The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017073	Pseudomonas putida strain PP112420, complete genome	6031212	1106622	1114401	6031212		Thermobifida_phage(16.67%)	10	NA	NA
WP_012270654.1|1106622_1107477_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	31.9	1.8e-08
WP_012270655.1|1107479_1107944_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_003255135.1|1107956_1108265_-	ribosome hibernation promoting factor	NA	A0A0K1LP60	Escherichia_phage	34.1	4.4e-05
WP_041166385.1|1108344_1109838_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_012270657.1|1110013_1110739_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.5	8.4e-23
WP_012270658.1|1110739_1111264_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_012270659.1|1111250_1111823_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_012270660.1|1111831_1112356_-	HAD family hydrolase	NA	A0A140XBD6	Dickeya_phage	48.1	5.3e-27
WP_012270661.1|1112368_1113343_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	33.1	2.1e-37
WP_012270662.1|1113591_1114401_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.5	4.5e-25
>prophage 2
NZ_CP017073	Pseudomonas putida strain PP112420, complete genome	6031212	2064864	2113271	6031212	protease,integrase,transposase,coat	Escherichia_phage(50.0%)	41	2072119:2072136	2109611:2109628
WP_012271589.1|2064864_2065401_-|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
WP_012271590.1|2065707_2066424_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041166453.1|2066420_2067311_+	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_012271592.1|2067371_2068499_+	2-methylcitrate synthase	NA	NA	NA	NA	NA
WP_012271593.1|2068668_2071257_+	Fe/S-dependent 2-methylisocitrate dehydratase AcnD	NA	NA	NA	NA	NA
WP_012271594.1|2071321_2072512_+	2-methylaconitate cis-trans isomerase PrpF	NA	NA	NA	NA	NA
2072119:2072136	attL	TGTCGACCAGGCTGCCGG	NA	NA	NA	NA
WP_012271595.1|2072584_2074069_+	2-methylcitrate dehydratase	NA	NA	NA	NA	NA
WP_041166454.1|2074141_2076751_-	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
WP_012271597.1|2077120_2077636_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_012271598.1|2077704_2078061_-	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_012271599.1|2078384_2079035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012271600.1|2079115_2080195_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_012271601.1|2080359_2080668_+	peptidase	NA	NA	NA	NA	NA
WP_012271602.1|2080667_2080982_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_012271603.1|2080982_2081651_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_012271604.1|2081647_2082967_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_012271605.1|2083220_2084375_+	HPP family protein	NA	NA	NA	NA	NA
WP_012271606.1|2084348_2085215_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033740654.1|2087138_2087447_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_125855459.1|2087610_2088006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028699633.1|2088025_2088490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053092298.1|2088483_2089002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071984337.1|2089312_2089639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028699631.1|2090043_2090835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028699630.1|2091132_2091531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012272582.1|2092015_2092474_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_060709262.1|2092780_2093761_+|transposase	IS5-like element ISPa41 family transposase	transposase	Q38213	Escherichia_phage	58.9	7.2e-102
WP_071984338.1|2093732_2094755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071984339.1|2094974_2097395_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_049275254.1|2097870_2098287_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071984340.1|2098255_2100145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071984341.1|2100144_2101803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028700088.1|2101795_2102944_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012271608.1|2104307_2105378_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_012271609.1|2105505_2105748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012271610.1|2106232_2108620_-	response regulator	NA	NA	NA	NA	NA
WP_012271611.1|2108633_2109095_-	response regulator	NA	NA	NA	NA	NA
WP_012271612.1|2109110_2111357_-	GAF domain-containing protein	NA	B5LWN8	Feldmannia_species_virus	21.4	3.2e-28
2109611:2109628	attR	TGTCGACCAGGCTGCCGG	NA	NA	NA	NA
WP_012271613.1|2111624_2112152_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_012271614.1|2112182_2112719_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_012271615.1|2112737_2113271_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
>prophage 3
NZ_CP017073	Pseudomonas putida strain PP112420, complete genome	6031212	3794449	3802540	6031212		Pseudomonas_phage(66.67%)	7	NA	NA
WP_071984495.1|3794449_3794896_-	structural protein P5	NA	A0A2H4J6R1	uncultured_Caudovirales_phage	56.1	8.7e-39
WP_081366119.1|3794958_3795696_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_071984497.1|3795731_3797702_-	hypothetical protein	NA	A0A2H4PI00	Pseudomonas_phage	65.6	2.1e-249
WP_071984498.1|3797758_3800482_-	hypothetical protein	NA	A0A0H5ART3	Pseudomonas_phage	53.1	1.4e-280
WP_071984499.1|3800478_3800874_-	hypothetical protein	NA	A0A2H4PI57	Pseudomonas_phage	58.8	1.1e-37
WP_071984500.1|3800885_3801383_-	DUF1833 domain-containing protein	NA	A0A2H4PI86	Pseudomonas_phage	50.6	1.3e-38
WP_155769225.1|3801379_3802540_-	hypothetical protein	NA	A0A0F7L427	uncultured_marine_virus	30.0	3.5e-23
>prophage 4
NZ_CP017073	Pseudomonas putida strain PP112420, complete genome	6031212	3806143	3850889	6031212	protease,integrase,terminase	Pseudomonas_phage(52.0%)	66	3793689:3793748	3846285:3846352
3793689:3793748	attL	CTGCGGGGCTTTCGAATGGTGGAGGCCGAGGTCGGAATCGAACCGGCGTAGACGGATTTG	NA	NA	NA	NA
WP_071984785.1|3806143_3806509_-	superinfection immunity protein	NA	A0A0S2SY85	Pseudomonas_phage	39.4	2.0e-12
WP_071984503.1|3806644_3806884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071984504.1|3807535_3808705_-	Ig-like domain-containing protein	NA	A0A2C9CX52	Yersinia_phage	54.1	6.5e-09
WP_071984505.1|3808764_3809172_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_071984506.1|3809556_3809940_-	glutamate 5-kinase	NA	A0A059VA70	Pseudomonas_phage	48.4	6.6e-27
WP_071984507.1|3809941_3810313_-	hypothetical protein	NA	A0A0S2SYB7	Pseudomonas_phage	56.7	8.0e-30
WP_071984508.1|3810312_3810618_-	hypothetical protein	NA	A0A0H5BBX8	Pseudomonas_phage	57.1	6.7e-06
WP_071984509.1|3810660_3811629_-	hypothetical protein	NA	A0A0H5ARK0	Pseudomonas_phage	78.6	1.1e-139
WP_071984510.1|3811638_3812385_-	hypothetical protein	NA	A0A0H5AWD1	Pseudomonas_phage	74.8	3.7e-90
WP_071984511.1|3812535_3813612_-	hypothetical protein	NA	A0A0H5BBX3	Pseudomonas_phage	52.4	2.1e-99
WP_081366120.1|3813611_3814997_-	DUF4055 domain-containing protein	NA	A0A0H5AWC7	Pseudomonas_phage	67.9	3.1e-183
WP_029886014.1|3814993_3816241_-|terminase	terminase	terminase	A0A2R3UAD4	Siphoviridae_environmental_samples	73.4	6.2e-183
WP_071984513.1|3816221_3816878_-|terminase	terminase small subunit	terminase	A0A2K9V3C4	Faecalibacterium_phage	44.6	4.0e-24
WP_071984514.1|3816917_3817358_-	proteasome subunit beta	NA	A0A2H4J821	uncultured_Caudovirales_phage	60.0	1.1e-38
WP_046787142.1|3817567_3817837_-	hypothetical protein	NA	A0A1B0VME7	Pseudomonas_phage	58.8	2.5e-17
WP_054881780.1|3817836_3818148_-	hypothetical protein	NA	A0A1B0VME9	Pseudomonas_phage	50.5	6.5e-17
WP_071984515.1|3818782_3819373_-	hypothetical protein	NA	A0A059VF83	Pseudomonas_phage	61.7	1.6e-64
WP_071984786.1|3819488_3820094_-	ninG protein	NA	A0A0U1VZM0	Pseudomonas_phage	53.0	7.9e-51
WP_071984516.1|3820090_3820489_-	NinB family protein	NA	A0A059VG13	Pseudomonas_phage	84.1	1.1e-61
WP_071984517.1|3820485_3820707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071984518.1|3820703_3821006_-	hypothetical protein	NA	A0A2H4JG78	uncultured_Caudovirales_phage	42.5	8.6e-06
WP_081366121.1|3821005_3821266_-	hypothetical protein	NA	A0A2H4J0W8	uncultured_Caudovirales_phage	61.8	1.9e-25
WP_071984519.1|3821330_3821966_-	hypothetical protein	NA	A0A0S2SYE7	Pseudomonas_phage	33.3	1.9e-18
WP_071984520.1|3821965_3823363_-	AAA family ATPase	NA	A0A125RNK2	Pseudomonas_phage	53.5	5.8e-129
WP_071984521.1|3823359_3824190_-	replication protein	NA	B5WZX9	Pseudomonas_phage	34.8	1.2e-28
WP_071984522.1|3824182_3824398_-	hypothetical protein	NA	A0A2H4J111	uncultured_Caudovirales_phage	100.0	1.8e-05
WP_071984524.1|3824689_3824941_-	hypothetical protein	NA	H2BD65	Pseudomonas_phage	66.2	7.4e-19
WP_019751332.1|3825217_3825424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019751331.1|3825454_3825631_-	hypothetical protein	NA	R9TPV3	Vibrio_phage	53.1	7.7e-07
WP_054830708.1|3825739_3826408_+	helix-turn-helix domain-containing protein	NA	A0A2H4J868	uncultured_Caudovirales_phage	62.9	9.7e-50
WP_071984526.1|3826814_3827210_+	hypothetical protein	NA	A0A2H4J590	uncultured_Caudovirales_phage	100.0	9.7e-66
WP_071984527.1|3827206_3827557_+	hypothetical protein	NA	A0A2H4J5I9	uncultured_Caudovirales_phage	100.0	1.3e-58
WP_071984529.1|3828533_3829010_+	HNH endonuclease	NA	A0A1U9HWQ1	Salmonella_phage	44.1	1.1e-28
WP_071984530.1|3829032_3829242_+	hypothetical protein	NA	A0A0H5ARH3	Pseudomonas_phage	63.3	4.5e-14
WP_071984531.1|3829576_3829774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071984532.1|3829797_3830217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012273069.1|3830213_3830417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071984533.1|3830413_3830635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123108938.1|3830631_3830898_+	hypothetical protein	NA	A0A0H5AW99	Pseudomonas_phage	72.1	2.0e-27
WP_071984535.1|3831182_3832307_+	hypothetical protein	NA	A0A1B0VN89	Pseudomonas_phage	64.6	2.8e-57
WP_071984536.1|3832317_3833079_+	single-stranded DNA-binding protein	NA	A0A125RNR3	Pseudomonas_phage	67.5	2.4e-81
WP_059395705.1|3833062_3833680_+	exonuclease	NA	A0A1B0VMB3	Pseudomonas_phage	84.4	2.9e-101
WP_071984537.1|3833687_3834194_+	hypothetical protein	NA	A0A2H4J7C8	uncultured_Caudovirales_phage	32.2	1.1e-08
WP_071984539.1|3834447_3834795_+	hypothetical protein	NA	A0A2H4J0L9	uncultured_Caudovirales_phage	87.2	6.1e-48
WP_071984540.1|3834769_3835132_+	hypothetical protein	NA	A0A2H4JAQ1	uncultured_Caudovirales_phage	48.9	1.4e-15
WP_071984541.1|3835149_3835662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071984542.1|3835772_3836249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071984544.1|3837057_3837630_+	DUF1566 domain-containing protein	NA	A0A0A0YR68	Pseudomonas_phage	46.2	1.1e-28
WP_054882108.1|3837682_3838036_+	four helix bundle protein	NA	NA	NA	NA	NA
WP_081366122.1|3838234_3839392_+	RNA-directed DNA polymerase	NA	A0A0N7AE80	Bacillus_phage	35.6	1.2e-47
WP_071984546.1|3839451_3840171_+	HNH endonuclease	NA	A0A1S5SDS7	Streptococcus_phage	28.2	2.3e-17
WP_123108942.1|3840154_3840376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050592038.1|3841076_3841619_+	hypothetical protein	NA	A0A0H4INT9	Pseudoalteromonas_phage	34.4	3.8e-20
WP_071984548.1|3842106_3842574_+	hypothetical protein	NA	Q6JII8	Burkholderia_virus	45.7	7.8e-14
WP_071984549.1|3842570_3842822_+	hypothetical protein	NA	A0A2H4J399	uncultured_Caudovirales_phage	94.0	6.4e-39
WP_071984787.1|3843105_3843504_+	DUF2591 domain-containing protein	NA	A0A1B0VMD7	Pseudomonas_phage	35.1	5.3e-11
WP_155769226.1|3843512_3843674_+	hypothetical protein	NA	A0A2H4J907	uncultured_Caudovirales_phage	92.5	2.7e-27
WP_071984550.1|3843736_3844474_+	serine/threonine protein phosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	83.6	1.5e-120
WP_071984551.1|3844674_3844917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071984552.1|3844944_3845190_+	hypothetical protein	NA	B5WZU8	Pseudomonas_phage	66.2	2.8e-23
WP_071984553.1|3845186_3846164_-|integrase	site-specific integrase	integrase	W6MYA3	Pseudomonas_phage	65.2	4.3e-115
WP_012273163.1|3846531_3847551_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	25.3	2.0e-22
3846285:3846352	attR	CTGCGGGGCTTTCGAATGGTGGAGGCCGAGGTCGGAATCGAACCGGCGTAGACGGATTTGCAATCCGG	NA	NA	NA	NA
WP_012273164.1|3847748_3848459_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_012273165.1|3848515_3848833_+	SCP2 sterol-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012273166.1|3849018_3850086_+	phosphotransferase family protein	NA	NA	NA	NA	NA
WP_012273167.1|3850121_3850889_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	1.7e-18
>prophage 5
NZ_CP017073	Pseudomonas putida strain PP112420, complete genome	6031212	3887118	3895667	6031212	tRNA	uncultured_Caudovirales_phage(75.0%)	10	NA	NA
WP_003251184.1|3887118_3887790_+	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	91.0	2.1e-105
WP_071984555.1|3887969_3889349_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	51.1	1.3e-27
WP_012273202.1|3889525_3889918_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	79.1	2.5e-53
WP_012273203.1|3889919_3890279_+	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	64.2	4.3e-36
WP_012273204.1|3890278_3890575_+	sulfurtransferase complex subunit TusB	NA	A0A2H4JG28	uncultured_Caudovirales_phage	63.6	3.0e-27
WP_012273205.1|3890571_3890907_+	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	76.6	1.7e-42
WP_012273206.1|3890903_3891905_+	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	80.5	2.1e-157
WP_012273207.1|3892001_3892961_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_071984556.1|3892994_3894386_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_012273209.1|3894386_3895667_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.5	5.0e-95
>prophage 6
NZ_CP017073	Pseudomonas putida strain PP112420, complete genome	6031212	5088115	5189036	6031212	integrase,transposase	Escherichia_phage(13.79%)	105	5142443:5142502	5158703:5158904
WP_014003920.1|5088115_5089096_-|transposase	IS5-like element ISPa41 family transposase	transposase	Q38213	Escherichia_phage	59.2	1.4e-102
WP_071984676.1|5089692_5090073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071984677.1|5090076_5090673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155769233.1|5090669_5090846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155769234.1|5091036_5091939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071984679.1|5092499_5092850_+	hypothetical protein	NA	B6SD62	Bacteriophage	54.5	2.8e-24
WP_155769235.1|5092846_5093218_+	hypothetical protein	NA	A0A2H4J0E0	uncultured_Caudovirales_phage	58.0	4.0e-13
WP_013741669.1|5093903_5095622_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_013741668.1|5095624_5096533_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_009288528.1|5096529_5097747_+	TniQ family protein	NA	NA	NA	NA	NA
WP_000904941.1|5097807_5098422_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	51.9	1.3e-37
WP_001087809.1|5098474_5098711_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_003465059.1|5098707_5099073_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000136268.1|5099089_5100736_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.3	1.0e-39
WP_000654684.1|5100732_5100978_-	mercury resistance system transport protein MerF	NA	NA	NA	NA	NA
WP_000735441.1|5100980_5101256_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294667.1|5101271_5101622_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_000429838.1|5101693_5102128_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_003464991.1|5102402_5102921_+	DUF417 family protein	NA	NA	NA	NA	NA
WP_003464995.1|5102950_5103796_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_024015041.1|5104032_5107062_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_010465829.1|5107045_5107648_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	50.3	1.6e-40
WP_004574529.1|5107833_5108052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004574528.1|5108204_5108624_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_004574527.1|5108695_5109046_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_004574526.1|5109059_5109338_+	mercury resistance system periplasmic binding protein MerP	NA	A0A218MNH0	uncultured_virus	47.8	1.3e-08
WP_004574525.1|5109350_5109782_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_004574524.1|5109794_5111477_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.0	1.9e-38
WP_004574523.1|5111497_5111914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004574522.1|5111913_5112276_+	mercuric resistance transcriptional repressor protein MerD	NA	NA	NA	NA	NA
WP_004574521.1|5112268_5112505_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_004574520.1|5112628_5112841_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_004574519.1|5112978_5115975_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	48.3	9.1e-265
WP_004574518.1|5115978_5116389_-	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_004574517.1|5116388_5116628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001389365.1|5116920_5117685_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_010792470.1|5117932_5118922_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_003090697.1|5118918_5119155_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_003090698.1|5119151_5119517_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_003090700.1|5119534_5121220_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.2	1.3e-39
WP_000732290.1|5121291_5121567_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294666.1|5121582_5121933_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000414383.1|5122004_5122439_+	mercury resistance transcriptional regulator MerR	NA	NA	NA	NA	NA
WP_049306259.1|5122969_5124190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023443007.1|5124170_5124635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058131653.1|5124702_5127393_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_003152690.1|5127832_5128390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034039546.1|5128569_5129733_+	MexC family multidrug efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_034065037.1|5129748_5132883_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.3	3.8e-56
WP_003152694.1|5132887_5134321_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_081366128.1|5134750_5135695_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	42.7	1.1e-59
WP_000480959.1|5135764_5136601_-	APH(6)-I family aminoglycoside O-phosphotransferase	NA	NA	NA	NA	NA
WP_025464697.1|5136600_5137404_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.6	2.2e-24
WP_001389365.1|5137611_5138376_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_003155741.1|5138607_5139231_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	47.6	1.7e-35
WP_003108247.1|5139411_5140212_-	subclass B1 metallo-beta-lactamase VIM-2	NA	NA	NA	NA	NA
WP_071984682.1|5140302_5140857_-	AAC(6')-Ib family aminoglycoside 6'-N-acetyltransferase	NA	NA	NA	NA	NA
WP_063844476.1|5140985_5141222_-	trimethoprim-resistant dihydrofolate reductase DfrB1	NA	A0A0H5ARK7	Pseudomonas_phage	66.0	4.8e-12
WP_000845054.1|5141428_5142442_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
5142443:5142502	attL	GGCAGCGCAAGTCAATCCTGGCGGATTCACTACCCCTGCGCGAAGGCCATCGGTGCCGCA	NA	NA	NA	NA
WP_017335988.1|5142740_5143658_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	57.8	4.2e-35
WP_039175666.1|5143985_5145821_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.1	1.6e-54
WP_000050481.1|5146453_5147995_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_069455558.1|5148714_5149005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032495607.1|5149175_5149832_-	quinolone resistance pentapeptide repeat protein QnrVC6	NA	NA	NA	NA	NA
WP_000050481.1|5150094_5151636_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_069455558.1|5152355_5152646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032495607.1|5152816_5153473_-	quinolone resistance pentapeptide repeat protein QnrVC6	NA	NA	NA	NA	NA
WP_000050481.1|5153735_5155277_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|5155681_5156521_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|5156514_5156862_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_071984683.1|5157094_5157529_-	GFA family protein	NA	NA	NA	NA	NA
WP_000845048.1|5157688_5158702_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_004574516.1|5159002_5159929_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	46.4	1.8e-41
5158703:5158904	attR	GGCAGCGCAAGTCAATCCTGGCGGATTCACTACCCCTGCGCGAAGGCCATCGGTGCCGCATCGAACGGCCGGTTGCGGAAAGTCCTCCCTGCGTCCGCTGATGGCCGGCAGCAGCCCGTCGTTGCCTGATGGATCCAACCCCTCCGCTGCTATAGTGCAGTCGGCTTCTGACGTTCAGTGCAGCCGTCTTCTGAAAACGACA	NA	NA	NA	NA
WP_005005993.1|5160039_5160414_+	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_003464988.1|5161274_5161541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003464986.1|5161710_5161992_-	DUF427 domain-containing protein	NA	NA	NA	NA	NA
WP_005005995.1|5162059_5162332_-	glutaredoxin 3	NA	A0A1X7BZ88	Faustovirus	42.6	1.3e-08
WP_002118292.1|5162785_5163532_-	oxidoreductase	NA	NA	NA	NA	NA
WP_003464980.1|5163524_5164127_-	sulfite oxidase-like oxidoreductase	NA	NA	NA	NA	NA
WP_003464979.1|5164594_5165065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010591687.1|5165196_5165394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010591688.1|5165390_5165684_-	DUF1330 domain-containing protein	NA	NA	NA	NA	NA
WP_005006001.1|5165742_5166174_-	heme-binding protein	NA	NA	NA	NA	NA
WP_071984684.1|5166246_5167260_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003464971.1|5167707_5168676_-	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
WP_003464969.1|5168672_5169377_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_003464967.1|5169517_5170057_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_003464965.1|5170058_5170502_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_076611919.1|5170784_5171906_-|transposase	ISAs1-like element ISPa60 family transposase	transposase	NA	NA	NA	NA
WP_071890699.1|5172260_5173064_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	36.2	5.2e-34
WP_110992713.1|5173056_5174556_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_153046132.1|5174499_5175570_+	hypothetical protein	NA	I4AZM6	Saccharomonospora_phage	34.7	1.2e-20
WP_003464945.1|5175933_5176863_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_049273832.1|5176889_5178212_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	34.5	5.4e-52
WP_003464940.1|5178292_5179219_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003464938.1|5179509_5180712_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	54.2	8.8e-110
WP_003465037.1|5181468_5181693_-	DUF2798 domain-containing protein	NA	NA	NA	NA	NA
WP_003465039.1|5181747_5182449_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_003465041.1|5182539_5183130_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016487046.1|5183211_5183889_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003464938.1|5184775_5185978_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	54.2	8.8e-110
WP_011711661.1|5186468_5186945_+	DM13 domain-containing protein	NA	NA	NA	NA	NA
WP_052959448.1|5187345_5187717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047296649.1|5187758_5188019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003465026.1|5188007_5189036_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.6	1.5e-46
>prophage 7
NZ_CP017073	Pseudomonas putida strain PP112420, complete genome	6031212	5453377	5462114	6031212		Agrobacterium_phage(16.67%)	7	NA	NA
WP_012274438.1|5453377_5454583_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	35.2	9.6e-48
WP_012274439.1|5454586_5455414_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	46.2	6.6e-48
WP_008099951.1|5455528_5455978_-	azurin	NA	NA	NA	NA	NA
WP_012274441.1|5456327_5456915_+	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	27.2	2.1e-08
WP_041166605.1|5456958_5459259_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	95.8	2.3e-135
WP_080516284.1|5459867_5460674_+	RHS repeat-associated core domain-containing protein	NA	A0A1W5K0N1	Bacteriophage	57.1	3.7e-19
WP_012274444.1|5460716_5462114_-	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	57.0	2.3e-141
