The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013309	Vibrio cholerae strain E1162 chromosome 1, complete sequence	2996535	339964	379490	2996535	coat	Vibrio_phage(53.57%)	33	NA	NA
WP_001161489.1|339964_340132_+	hypothetical protein	NA	E3U9J0	Vibrio_phage	100.0	2.3e-13
WP_000005769.1|341330_341882_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001881266.1|342058_343627_+	replication protein	NA	A7BJY2	Enterobacteria_phage	32.3	2.7e-58
WP_000512956.1|343646_343916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001052672.1|344045_344738_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001161489.1|344815_344983_+	hypothetical protein	NA	E3U9J0	Vibrio_phage	100.0	2.3e-13
WP_000170634.1|344975_345560_+	DNA-binding protein	NA	E3U9I9	Vibrio_phage	100.0	6.4e-114
WP_000693566.1|346049_346388_-	helix-turn-helix transcriptional regulator	NA	U5TNA1	Satellite_phage	100.0	7.3e-54
WP_000743997.1|346513_347593_+	replication initiation factor domain-containing protein	NA	U5TQR3	Satellite_phage	100.0	2.2e-213
WP_001911548.1|347594_347954_+	hypothetical protein	NA	A0A0N9HE73	Vibrio_phage	100.0	4.4e-65
WP_000493022.1|348089_348338_+	colonization factor	NA	A0A0N7F140	Vibrio_phage	100.0	8.8e-33
WP_001268534.1|348444_349632_+|coat	minor coat protein pIII	coat	A0A142I701	Vibrio_phage	100.0	1.4e-200
WP_000979342.1|349628_349922_+	accessory cholera enterotoxin	NA	A0A0F6YNQ7	Vibrio_phage	100.0	3.7e-46
WP_000021616.1|349918_351118_+	zonula occludens toxin ZOT	NA	A0A142I6Z1	Vibrio_phage	100.0	5.3e-240
WP_001881225.1|351216_351993_+	cholera enterotoxin catalytic subunit CtxA	NA	A0A142I6Y0	Vibrio_phage	100.0	1.3e-151
WP_000593522.1|351989_352364_+	cholera enterotoxin binding subunit CtxB	NA	Q77DH7	Vibrio_virus	100.0	7.8e-65
WP_000693566.1|352965_353304_-	helix-turn-helix transcriptional regulator	NA	U5TNA1	Satellite_phage	100.0	7.3e-54
WP_000743997.1|353429_354509_+	replication initiation factor domain-containing protein	NA	U5TQR3	Satellite_phage	100.0	2.2e-213
WP_001911551.1|354510_354861_+	hypothetical protein	NA	U5TMH5	Satellite_phage	100.0	1.0e-63
WP_000053920.1|354954_355179_+	RstC protein	NA	U5TMI6	Satellite_phage	100.0	1.1e-34
WP_000693566.1|355690_356029_-	helix-turn-helix transcriptional regulator	NA	U5TNA1	Satellite_phage	100.0	7.3e-54
WP_000743997.1|356154_357234_+	replication initiation factor domain-containing protein	NA	U5TQR3	Satellite_phage	100.0	2.2e-213
WP_001911548.1|357235_357595_+	hypothetical protein	NA	A0A0N9HE73	Vibrio_phage	100.0	4.4e-65
WP_000493022.1|357730_357979_+	colonization factor	NA	A0A0N7F140	Vibrio_phage	100.0	8.8e-33
WP_001268534.1|358085_359273_+|coat	minor coat protein pIII	coat	A0A142I701	Vibrio_phage	100.0	1.4e-200
WP_000979342.1|359269_359563_+	accessory cholera enterotoxin	NA	A0A0F6YNQ7	Vibrio_phage	100.0	3.7e-46
WP_000021616.1|359559_360759_+	zonula occludens toxin ZOT	NA	A0A142I6Z1	Vibrio_phage	100.0	5.3e-240
WP_001881225.1|360857_361634_+	cholera enterotoxin catalytic subunit CtxA	NA	A0A142I6Y0	Vibrio_phage	100.0	1.3e-151
WP_000593522.1|361630_362005_+	cholera enterotoxin binding subunit CtxB	NA	Q77DH7	Vibrio_virus	100.0	7.8e-65
WP_000517826.1|362462_376100_-	MARTX multifunctional-autoprocessing repeats-in-toxin holotoxin RtxA	NA	B3Y8K3	Vibrio_virus	100.0	8.4e-07
WP_001881196.1|376123_376585_-	RTX toxin-activating lysine-acyltransferase RtxC	NA	NA	NA	NA	NA
WP_001906284.1|376610_376958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149591715.1|377384_379490_+	RTX toxin T1SS ABC transporter subunit RtxB	NA	W8CYL7	Bacillus_phage	27.1	4.9e-39
>prophage 2
NZ_CP013309	Vibrio cholerae strain E1162 chromosome 1, complete sequence	2996535	1117864	1125057	2996535		Anguillid_herpesvirus(16.67%)	9	NA	NA
WP_001162850.1|1117864_1118293_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	38.4	1.0e-20
WP_000107237.1|1118496_1119786_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	34.3	1.7e-34
WP_000872176.1|1120005_1120200_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001124187.1|1120248_1120587_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_001196560.1|1120600_1122451_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.1	5.3e-106
WP_001105747.1|1122474_1122990_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_000301571.1|1123038_1123362_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	50.5	3.0e-25
WP_000331703.1|1123422_1123806_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.2	5.4e-53
WP_000775253.1|1123842_1125057_-	IscS subfamily cysteine desulfurase	NA	A0A0H3TPH2	Faustovirus	30.5	1.1e-32
>prophage 3
NZ_CP013309	Vibrio cholerae strain E1162 chromosome 1, complete sequence	2996535	1356692	1363916	2996535		uncultured_Mediterranean_phage(33.33%)	6	NA	NA
WP_001279365.1|1356692_1357580_+	cysteine synthase CysM	NA	A0A1X9I5K7	Streptococcus_phage	41.1	4.1e-56
WP_001894770.1|1357847_1360436_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	23.0	2.2e-33
WP_000116737.1|1360528_1361536_-	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	34.2	6.0e-35
WP_000177568.1|1361609_1362545_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	34.7	7.8e-05
WP_000002982.1|1362544_1363171_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.1	2.0e-36
WP_000698379.1|1363163_1363916_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	53.3	8.0e-69
>prophage 4
NZ_CP013309	Vibrio cholerae strain E1162 chromosome 1, complete sequence	2996535	2474338	2480955	2996535		Staphylococcus_phage(66.67%)	7	NA	NA
WP_000210573.1|2474338_2475472_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.4e-64
WP_000366574.1|2475483_2476734_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	49.5	5.0e-100
WP_000543544.1|2476833_2477283_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001131994.1|2477308_2478412_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	33.1	1.3e-43
WP_000493874.1|2478416_2479070_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	38.2	1.2e-31
WP_001122865.1|2479110_2480220_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	39.8	6.7e-64
WP_000864130.1|2480484_2480955_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	48.7	6.8e-34
>prophage 5
NZ_CP013309	Vibrio cholerae strain E1162 chromosome 1, complete sequence	2996535	2535754	2601720	2996535	integrase,head,terminase,tail,plate,portal,tRNA,capsid	Vibrio_phage(89.13%)	70	2569295:2569318	2602405:2602428
WP_000216841.1|2535754_2537179_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000731531.1|2537474_2538440_+	OmpA family protein	NA	NA	NA	NA	NA
WP_001895039.1|2538528_2539035_-	Fe3+-citrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000279435.1|2539646_2541710_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_000064348.1|2542013_2542829_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_000523394.1|2543074_2550328_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	22.9	2.9e-30
WP_000739493.1|2550457_2551591_-	flagella assembly protein FlgT	NA	NA	NA	NA	NA
WP_000759070.1|2551751_2552387_+	membrane protein	NA	NA	NA	NA	NA
WP_001881911.1|2552394_2552832_+	flagellar assembly lipoprotein FlgP	NA	NA	NA	NA	NA
WP_000729367.1|2552941_2553367_-	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_000907265.1|2553470_2553794_-	flagellar biosynthesis anti-sigma factor FlgM	NA	NA	NA	NA	NA
WP_001881906.1|2553924_2554692_-	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_000145786.1|2554748_2555675_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.6	1.4e-35
WP_000125387.1|2555685_2556513_+	protein-glutamate O-methyltransferase	NA	NA	NA	NA	NA
WP_001007981.1|2556732_2557128_+	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_000051920.1|2557132_2557549_+	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_000929365.1|2557566_2558274_+	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_000122825.1|2558302_2559607_+	flagellar hook protein FlgE	NA	NA	NA	NA	NA
WP_000373284.1|2559789_2560539_+	flagellar basal-body rod protein FlgF	NA	NA	NA	NA	NA
WP_001182097.1|2560558_2561347_+	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_001911822.1|2561370_2562147_+	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_001225051.1|2562237_2563323_+	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_000609516.1|2563333_2564272_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M9Y4	Brevibacillus_phage	31.9	9.5e-11
WP_000135483.1|2564451_2566326_+	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_000934642.1|2566338_2567532_+	flagellar hook-associated protein FlgL	NA	NA	NA	NA	NA
WP_000154827.1|2567939_2569079_+	flagellin	NA	NA	NA	NA	NA
2569295:2569318	attL	GAAAAGGGGCTTTTCTTTTTTCTG	NA	NA	NA	NA
WP_000116333.1|2569527_2570565_-|integrase	site-specific integrase	integrase	U3PIJ4	Vibrio_phage	100.0	1.5e-198
WP_000985033.1|2570564_2570978_-	hypothetical protein	NA	U3PDE6	Vibrio_phage	100.0	8.9e-70
WP_000132153.1|2570977_2571883_-	NAD-dependent DNA ligase	NA	U3PB51	Vibrio_phage	100.0	1.3e-161
WP_001881894.1|2571908_2572556_-	phage repressor protein CI	NA	A0A166YHA0	Vibrio_phage	100.0	1.1e-119
WP_000959026.1|2572701_2572914_+	hypothetical protein	NA	U3PFJ1	Vibrio_phage	100.0	6.4e-32
WP_000253093.1|2573024_2573564_+	phage regulatory CII family protein	NA	U3PIJ8	Vibrio_phage	100.0	5.5e-96
WP_001272765.1|2573576_2574011_+	hypothetical protein	NA	U3PDF0	Vibrio_phage	100.0	2.8e-74
WP_001031152.1|2574092_2574626_+	hypothetical protein	NA	U3PB56	Vibrio_phage	100.0	3.9e-86
WP_000997540.1|2574622_2575033_+	hypothetical protein	NA	U3PCE8	Vibrio_phage	100.0	1.8e-75
WP_001198814.1|2575282_2575510_+	hypothetical protein	NA	U3PIK2	Vibrio_phage	100.0	3.2e-37
WP_000099608.1|2575506_2576124_+	DNA methyltransferase	NA	U3PDF3	Vibrio_phage	100.0	1.2e-118
WP_000629095.1|2576120_2576231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000613058.1|2576227_2576812_+	hypothetical protein	NA	U3PB60	Vibrio_phage	100.0	3.2e-105
WP_001909657.1|2576808_2579394_+	replication endonuclease	NA	A0A166YHE2	Vibrio_phage	99.9	0.0e+00
WP_000756239.1|2579403_2579940_+	DUF262 domain-containing protein	NA	U3PFK3	Vibrio_phage	100.0	4.1e-99
WP_001140408.1|2580013_2580352_-	helix-turn-helix transcriptional regulator	NA	U3PIK7	Vibrio_phage	100.0	2.8e-53
WP_001292395.1|2580589_2580835_+	hypothetical protein	NA	U3PDF9	Vibrio_phage	100.0	1.5e-37
WP_001263191.1|2580835_2581087_-	ogr/Delta-like zinc finger family protein	NA	U3PB63	Vibrio_phage	100.0	1.9e-43
WP_000729650.1|2581157_2581373_-	hypothetical protein	NA	U3PCF7	Vibrio_phage	100.0	3.1e-34
WP_001999948.1|2581356_2582403_-|portal	phage portal protein	portal	U3PFK6	Vibrio_phage	100.0	5.7e-206
WP_000331803.1|2582399_2584217_-|terminase	terminase ATPase subunit family protein	terminase	U3PIL1	Vibrio_phage	100.0	0.0e+00
WP_001127095.1|2584390_2585290_+|capsid	GPO family capsid scaffolding protein	capsid	A0A160DHM4	Vibrio_phage	100.0	4.0e-123
WP_000078361.1|2585326_2586337_+|capsid	phage major capsid protein, P2 family	capsid	U3PB67	Vibrio_phage	100.0	7.0e-193
WP_000059165.1|2586352_2587069_+|terminase	terminase endonuclease subunit	terminase	U3PCG2	Vibrio_phage	100.0	1.3e-132
WP_000493401.1|2587175_2587637_+|head	head completion/stabilization protein	head	U3PFL1	Vibrio_phage	100.0	1.5e-78
WP_000122189.1|2587633_2588122_+|tail	phage tail protein	tail	U3PIL4	Vibrio_phage	100.0	1.6e-89
WP_000461677.1|2588108_2588768_+	phage virion morphogenesis protein	NA	U3PDG7	Vibrio_phage	100.0	9.1e-117
WP_000312540.1|2588769_2589879_+	DUF2586 family protein	NA	U3PB71	Vibrio_phage	100.0	1.5e-209
WP_000063627.1|2589878_2590337_+	DUF2597 family protein	NA	U3PCG7	Vibrio_phage	100.0	1.3e-82
WP_000382491.1|2590351_2590561_+	TraR/DksA family transcriptional regulator	NA	U3PFL5	Vibrio_phage	100.0	2.0e-33
WP_001077689.1|2590557_2590785_+	hypothetical protein	NA	U3PIL8	Vibrio_phage	100.0	2.1e-36
WP_000705022.1|2590771_2591359_+	lysozyme	NA	U3PDH1	Vibrio_phage	100.0	2.5e-110
WP_000990572.1|2591333_2591675_+	hypothetical protein	NA	U3PB75	Vibrio_phage	100.0	1.1e-52
WP_001899696.1|2591724_2591886_+	hypothetical protein	NA	U3PCH1	Vibrio_phage	98.1	1.1e-23
WP_000165786.1|2591882_2592164_+	hypothetical protein	NA	A9ZT39	Vibrio_virus	100.0	5.1e-45
WP_000343647.1|2592360_2594178_+|tail	phage tail tape measure protein	tail	U3PFL8	Vibrio_phage	100.0	0.0e+00
WP_001113003.1|2594167_2594500_+	DUF2590 family protein	NA	U3PIM1	Vibrio_phage	100.0	1.7e-55
WP_000044509.1|2594496_2595696_+|plate	baseplate J/gp47 family protein	plate	U3PDH5	Vibrio_phage	100.0	1.0e-222
WP_000005870.1|2595692_2596352_+	hypothetical protein	NA	U3PB79	Vibrio_phage	100.0	8.2e-126
WP_000083759.1|2596348_2598211_+|tail	phage tail protein	tail	Q8HA58	Vibrio_phage	100.0	0.0e+00
WP_000369864.1|2598210_2598735_+	hypothetical protein	NA	A9ZT45	Vibrio_virus	100.0	4.8e-97
WP_000267787.1|2598737_2599631_+	hypothetical protein	NA	U3PIM3	Vibrio_phage	100.0	2.8e-161
WP_000457681.1|2599618_2600092_+	hypothetical protein	NA	U3PDI0	Vibrio_phage	100.0	6.6e-77
WP_000779002.1|2600088_2601720_+	hypothetical protein	NA	U3PB83	Vibrio_phage	100.0	0.0e+00
2602405:2602428	attR	GAAAAGGGGCTTTTCTTTTTTCTG	NA	NA	NA	NA
