA	NA	NA	NA
WP_000262203.1|3141558_3142857_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_032159458.1|3143100_3143889_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.6	4.5e-62
WP_000502839.1|3144624_3144744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285498.1|3144728_3145961_-	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	33.1	1.7e-60
WP_024199857.1|3146469_3148638_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_001229396.1|3149392_3149968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032150361.1|3150680_3150890_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000124173.1|3150942_3151176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001260392.1|3151271_3151895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001167434.1|3151983_3152493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001387494.1|3152950_3153409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000406624.1|3153508_3154195_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001390454.1|3154806_3155130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001183600.1|3155190_3157311_-	microcin export transporter peptidase/ATP-binding subunit MchF	NA	F2Y165	Organic_Lake_phycodnavirus	24.2	9.4e-14
WP_001391574.1|3157285_3158527_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_000291472.1|3158712_3159165_-	toxin-activating lysine-acyltransferase	NA	NA	NA	NA	NA
WP_000019320.1|3159190_3160741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001375214.1|3161012_3161240_-	microcin H47	NA	NA	NA	NA	NA
WP_000120662.1|3161267_3161477_-	microcin H47 immunity protein MchI	NA	NA	NA	NA	NA
WP_001383561.1|3162409_3162724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001390635.1|3164039_3165314_+	esterase family protein	NA	NA	NA	NA	NA
WP_001231529.1|3165455_3166580_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_000958487.1|3167309_3167507_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_157787301.1|3167572_3167788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001390447.1|3168076_3168349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001299815.1|3168437_3168617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001004881.1|3168668_3168863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000477617.1|3170631_3170850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001223341.1|3172302_3174393_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	3.4e-08
3172756:3172770	attL	GTGGTGAATATCATT	NA	NA	NA	NA
WP_000839179.1|3175088_3175493_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612617.1|3175489_3175837_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	7.5e-62
WP_000035067.1|3177080_3177269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000233439.1|3177286_3179647_-	DEAD/DEAH box helicase family protein	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.0	1.5e-33
WP_000282072.1|3179801_3180365_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_001258866.1|3181701_3183537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000070932.1|3183637_3183925_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001390445.1|3183896_3185426_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000279857.1|3185595_3186813_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.7	6.5e-44
WP_000611858.1|3187360_3188347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000627404.1|3188343_3188835_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_000169541.1|3188937_3189237_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_000878218.1|3189233_3190100_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
3190465:3190479	attR	AATGATATTCACCAC	NA	NA	NA	NA
>prophage 9
NZ_CP013185	Escherichia coli strain FORC_029 chromosome, complete genome	5189944	3247004	3299034	5189944	terminase,holin,protease,portal,tail,integrase,lysis	Escherichia_phage(58.49%)	66	3251678:3251737	3298109:3298170
WP_000003662.1|3247004_3247592_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3247588_3248296_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107384.1|3248314_3250108_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001058323.1|3250104_3251223_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
3251678:3251737	attL	CGGTCTTGAAAACCGGCGACCCGAAAGGGTTCCAGAGTTCGAATCTCTGCGCTTCCGCCA	NA	NA	NA	NA
WP_022581964.1|3251877_3252207_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_088888702.1|3252474_3254388_-|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	97.6	6.8e-173
WP_088888703.1|3254538_3255162_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	59.9	1.8e-66
WP_088888704.1|3255230_3258926_-	DUF1983 domain-containing protein	NA	S5MW25	Escherichia_phage	80.8	0.0e+00
WP_131199704.1|3259172_3259805_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	89.5	2.1e-99
WP_088888705.1|3259750_3260494_-|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	96.8	4.3e-147
WP_001484085.1|3260504_3261203_-|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	97.4	6.8e-131
WP_000847280.1|3261202_3261532_-|tail	phage tail protein	tail	S5MW28	Escherichia_phage	99.1	1.2e-58
WP_088888706.1|3261528_3264177_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	92.9	0.0e+00
WP_000532075.1|3264220_3264529_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	99.0	3.0e-54
WP_000479054.1|3264555_3264978_-|tail	phage minor tail protein G	tail	S5MQJ3	Escherichia_phage	100.0	5.1e-73
WP_088888707.1|3264993_3265743_-|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	98.4	9.9e-136
WP_000682704.1|3265750_3266149_-	hypothetical protein	NA	S5MW30	Escherichia_phage	100.0	2.7e-71
WP_000974964.1|3266158_3266785_-	hypothetical protein	NA	S5MBY4	Escherichia_phage	100.0	7.8e-102
WP_001281347.1|3266787_3267069_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	98.9	1.3e-45
WP_088888708.1|3267061_3267388_-	DUF2190 family protein	NA	S5MQJ5	Escherichia_phage	99.1	1.8e-49
WP_157787306.1|3267475_3269455_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.7	0.0e+00
WP_000974564.1|3269444_3270947_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_000102415.1|3270946_3271159_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_088888709.1|3271155_3273279_-|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	99.9	0.0e+00
WP_016236020.1|3273275_3273752_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	96.8	1.3e-80
WP_000735655.1|3274209_3274434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088888710.1|3274457_3274925_-|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	85.8	3.3e-65
WP_088888711.1|3274921_3275455_-	lysozyme	NA	S5MQK2	Escherichia_phage	96.6	1.1e-99
WP_088888739.1|3275491_3276049_-	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	82.6	3.1e-49
WP_000284510.1|3276052_3276268_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_088888712.1|3276345_3276591_-	DUF826 domain-containing protein	NA	A0A088CE63	Shigella_phage	93.8	2.5e-19
WP_000143458.1|3276631_3276811_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_088888713.1|3276946_3278893_-	DUF1737 domain-containing protein	NA	S5MDQ7	Escherichia_phage	98.8	0.0e+00
WP_000738072.1|3279398_3279668_-	Shiga toxin Stx2a subunit B	NA	Q6DWN4	Enterobacteria_phage	100.0	1.2e-43
WP_001365678.1|3279679_3280639_-	Shiga toxin Stx2a subunit A	NA	A0A0P0ZDQ7	Stx2-converting_phage	99.7	3.6e-175
WP_088888714.1|3281021_3282080_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	92.6	4.3e-193
WP_000917768.1|3282230_3282428_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	100.0	6.1e-29
WP_000640044.1|3282644_3283205_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.1	5.6e-67
WP_021577231.1|3283213_3283573_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	8.0e-35
WP_062881283.1|3283585_3284635_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.5e-110
WP_088888715.1|3284636_3284909_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	1.0e-10
WP_001398985.1|3285075_3285288_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	67.1	6.4e-16
WP_028985605.1|3285521_3286037_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	77.6	1.2e-36
WP_001224672.1|3286202_3286385_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	96.7	2.0e-26
WP_157787302.1|3286477_3286876_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	95.8	1.4e-56
WP_001369935.1|3286811_3287138_-	hypothetical protein	NA	Q8VNQ2	Enterobacteria_phage	88.5	2.0e-24
WP_001289674.1|3287138_3287450_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	1.1e-48
WP_001376361.1|3287436_3287742_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	93.1	2.9e-49
WP_087614068.1|3287738_3288020_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	7.9e-30
WP_088888717.1|3288052_3288769_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.0	5.7e-72
WP_072130322.1|3288802_3289345_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	3.6e-79
WP_157787303.1|3289256_3290288_-	phage replisome organizer	NA	A0A0U2RT81	Escherichia_phage	70.4	8.1e-88
WP_000693925.1|3290356_3290782_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_047083516.1|3290765_3291041_-	helix-turn-helix transcriptional regulator	NA	A0A0U2S629	Escherichia_phage	51.2	2.4e-15
WP_033812093.1|3291148_3291649_+	helix-turn-helix transcriptional regulator	NA	A0A0U2QW76	Escherichia_phage	54.5	1.4e-16
WP_033812094.1|3291666_3291858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033812095.1|3291857_3292148_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000380319.1|3292416_3292569_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_077637644.1|3292724_3292982_+	hypothetical protein	NA	I6PDF6	Cronobacter_phage	84.2	1.4e-09
WP_024213805.1|3293062_3293248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450222.1|3293792_3293981_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_086163675.1|3293977_3294166_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_088888718.1|3294258_3296661_+	exonuclease	NA	V5UQJ3	Shigella_phage	58.6	3.7e-176
WP_000273163.1|3296727_3296979_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001367167.1|3296947_3297967_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	50.3	2.6e-86
WP_000375136.1|3298374_3299034_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
3298109:3298170	attR	CGGTCTTGAAAACCGGCGACCCGAAAGGGTTCCAGAGTTCGAATCTCTGCGCTTCCGCCAAA	NA	NA	NA	NA
>prophage 10
NZ_CP013185	Escherichia coli strain FORC_029 chromosome, complete genome	5189944	3311493	3396948	5189944	protease,tail,head,plate,integrase,tRNA,transposase	Shigella_phage(51.16%)	94	3309543:3309559	3363225:3363241
3309543:3309559	attL	TTTTTTCATATGCCTGA	NA	NA	NA	NA
WP_000156526.1|3311493_3313254_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_001386684.1|3313322_3313841_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000828648.1|3313910_3314078_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759123.1|3314333_3314897_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000445533.1|3314893_3316534_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333176.1|3316538_3317792_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053089.1|3317921_3319829_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.4e-53
WP_001086517.1|3319839_3321948_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000258204.1|3322191_3323301_+	6-N-hydroxylaminopurine resistance protein YcbX	NA	NA	NA	NA	NA
WP_001295353.1|3323297_3323840_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_001295352.1|3324013_3325024_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001111470.1|3325134_3325872_-	fimbrial chaperone	NA	NA	NA	NA	NA
WP_000919489.1|3325837_3326353_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000730614.1|3326360_3326903_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001165657.1|3326914_3327985_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000077538.1|3330276_3330807_-	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	61.7	1.1e-35
WP_001310454.1|3330996_3331245_+	transcriptional regulator	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
WP_000289277.1|3331246_3333337_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	47.4	3.0e-166
WP_000129797.1|3333408_3334341_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	49.0	4.8e-71
WP_000560046.1|3334343_3334565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001057199.1|3334577_3334832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000827936.1|3334833_3335115_+	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
WP_000049398.1|3335111_3335414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000049308.1|3335388_3335682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001129560.1|3335693_3336224_+	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	56.6	4.2e-48
WP_000323221.1|3336321_3336864_+	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.0	2.9e-28
WP_000564282.1|3336867_3337401_+	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	67.8	1.8e-67
WP_000465557.1|3337400_3337916_+	hypothetical protein	NA	C9DGM0	Escherichia_phage	54.2	1.3e-46
WP_000977064.1|3337919_3338471_+	SANT/Myb domain-containing protein	NA	NA	NA	NA	NA
WP_000595949.1|3338467_3338653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000021236.1|3338691_3339024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086885.1|3339016_3339214_+	hypothetical protein	NA	A0A291AXE7	Shigella_phage	36.2	5.6e-06
WP_000378478.1|3339203_3339500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001214355.1|3339496_3340006_+	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	46.8	2.8e-25
WP_000852373.1|3340076_3340499_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001125312.1|3340570_3341071_+	lysozyme	NA	A0A2H4J3P8	uncultured_Caudovirales_phage	42.0	6.6e-27
WP_001388992.1|3341105_3341534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048657292.1|3341463_3341736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342741.1|3341746_3341974_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000270160.1|3341954_3342266_+	DUF2730 family protein	NA	NA	NA	NA	NA
WP_001279080.1|3342258_3342549_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	63.2	2.1e-25
WP_088888728.1|3342551_3343133_+	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	3.2e-49
WP_000255659.1|3343143_3343392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001030238.1|3343391_3345056_+	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	2.4e-230
WP_000532599.1|3345055_3346645_+	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	58.1	8.5e-169
WP_000046202.1|3346628_3347960_+|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	58.5	6.4e-154
WP_000094810.1|3348081_3348555_+	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	53.9	1.7e-37
WP_000850814.1|3348732_3349857_+|protease	protease	protease	A0A0C4UQU6	Shigella_phage	46.5	5.0e-75
WP_001142988.1|3349856_3350804_+|head	head protein	head	A0A0C4UQR9	Shigella_phage	66.9	2.7e-122
WP_001002063.1|3350847_3351207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001104960.1|3351203_3351623_+	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	54.3	6.1e-34
WP_000627436.1|3351619_3352183_+	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.1	4.8e-42
WP_000207437.1|3352186_3352465_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_000606778.1|3352464_3353967_+|tail	tail protein	tail	A0A0C4UQS0	Shigella_phage	51.1	2.7e-132
WP_000015469.1|3353975_3354341_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_000213225.1|3354355_3354832_+	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
WP_000113523.1|3354958_3357034_+	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.7	3.7e-71
WP_000146118.1|3357020_3358370_+	DMT family permease	NA	C9DGQ2	Escherichia_phage	33.1	5.9e-54
WP_000098806.1|3358353_3359478_+|tail	tail protein	tail	C9DGQ3	Escherichia_phage	47.7	1.7e-94
WP_072105406.1|3359467_3360082_+|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.3	2.5e-52
WP_000763299.1|3360074_3360512_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	56.9	7.7e-40
WP_001146839.1|3360511_3361594_+|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	8.2e-99
WP_000301578.1|3361584_3362145_+	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	49.1	3.9e-44
WP_000469169.1|3362144_3363026_+	hypothetical protein	NA	C9DGQ8	Escherichia_phage	39.5	3.6e-28
WP_000421093.1|3363057_3363579_-|tail	tail protein	tail	A0A0U2QV64	Escherichia_phage	49.1	8.6e-46
3363225:3363241	attR	TTTTTTCATATGCCTGA	NA	NA	NA	NA
WP_001029053.1|3363630_3363975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000904914.1|3364069_3364642_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	76.9	1.3e-74
WP_001284084.1|3364727_3366782_+	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	64.9	1.3e-233
WP_000143467.1|3366926_3367109_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	54.4	2.2e-09
WP_001114101.1|3367144_3367399_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_001388991.1|3367474_3367675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001388990.1|3368250_3368451_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000528247.1|3368404_3369142_+	hypothetical protein	NA	A0A0C4UQZ7	Shigella_phage	79.0	3.7e-103
WP_001390666.1|3369248_3369824_-	usher protein FimD	NA	NA	NA	NA	NA
WP_000845152.1|3369848_3370550_-	molecular chaperone	NA	NA	NA	NA	NA
WP_000750284.1|3370632_3371175_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001263934.1|3371530_3372106_+	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
WP_001244318.1|3372098_3373058_+	aliphatic sulfonate ABC transporter substrate-binding protein SsuA	NA	NA	NA	NA	NA
WP_000055996.1|3373054_3374200_+	FMNH2-dependent alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
WP_000235203.1|3374210_3375002_+	aliphatic sulfonate ABC transporter permease SsuC	NA	NA	NA	NA	NA
WP_001090514.1|3374998_3375766_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.6	1.7e-29
WP_000193859.1|3375972_3378585_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	4.1e-19
WP_001297200.1|3378850_3380053_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000117881.1|3380221_3381622_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_000977920.1|3382223_3383312_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000462687.1|3383496_3384687_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_000399648.1|3384965_3385946_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001109487.1|3386187_3386835_-	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_001295932.1|3386861_3387410_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_000925997.1|3387590_3389438_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000572634.1|3389698_3394159_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_001295347.1|3394158_3394863_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_001288850.1|3394843_3396166_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001298300.1|3396162_3396948_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
>prophage 11
NZ_CP013185	Escherichia coli strain FORC_029 chromosome, complete genome	5189944	4119646	4181972	5189944	transposase,tRNA,plate,protease	Cronobacter_phage(12.5%)	51	NA	NA
WP_000611748.1|4119646_4120060_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393853.1|4120063_4121914_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348793.1|4121877_4122960_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113725.1|4122984_4124265_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|4124261_4124786_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246421.1|4124788_4126120_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000343303.1|4126124_4126886_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000614396.1|4126894_4129654_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.6	9.4e-83
WP_000088873.1|4129650_4130394_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240544.1|4130398_4131814_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_122987046.1|4131922_4135357_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001087741.1|4135367_4136720_+	membrane protein	NA	NA	NA	NA	NA
WP_001284200.1|4136743_4137226_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000908057.1|4137269_4138184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236649.1|4138193_4138673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086142.1|4138809_4139595_-	aminopeptidase	NA	NA	NA	NA	NA
WP_001297205.1|4140130_4140862_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_000917888.1|4140926_4141394_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001298887.1|4141390_4142113_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052751.1|4142146_4142902_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|4142973_4144332_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211710.1|4144379_4145150_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|4145227_4146028_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648601.1|4146268_4147183_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997043.1|4147179_4147983_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	3.2e-39
WP_001140174.1|4153880_4154453_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593994.1|4154640_4155672_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001294600.1|4155664_4156318_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874224.1|4156357_4157173_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202329.1|4157290_4157695_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094011.1|4157691_4158399_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260716.1|4158510_4160229_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000399648.1|4161308_4162289_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000239154.1|4162538_4163249_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635545.1|4163262_4163685_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185290.1|4163681_4164227_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|4164392_4164593_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062312.1|4164579_4164840_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000176578.1|4164888_4166187_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901098.1|4166251_4166641_-	VOC family protein	NA	NA	NA	NA	NA
WP_001020973.1|4166697_4168839_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000055741.1|4168937_4169897_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001294757.1|4169909_4173392_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000569430.1|4173428_4174025_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_000139667.1|4174021_4175170_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000565966.1|4175169_4175958_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|4175961_4176417_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_001139279.1|4176521_4177547_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000758956.1|4177550_4178036_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001240896.1|4178157_4180590_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_001346129.1|4180619_4181972_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
>prophage 12
NZ_CP013185	Escherichia coli strain FORC_029 chromosome, complete genome	5189944	4609992	4688582	5189944	tRNA,transposase,protease,integrase	Vibrio_phage(14.29%)	57	4638787:4638802	4678229:4678244
WP_001232412.1|4609992_4610997_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312490.1|4610999_4612259_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460360.1|4612344_4613625_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|4613701_4614010_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280345.1|4614095_4615046_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001122523.1|4615038_4616886_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.6	2.6e-60
WP_000990321.1|4616895_4618233_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_000981977.1|4618251_4618713_-|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_001307537.1|4618684_4620232_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_001294219.1|4620230_4621370_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_010723271.1|4621352_4621406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295188.1|4622148_4622694_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_000041970.1|4622788_4623841_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_000934933.1|4623937_4624906_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_001236813.1|4624927_4628251_+	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_001276180.1|4628279_4628594_-	YjeO family protein	NA	NA	NA	NA	NA
WP_000342867.1|4628590_4628905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001346081.1|4628956_4630459_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_000004771.1|4630677_4631655_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
WP_001192973.1|4631979_4633788_+	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000829498.1|4633780_4634515_+	fumarate reductase iron-sulfur protein	NA	NA	NA	NA	NA
WP_000208757.1|4634525_4634921_+	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_001299198.1|4634931_4635291_+	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_001367937.1|4635353_4636487_+	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_001238378.1|4636575_4637109_+	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
WP_000118482.1|4637105_4637423_-	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_000239596.1|4637597_4637744_-	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000977757.1|4637854_4637980_-	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000257278.1|4638031_4638598_-	elongation factor P	NA	NA	NA	NA	NA
WP_000940530.1|4638639_4639668_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
4638787:4638802	attL	CTGTTTGCCCTGCGTG	NA	NA	NA	NA
WP_001008073.1|4640057_4640927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000558209.1|4641129_4641483_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_000729117.1|4641620_4643267_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|4643310_4643604_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000015837.1|4643879_4645136_+	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001267448.1|4645151_4645628_-	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000069437.1|4645964_4647401_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_000961957.1|4647518_4648820_+	anaerobic C4-dicarboxylate transporter DcuA	NA	NA	NA	NA	NA
WP_000883400.1|4648935_4649274_+	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000068978.1|4649249_4650947_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_001387262.1|4650983_4651559_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001218804.1|4651938_4653201_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	9.3e-78
WP_071588995.1|4658242_4659280_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_001034110.1|4659640_4663498_+|protease	serine protease autotransporter toxin SigA	protease	Q9LA58	Enterobacterial_phage	38.3	2.4e-225
WP_000291751.1|4663544_4664126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000422750.1|4666736_4667162_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	97.9	4.4e-48
WP_001189118.1|4668847_4670356_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	6.2e-44
WP_001387241.1|4671320_4673516_-	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_000750143.1|4673521_4674859_-	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_001015710.1|4674855_4676598_-	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_001287497.1|4676597_4677545_-	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001387605.1|4677545_4679270_-	aerobactin synthase IucA	NA	NA	NA	NA	NA
4678229:4678244	attR	CACGCAGGGCAAACAG	NA	NA	NA	NA
WP_000074478.1|4679405_4680599_+	MFS transporter	NA	NA	NA	NA	NA
WP_001387604.1|4680548_4681475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000555384.1|4682214_4683348_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001189118.1|4683959_4685468_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	6.2e-44
WP_001390760.1|4687457_4688582_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	3.3e-199
>prophage 1
NZ_CP013186	Escherichia coli strain FORC_029 plasmid FORC_029p, complete sequence	77339	12075	64575	77339	integrase,transposase,protease	Enterobacteria_phage(26.32%)	43	28350:28364	71476:71490
WP_000878026.1|12075_13095_-|transposase	IS110-like element ISEc11 family transposase	transposase	NA	NA	NA	NA
WP_001088305.1|13404_14082_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	33.1	1.5e-10
WP_001145107.1|14298_15291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235713.1|16072_16630_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|16812_17673_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067858.1|20433_21138_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000085189.1|21277_21679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100138627.1|21887_22979_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.4	2.6e-28
WP_000624688.1|23974_24325_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	6.2e-40
WP_001309734.1|24321_24756_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	1.5e-19
WP_001390768.1|25970_27182_-	dispersin export-associated protein AatD	NA	NA	NA	NA	NA
WP_000621743.1|27193_27823_-	dispersin export ABC transporter ATP-binding protein AatC	NA	G9BWD6	Planktothrix_phage	35.4	1.2e-20
WP_002431107.1|27815_28637_-	dispersin export-associated protein AatB	NA	NA	NA	NA	NA
28350:28364	attL	TTCCATATCTCTTTT	NA	NA	NA	NA
WP_001216022.1|28533_29772_-	dispersin export ABC transporter outer membrane protein AatA	NA	NA	NA	NA	NA
WP_000209218.1|29768_30899_-	dispersin export ABC transporter permease subunit AatP	NA	NA	NA	NA	NA
WP_001388597.1|31278_31527_+|transposase	IS3 family transposase	transposase	A0A0N7BVE9	Escherichia_phage	83.8	4.0e-25
WP_000239755.1|31669_31906_+|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	63.8	2.0e-18
WP_000546071.1|31877_32627_-|protease	serine protease	protease	Q9LA58	Enterobacterial_phage	58.2	5.8e-51
WP_001441124.1|33511_33667_-|protease	serine protease SepA autotransporter	protease	NA	NA	NA	NA
WP_000643555.1|35193_35394_-	AggR-activated transcriptional regulator Aar	NA	NA	NA	NA	NA
WP_000721276.1|36124_36475_+	dispersin Aap	NA	NA	NA	NA	NA
WP_077628273.1|36836_36980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000769457.1|37314_38112_+	aggregative adherence transcriptional regulator AggR	NA	NA	NA	NA	NA
WP_001387337.1|40543_41083_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_000869859.1|41086_42115_-	class 1 isoprenoid biosynthesis enzyme	NA	NA	NA	NA	NA
WP_012602932.1|43490_43718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100138626.1|43766_44267_-	aggregative adherence fimbria 3 major subunit Agg3A	NA	NA	NA	NA	NA
WP_001390764.1|44441_44882_-	aggregative adherence fimbria 3 minor subunit Agg3B	NA	NA	NA	NA	NA
WP_000902426.1|44895_47445_-	aggregative adherence fimbria 3 usher protein Agg3C	NA	NA	NA	NA	NA
WP_000702698.1|47498_48251_-	aggregative adherence fimbria 3 chaperone Agg3D	NA	NA	NA	NA	NA
WP_001189111.1|50410_51919_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_000340832.1|53351_53744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001103689.1|53748_54720_-	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	43.3	3.3e-67
WP_000633911.1|54948_55593_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.5	8.8e-40
WP_000239529.1|55586_55862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016979.1|55999_56809_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	95.5	7.8e-54
WP_001159871.1|56809_57115_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000813634.1|57116_57335_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_000555401.1|57945_59079_+|transposase	IS110-like element ISEc45 family transposase	transposase	NA	NA	NA	NA
WP_000624722.1|60787_61138_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|61134_61560_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_001388581.1|62572_63550_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	58.9	5.1e-100
WP_001388582.1|63834_64575_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.7	3.5e-24
71476:71490	attR	TTCCATATCTCTTTT	NA	NA	NA	NA
