The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP026585	Klebsiella pneumoniae strain WCHKP649 chromosome, complete genome	5461116	448578	481836	5461116	capsid,terminase,portal,tRNA,tail,protease,head,integrase	uncultured_Caudovirales_phage(73.33%)	35	466186:466203	482181:482198
WP_002919147.1|448578_449526_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_002919144.1|449540_450050_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_002919139.1|450178_451303_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919137.1|451274_451748_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_004145330.1|451773_452316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002919132.1|452320_452893_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_002919126.1|452896_453715_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919125.1|453711_453969_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919123.1|453944_454499_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002919103.1|460294_460516_-	membrane protein	NA	NA	NA	NA	NA
WP_002919102.1|460809_463920_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002919101.1|463932_465072_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004150972.1|465450_466101_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
466186:466203	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004150971.1|466376_467603_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
WP_004150970.1|467695_468637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547839.1|468818_469103_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004150969.1|469113_469893_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_024194847.1|470016_470211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106918304.1|470344_470614_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_001549752.1|470606_470795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150967.1|470787_471102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|471098_471467_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_001549749.1|471463_471829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|471828_473964_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_004150964.1|474306_474642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150963.1|474690_475203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549743.1|475466_476633_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_001547826.1|476684_477245_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_004150962.1|477246_478488_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_004150961.1|478484_478820_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_001547824.1|478816_479116_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150959.1|479115_479559_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_004198610.1|479685_479877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113647.1|479834_480191_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150955.1|480174_481836_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
482181:482198	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
>prophage 2
NZ_CP026585	Klebsiella pneumoniae strain WCHKP649 chromosome, complete genome	5461116	1241256	1290400	5461116	capsid,terminase,portal,tail,tRNA,transposase,plate,lysis,head,coat,integrase	Salmonella_phage(80.0%)	63	1240671:1240717	1279026:1279072
1240671:1240717	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_000019473.1|1241256_1242237_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_062955148.1|1242282_1243281_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	94.5	2.2e-183
WP_004151019.1|1243283_1243913_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
WP_001397669.1|1244035_1244278_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
WP_004151018.1|1244310_1244820_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_004151017.1|1244827_1245028_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
WP_004144796.1|1244991_1245330_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_004151016.1|1245397_1245631_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
WP_004151014.1|1245630_1245858_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
WP_004151013.1|1245854_1246706_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
WP_004151012.1|1246702_1249087_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
WP_009483812.1|1249316_1249568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152765.1|1249567_1251052_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004151011.1|1251159_1251348_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
WP_004151010.1|1251359_1251593_+	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
WP_004151009.1|1251688_1252372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151008.1|1252358_1253438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151007.1|1253437_1254439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024940854.1|1254960_1255230_+	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
WP_004151006.1|1255286_1256330_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
WP_019405037.1|1256329_1258093_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
WP_004151004.1|1258233_1259067_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
WP_004151003.1|1259083_1260136_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
WP_004134644.1|1260139_1260793_+|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
WP_004151002.1|1260888_1261353_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
WP_004151001.1|1261352_1261556_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
WP_004134639.1|1261559_1261775_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
WP_004151000.1|1261755_1262265_+	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
WP_004150999.1|1262269_1262653_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
WP_004150998.1|1262649_1263078_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
WP_085955118.1|1263007_1263211_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	77.6	3.0e-23
WP_004150997.1|1263173_1263596_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
WP_004150996.1|1263588_1264035_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
WP_004150995.1|1264057_1264924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150994.1|1265018_1265591_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
WP_004150993.1|1265587_1265950_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
WP_004150992.1|1265936_1266845_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
WP_004152935.1|1266837_1267509_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
WP_004150990.1|1267510_1269460_+|coat	spore coat protein CotH	coat	Q6QI97	Burkholderia_phage	38.9	1.0e-06
WP_004200602.1|1269469_1270588_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
WP_004150988.1|1270639_1271713_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
WP_004150987.1|1271861_1273034_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
WP_004150986.1|1273043_1273559_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004150985.1|1273611_1273911_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
WP_002896220.1|1273925_1274045_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_004150984.1|1274037_1276668_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	41.9	8.9e-115
WP_004150983.1|1276664_1277150_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
WP_004150982.1|1277146_1278241_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
WP_004150981.1|1278307_1278526_+	positive regulator of late gene transcription	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004150980.1|1278553_1278931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914164.1|1279534_1280017_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
1279026:1279072	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_004188817.1|1280127_1280604_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914161.1|1280593_1280884_+	RnfH family protein	NA	NA	NA	NA	NA
WP_002914160.1|1280950_1281292_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_002914159.1|1281439_1283101_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914158.1|1283187_1284066_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914155.1|1284190_1284781_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_004149392.1|1284900_1286187_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914153.1|1286206_1286998_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_002914152.1|1287161_1288526_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914149.1|1288785_1289034_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_004150977.1|1289052_1289601_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914147.1|1289632_1290400_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP026585	Klebsiella pneumoniae strain WCHKP649 chromosome, complete genome	5461116	1395116	1447859	5461116	terminase,tail,holin,transposase,integrase	Salmonella_phage(40.38%)	63	1388451:1388465	1418556:1418570
1388451:1388465	attL	TGAGCAGGTTCGCGA	NA	NA	NA	NA
WP_004151980.1|1395116_1396583_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
WP_004151979.1|1396650_1398228_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_062955102.1|1398419_1399670_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	84.4	5.8e-205
WP_063002073.1|1399612_1399855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197356.1|1399851_1400445_-	MT-A70 family protein	NA	T1SA14	Salmonella_phage	91.9	6.3e-109
WP_062955103.1|1400441_1401104_-	hypothetical protein	NA	A0A059VF56	Pseudomonas_phage	46.6	1.2e-47
WP_048264082.1|1401100_1401259_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	78.8	1.1e-17
WP_009485475.1|1401251_1401545_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	4.0e-32
WP_062955104.1|1401654_1401903_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	76.8	4.9e-31
WP_062955105.1|1401951_1402833_-	recombinase RecT	NA	T1SBJ5	Salmonella_phage	84.3	8.9e-136
WP_062955106.1|1402829_1403651_-	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	80.2	1.8e-130
WP_004164029.1|1403647_1403947_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
WP_004144290.1|1404313_1404895_-	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	7.1e-65
WP_004152538.1|1405049_1405283_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_004152537.1|1405429_1405639_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_004207253.1|1405638_1406406_+	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
WP_032418532.1|1406402_1407188_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.7	3.7e-133
WP_048328152.1|1407307_1407655_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	82.6	6.5e-50
WP_062955107.1|1407847_1408258_+	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	45.1	4.3e-16
WP_032441402.1|1408241_1408433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032441401.1|1408429_1409074_+	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	79.3	8.0e-110
WP_072200041.1|1409367_1409835_+	hypothetical protein	NA	A0A2R2Z312	Escherichia_phage	51.7	1.3e-37
WP_029602865.1|1409834_1410128_+	hypothetical protein	NA	Q6UAT9	Klebsiella_phage	86.6	2.7e-44
WP_050491799.1|1410124_1410745_+	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	40.7	1.0e-29
WP_032441458.1|1410744_1410948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023339258.1|1410940_1411279_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	1.8e-44
WP_004152765.1|1411375_1412860_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_009483812.1|1412859_1413111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032418540.1|1413263_1413521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032441400.1|1413598_1414183_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.6	2.2e-90
WP_062955142.1|1414179_1415655_+	hypothetical protein	NA	Q858H3	Salmonella_phage	93.1	6.4e-280
WP_004200550.1|1415698_1416070_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	91.9	3.7e-59
WP_072354015.1|1416119_1416362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004141368.1|1416823_1417030_+	hypothetical protein	NA	T1SA67	Salmonella_phage	88.2	4.8e-08
WP_032441398.1|1417044_1418727_+|tail	tail protein	tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	84.4	1.5e-264
1418556:1418570	attR	TGAGCAGGTTCGCGA	NA	NA	NA	NA
WP_004152446.1|1418723_1419020_+	hypothetical protein	NA	T1SBI9	Salmonella_phage	70.4	1.2e-33
WP_032441397.1|1419022_1419703_+	peptidase	NA	G9L6C4	Escherichia_phage	84.0	6.1e-76
WP_004200546.1|1419717_1420704_+	hypothetical protein	NA	A0A193GZ49	Enterobacter_phage	94.2	2.5e-179
WP_020953461.1|1420757_1421195_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	91.7	1.3e-66
WP_062955141.1|1421205_1421547_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	70.8	2.4e-36
WP_004152441.1|1421597_1421921_+	hypothetical protein	NA	G9L6C8	Escherichia_phage	85.0	5.3e-46
WP_062955139.1|1421920_1422526_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	77.0	4.0e-87
WP_062955138.1|1422525_1425003_+	hypothetical protein	NA	Q858G3	Salmonella_phage	84.4	0.0e+00
WP_004152438.1|1425002_1425467_+	hypothetical protein	NA	Q858G2	Salmonella_phage	81.2	1.5e-70
WP_032447858.1|1425466_1426006_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	80.0	8.0e-71
WP_062955137.1|1426016_1428551_+	hypothetical protein	NA	Q858G0	Salmonella_phage	84.1	0.0e+00
WP_062955136.1|1428550_1430461_+	hypothetical protein	NA	Q858F9	Salmonella_phage	82.7	5.4e-287
WP_062955135.1|1430460_1433217_+	hypothetical protein	NA	Q858F8	Salmonella_phage	95.4	0.0e+00
WP_062955134.1|1433213_1433408_+	hypothetical protein	NA	Q858F7	Salmonella_phage	67.2	6.5e-15
WP_071787028.1|1433442_1433595_-	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	83.7	2.5e-14
WP_062955133.1|1433693_1433990_-	hypothetical protein	NA	T1SA06	Salmonella_phage	63.9	6.9e-24
WP_062955131.1|1436817_1437081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062956176.1|1437121_1438255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032188295.1|1438243_1438330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019445.1|1438368_1439349_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_000608644.1|1440217_1441480_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_072354001.1|1442370_1442511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077265603.1|1442588_1443905_+	right-handed parallel beta-helix repeat-containing protein	NA	A0A0K2FI18	Enterobacter_phage	32.3	2.3e-34
WP_062955010.1|1443991_1444396_+	hypothetical protein	NA	T1SA79	Salmonella_phage	81.1	8.7e-54
WP_023339240.1|1444382_1444688_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	81.4	2.7e-39
WP_062955009.1|1444677_1445307_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	76.9	1.8e-90
WP_062955008.1|1445303_1445804_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	76.9	1.3e-59
WP_004152009.1|1445990_1447859_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
>prophage 4
NZ_CP026585	Klebsiella pneumoniae strain WCHKP649 chromosome, complete genome	5461116	1780210	1787115	5461116	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_072353998.1|1780210_1781074_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	7.4e-10
WP_004180550.1|1781084_1781858_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_002912636.1|1782098_1782992_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|1783237_1784599_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|1784917_1785640_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_072353997.1|1785636_1787115_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.9e-29
>prophage 5
NZ_CP026585	Klebsiella pneumoniae strain WCHKP649 chromosome, complete genome	5461116	1830460	1842135	5461116	transposase	Escherichia_phage(33.33%)	10	NA	NA
WP_000043543.1|1830460_1831867_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
WP_004180506.1|1832093_1833509_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.0	1.4e-53
WP_039819506.1|1833530_1834901_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	25.9	6.4e-32
WP_039819536.1|1835055_1836120_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	9.8e-105
WP_023278825.1|1836133_1837003_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	1.7e-110
WP_004175259.1|1837034_1837925_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	2.8e-28
WP_039819508.1|1837939_1838494_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	2.9e-52
WP_072353991.1|1838673_1839840_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	9.1e-112
WP_072353990.1|1840202_1841114_+	acyltransferase	NA	NA	NA	NA	NA
WP_000019473.1|1841154_1842135_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
>prophage 6
NZ_CP026585	Klebsiella pneumoniae strain WCHKP649 chromosome, complete genome	5461116	2835473	2846360	5461116		Escherichia_phage(87.5%)	9	NA	NA
WP_004151613.1|2835473_2838581_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004151612.1|2838635_2839901_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|2839931_2841020_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_002904006.1|2841106_2841367_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_004176269.1|2841664_2842525_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|2842545_2843307_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004151610.1|2843567_2844470_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_004151609.1|2844481_2845747_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_002210516.1|2845739_2846360_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 7
NZ_CP026585	Klebsiella pneumoniae strain WCHKP649 chromosome, complete genome	5461116	3063993	3102459	5461116	terminase,integrase	uncultured_Caudovirales_phage(34.04%)	56	3093572:3093586	3099581:3099595
WP_004152576.1|3063993_3064860_-	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
WP_004152575.1|3064859_3065633_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152574.1|3065629_3066826_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152573.1|3066825_3067179_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152572.1|3067180_3067834_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152571.1|3067887_3068454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004173705.1|3068490_3068676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152570.1|3068728_3069070_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004152569.1|3069069_3070092_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004152568.1|3070094_3070397_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	55.2	2.0e-26
WP_004152567.1|3070397_3070997_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_004152566.1|3070996_3073000_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152565.1|3072989_3073142_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152564.1|3073177_3073603_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_004199809.1|3073606_3074047_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.1	3.3e-62
WP_004152177.1|3074057_3075203_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004152176.1|3075206_3075647_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_001116156.1|3075741_3076128_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_000834982.1|3076127_3076634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|3076630_3077050_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000725700.1|3077018_3077300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132269.1|3077339_3078281_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000528476.1|3078292_3078787_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_004199270.1|3078790_3079993_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_004152174.1|3080044_3080593_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004152173.1|3080648_3082100_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152172.1|3082337_3083738_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004152171.1|3083688_3084441_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	66.0	4.0e-12
WP_004152170.1|3084542_3084863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153952.1|3085097_3085487_-	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152169.1|3085483_3086014_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004146526.1|3086016_3086265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152167.1|3086670_3087453_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004198239.1|3087449_3087926_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004198233.1|3087922_3088885_-	zinc-binding domain of primase-helicase family protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198228.1|3088886_3090545_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004152163.1|3090853_3091147_-	hypothetical protein	NA	A0A286S2B5	Klebsiella_phage	97.6	2.8e-38
WP_004152162.1|3091121_3091343_-	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004152161.1|3091440_3092109_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152160.1|3092279_3092594_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152159.1|3092586_3092775_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152158.1|3092944_3093310_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152157.1|3093302_3093557_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
3093572:3093586	attL	AGGCGCTGCAGGTCC	NA	NA	NA	NA
WP_004152156.1|3093743_3094169_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004152155.1|3094165_3094360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152154.1|3094356_3095184_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152153.1|3095288_3095807_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
WP_004154298.1|3095812_3096523_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152151.1|3096512_3096737_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004152150.1|3096733_3096946_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_004152149.1|3096942_3097422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152148.1|3097600_3097843_+	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004152147.1|3097823_3099005_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_016197745.1|3099201_3099750_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
3099581:3099595	attR	GGACCTGCAGCGCCT	NA	NA	NA	NA
WP_004152145.1|3099948_3101481_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_004152144.1|3101697_3102459_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
>prophage 8
NZ_CP026585	Klebsiella pneumoniae strain WCHKP649 chromosome, complete genome	5461116	3265540	3353419	5461116	capsid,terminase,portal,tail,tRNA,lysis,head,integrase	Klebsiella_phage(45.45%)	96	3292343:3292357	3351230:3351244
WP_002901088.1|3265540_3266041_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_002901080.1|3266157_3266604_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_002901073.1|3266587_3267379_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004150777.1|3267480_3268665_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004140471.1|3268696_3269389_-	CTP synthase	NA	NA	NA	NA	NA
WP_004150778.1|3269534_3270044_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004150779.1|3270030_3270387_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_004150780.1|3270376_3270616_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_004150781.1|3270916_3271930_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.4e-12
WP_004150782.1|3271987_3272089_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_099119317.1|3272088_3272163_+	protein YoaJ	NA	NA	NA	NA	NA
WP_004140488.1|3272280_3272406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140489.1|3272465_3272729_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004150783.1|3272859_3273498_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004148038.1|3273587_3274502_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
WP_020956815.1|3274717_3274909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150784.1|3275163_3276207_-	type II asparaginase	NA	NA	NA	NA	NA
WP_004150785.1|3276509_3277718_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_004150787.1|3277791_3279576_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
WP_004150788.1|3279582_3280473_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004140497.1|3280593_3282102_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_004150790.1|3282412_3283099_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004140501.1|3283496_3283676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150791.1|3283715_3284348_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_004140506.1|3284914_3285112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140509.1|3285227_3286238_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_004150793.1|3286234_3287641_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004140512.1|3287696_3288584_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_004140514.1|3288600_3289107_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004150794.1|3289133_3289628_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004150795.1|3289718_3289904_-	general stress protein	NA	NA	NA	NA	NA
WP_004140529.1|3290525_3291719_+	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004140530.1|3291831_3292059_+	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
3292343:3292357	attL	TGGCTGGCGTTCTTT	NA	NA	NA	NA
WP_004150797.1|3292495_3292819_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_004150798.1|3292811_3293204_+	amino acid-binding protein	NA	NA	NA	NA	NA
WP_004150799.1|3293200_3293914_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004892953.1|3294186_3294339_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
WP_023328083.1|3294493_3295990_-|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	63.7	1.4e-125
WP_062955111.1|3296058_3308763_-	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	47.1	0.0e+00
WP_023328085.1|3308825_3309419_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	76.6	8.0e-80
WP_047666390.1|3309445_3309868_-	hypothetical protein	NA	J9Q806	Salmonella_phage	50.0	5.9e-29
WP_047666389.1|3309909_3310620_-	peptidase P60	NA	Q6UAW4	Klebsiella_phage	90.3	1.9e-136
WP_023328087.1|3310621_3311377_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.5	4.6e-125
WP_023328088.1|3311373_3311712_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	88.4	1.4e-57
WP_023328089.1|3311711_3315047_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	88.3	0.0e+00
WP_071836352.1|3315046_3315265_-	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	90.5	5.4e-34
WP_014228914.1|3315279_3315645_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
WP_023328090.1|3315702_3316164_-	hypothetical protein	NA	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
WP_023328091.1|3316195_3316597_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	94.0	2.3e-62
WP_017880258.1|3316593_3316983_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	86.0	9.6e-58
WP_023328092.1|3316963_3317302_-|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	90.2	2.8e-53
WP_020317538.1|3317298_3317616_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	1.5e-45
WP_049010370.1|3317596_3317857_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	60.5	7.4e-22
WP_023328094.1|3317915_3319202_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.0	9.8e-216
WP_014907815.1|3319279_3320200_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	88.2	9.6e-149
WP_023279520.1|3320236_3321496_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	89.8	1.8e-222
WP_017898992.1|3321495_3321675_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	57.6	3.1e-11
WP_021462603.1|3321668_3323390_-|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.4	1.5e-190
WP_012542168.1|3323389_3323824_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
WP_014907818.1|3324072_3324504_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	61.6	1.8e-41
WP_023297386.1|3324500_3324824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032428746.1|3324775_3325138_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	83.3	1.2e-57
WP_032749552.1|3325464_3325689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049115059.1|3325727_3326165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016160650.1|3327114_3327465_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	38.1	7.9e-11
WP_032432826.1|3327461_3327959_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	84.6	1.1e-77
WP_016160648.1|3327958_3328174_-|lysis	phage S lysis protein	lysis	A5LH82	Enterobacteria_phage	88.7	2.7e-30
WP_025861432.1|3330425_3331028_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	68.6	1.1e-76
WP_062955112.1|3331044_3332076_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.6	4.7e-96
WP_017898980.1|3332075_3332279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025861428.1|3332275_3332668_-	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	36.6	8.0e-12
WP_077255782.1|3332708_3332999_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	56.9	8.0e-17
WP_025368263.1|3333010_3333244_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	71.1	3.7e-25
WP_004152765.1|3333322_3334807_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_009483812.1|3334806_3335058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062954975.1|3335647_3337009_-	deoxyguanosinetriphosphate triphosphohydrolase family protein	NA	NA	NA	NA	NA
WP_062954976.1|3337182_3337896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062954989.1|3338247_3339117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062954977.1|3339205_3340597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032443841.1|3340945_3341386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047667474.1|3341399_3341864_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	72.2	4.1e-63
WP_077265602.1|3341856_3342861_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	40.0	1.0e-31
WP_046622349.1|3342920_3343475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071561166.1|3343477_3343702_-	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	62.5	1.3e-19
WP_077257742.1|3343790_3344228_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	62.2	1.3e-39
WP_040234937.1|3344549_3344864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099143961.1|3345026_3345245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023279538.1|3345254_3345449_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_014228879.1|3345491_3345836_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_062954978.1|3345977_3348116_+	exodeoxyribonuclease VIII	NA	S4TNL0	Salmonella_phage	42.7	5.6e-99
WP_012542206.1|3348168_3348414_+	excisionase	NA	NA	NA	NA	NA
WP_032418030.1|3348394_3349522_+|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	58.4	4.4e-119
WP_004150800.1|3349639_3350890_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_004150801.1|3351130_3351781_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
3351230:3351244	attR	AAAGAACGCCAGCCA	NA	NA	NA	NA
WP_004150802.1|3351797_3352256_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004150803.1|3352312_3353419_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP026585	Klebsiella pneumoniae strain WCHKP649 chromosome, complete genome	5461116	3462994	3519153	5461116	capsid,terminase,portal,tail,protease,plate,head,integrase	Enterobacteria_phage(40.0%)	62	3461154:3461174	3495678:3495698
3461154:3461174	attL	AACCCGGAGTGCTCCGGGTTT	NA	NA	NA	NA
WP_077273873.1|3462994_3464149_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	77.2	6.6e-171
WP_072353964.1|3464300_3465482_+|tail	phage tail protein	tail	A0A0A7NV69	Enterobacteria_phage	69.4	8.0e-156
WP_004187274.1|3465482_3465998_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	70.0	2.6e-63
WP_072353963.1|3466049_3466349_+|tail	phage tail protein	tail	B9A7B2	Serratia_phage	72.7	2.9e-30
WP_050554917.1|3466369_3466522_+|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	71.4	1.5e-11
WP_072353962.1|3466511_3469247_+|tail	phage tail tape measure protein	tail	B9A7B3	Serratia_phage	80.6	2.0e-242
WP_072353961.1|3469258_3469747_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	59.9	2.9e-51
WP_072353960.1|3469844_3470921_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	48.3	2.3e-32
WP_064144972.1|3470932_3471676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072353959.1|3471681_3473946_-	hypothetical protein	NA	B5TAB2	Burkholderia_phage	39.7	5.7e-102
WP_072353958.1|3473947_3474550_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	44.8	1.8e-42
WP_040209819.1|3474542_3475442_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	62.2	6.2e-92
WP_004187254.1|3475428_3475797_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	57.4	2.3e-29
WP_072353957.1|3475793_3476378_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	61.4	8.7e-63
WP_072353956.1|3476377_3477019_-	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	49.8	1.4e-45
WP_004187249.1|3477015_3477474_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	46.8	3.1e-31
WP_072353969.1|3477470_3477734_-	peptidase	NA	NA	NA	NA	NA
WP_072353955.1|3478010_3478562_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	42.5	6.8e-33
WP_004187237.1|3478558_3478840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187236.1|3478830_3479031_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	64.6	3.0e-15
WP_032705909.1|3479030_3479528_-|head	head completion/stabilization protein	head	B9A7B7	Serratia_phage	69.7	2.2e-59
WP_072353954.1|3479630_3480491_-|terminase	terminase	terminase	B9A7B6	Serratia_phage	68.4	1.0e-83
WP_060528036.1|3480537_3481587_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	53.9	2.3e-106
WP_072353953.1|3481610_3482444_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	65.3	6.5e-96
WP_060528038.1|3482604_3484326_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	66.5	4.3e-227
WP_077273872.1|3484346_3485381_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.6	2.0e-139
WP_072353968.1|3485788_3486103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072353951.1|3486375_3486783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072353950.1|3486954_3489549_-	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	51.7	1.1e-192
WP_072353949.1|3489541_3490558_-	DNA cytosine methyltransferase	NA	Q6J1P4	Burkholderia_virus	54.8	2.4e-92
WP_072353948.1|3490859_3491828_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	49.1	3.1e-73
WP_046624144.1|3491836_3492415_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	39.5	2.7e-32
WP_046624145.1|3492411_3492636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187204.1|3492703_3492976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187203.1|3492991_3493378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071561575.1|3493394_3493592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023328159.1|3493783_3494116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004201485.1|3494210_3494513_+	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	61.0	2.6e-26
WP_072353947.1|3494600_3495608_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	52.1	7.6e-99
WP_002898698.1|3495704_3496952_-	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
3495678:3495698	attR	AACCCGGAGTGCTCCGGGTTT	NA	NA	NA	NA
WP_002898606.1|3497104_3497554_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004150831.1|3497669_3498458_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002898602.1|3498478_3498700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002898600.1|3498956_3499079_+	small membrane protein	NA	NA	NA	NA	NA
WP_002898598.1|3499197_3500589_-	APC family permease	NA	NA	NA	NA	NA
WP_004199537.1|3500578_3500770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002898595.1|3500942_3502364_-	glutamine synthetase	NA	NA	NA	NA	NA
WP_002898593.1|3502577_3503342_+	gamma-glutamyl-gamma-aminobutyrate hydrolase	NA	NA	NA	NA	NA
WP_002898590.1|3503367_3503925_+	HTH-type transcriptional regulator PuuR	NA	NA	NA	NA	NA
WP_004150832.1|3504245_3505733_+	aldehyde dehydrogenase PuuC	NA	NA	NA	NA	NA
WP_062954981.1|3505735_3507016_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_002898582.1|3507012_3507954_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002898577.1|3508057_3509143_+	tartrate dehydrogenase	NA	NA	NA	NA	NA
WP_002898574.1|3509647_3511255_+	BCCT family transporter	NA	NA	NA	NA	NA
WP_002898571.1|3511291_3512416_+	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_004150833.1|3512434_3513883_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_002898475.1|3513940_3514906_+	oxidoreductase	NA	NA	NA	NA	NA
WP_002898472.1|3515075_3515264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004176625.1|3515328_3515616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002898466.1|3515594_3516215_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004150834.1|3516571_3518224_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002898458.1|3518493_3519153_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	46.6	3.2e-37
>prophage 10
NZ_CP026585	Klebsiella pneumoniae strain WCHKP649 chromosome, complete genome	5461116	3603922	3699983	5461116	capsid,terminase,portal,tail,tRNA,protease,transposase,plate,lysis,head,integrase	Salmonella_phage(55.0%)	101	3659448:3659466	3700058:3700076
WP_002898139.1|3603922_3605215_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_002898137.1|3605305_3606649_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
WP_002898132.1|3606657_3607269_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_004150846.1|3607391_3611645_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
WP_000228469.1|3611780_3612275_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_002898019.1|3612807_3613776_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.2e-62
WP_002898017.1|3613890_3615657_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
WP_004150847.1|3615657_3617379_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|3617423_3618125_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3618478_3618697_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3618817_3621097_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3621127_3621445_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3621770_3621992_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_071528213.1|3621946_3622129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150848.1|3622068_3624009_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3624005_3625121_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_002896437.1|3625267_3626926_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896434.1|3627345_3628041_+	aquaporin Z	NA	NA	NA	NA	NA
WP_004147773.1|3628156_3629056_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_002896412.1|3629199_3630852_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_002896410.1|3630862_3631831_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_085666582.1|3631781_3631985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896408.1|3632042_3632477_-	DoxX family protein	NA	NA	NA	NA	NA
WP_002896406.1|3632628_3634347_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_002896404.1|3634385_3635387_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_002896401.1|3635397_3636840_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002896399.1|3636927_3637941_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002896397.1|3637937_3638768_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_004150851.1|3638799_3639939_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_004147767.1|3639991_3640171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896394.1|3640816_3641332_+	lipoprotein	NA	NA	NA	NA	NA
WP_032419144.1|3641558_3642287_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896390.1|3642307_3643039_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896386.1|3643045_3643762_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004150852.1|3643761_3644430_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_002896384.1|3644613_3645345_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896382.1|3645387_3646860_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896380.1|3646856_3647573_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896378.1|3647651_3648779_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896376.1|3648820_3649309_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896372.1|3649366_3650212_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896371.1|3650208_3651162_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896370.1|3651172_3652306_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_002896368.1|3652469_3653582_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|3653930_3654410_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896363.1|3654498_3655401_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896354.1|3656222_3656510_-	YbjC family protein	NA	NA	NA	NA	NA
WP_002896352.1|3656712_3656976_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896351.1|3656982_3657366_-	membrane protein	NA	NA	NA	NA	NA
WP_004179131.1|3657632_3659318_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
3659448:3659466	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
WP_000972391.1|3659537_3659756_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_002896225.1|3659847_3660948_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_002896224.1|3660944_3661430_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_002896222.1|3661426_3664054_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
WP_002896220.1|3664046_3664166_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896204.1|3664180_3664480_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896201.1|3664532_3665048_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896193.1|3665057_3666230_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896191.1|3666368_3667445_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896188.1|3667474_3667678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896186.1|3667674_3668406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152882.1|3668409_3671361_-	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
WP_004150856.1|3671362_3671962_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_002896182.1|3671954_3672863_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_032441567.1|3672849_3673212_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	83.9	4.9e-48
WP_002896177.1|3673208_3673781_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_072354028.1|3673964_3674102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019445.1|3674140_3675121_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_004199112.1|3675258_3675768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896175.1|3675764_3676211_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_002896172.1|3676203_3676635_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896168.1|3676730_3677159_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896163.1|3677155_3677539_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896161.1|3677543_3678053_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896158.1|3678033_3678249_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896155.1|3678252_3678456_-|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896151.1|3678455_3678920_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_000059191.1|3679015_3679666_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002895972.1|3679669_3680728_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_002895967.1|3680744_3681578_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_004150858.1|3681720_3683487_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895959.1|3683486_3684512_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004199124.1|3684573_3686316_-	AIPR family protein	NA	NA	NA	NA	NA
WP_000700647.1|3686591_3687269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001316229.1|3687383_3687689_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|3687627_3687816_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_004152765.1|3687916_3689401_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_009483812.1|3689400_3689652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150862.1|3689879_3692294_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_004150863.1|3692290_3693148_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_000752622.1|3693144_3693372_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150864.1|3693371_3693605_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000963473.1|3693672_3694014_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_000956179.1|3693977_3694178_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000460893.1|3694185_3694695_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000188448.1|3694727_3694949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152885.1|3695094_3695973_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
WP_004150866.1|3695984_3696929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152765.1|3697027_3698512_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_009483812.1|3698511_3698763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151720.1|3698930_3699983_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.0e-106
3700058:3700076	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 11
NZ_CP026585	Klebsiella pneumoniae strain WCHKP649 chromosome, complete genome	5461116	4351766	4363419	5461116	integrase	Enterobacteria_phage(70.0%)	13	4352216:4352230	4375272:4375286
WP_004144574.1|4351766_4352870_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
4352216:4352230	attL	CAATCTCTCCGCGCT	NA	NA	NA	NA
WP_002889940.1|4352880_4354134_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_002889938.1|4354486_4355677_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_004152029.1|4355664_4356615_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_004152979.1|4356614_4357040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152202.1|4357607_4358174_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
WP_004152203.1|4358191_4358437_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_062956184.1|4358433_4359171_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.9e-70
WP_002889915.1|4359712_4359979_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_024940872.1|4359975_4360533_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889911.1|4360529_4360757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889897.1|4360753_4361074_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889890.1|4361085_4363419_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
4375272:4375286	attR	CAATCTCTCCGCGCT	NA	NA	NA	NA
>prophage 12
NZ_CP026585	Klebsiella pneumoniae strain WCHKP649 chromosome, complete genome	5461116	4831656	4841181	5461116	transposase	Enterobacteria_phage(83.33%)	10	NA	NA
WP_004152207.1|4831656_4833990_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
WP_004152206.1|4834004_4834325_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_004152205.1|4834321_4834549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153681.1|4834545_4835094_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
WP_004152204.1|4835917_4836655_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
WP_004152203.1|4836651_4836897_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_004152202.1|4836914_4837481_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
WP_004152201.1|4838221_4839301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152200.1|4839301_4839838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019445.1|4840200_4841181_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
>prophage 1
NZ_CP026584	Klebsiella pneumoniae strain WCHKP649 plasmid pKPC2_095649, complete sequence	156099	1796	21170	156099	protease,transposase	Escherichia_phage(50.0%)	17	NA	NA
WP_000616807.1|1796_2450_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_012602143.1|2669_3134_+	Plasmid stable inheritance protein	NA	NA	NA	NA	NA
WP_012602142.1|3130_3235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|4444_5149_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004199234.1|6417_7299_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_013213985.1|7574_8555_-|transposase	IS481-like element ISKpn27 family transposase	transposase	A8RHK4	Spiroplasma_virus	27.4	2.9e-10
WP_014343468.1|8677_9151_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	99.3	3.3e-76
WP_001067855.1|9190_9895_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_013188475.1|10405_11281_+	class A extended-spectrum beta-lactamase CTX-M-65	NA	A0A1B0VBP7	Salmonella_phage	98.9	6.8e-152
WP_012579081.1|11360_12284_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	2.2e-177
WP_001067855.1|14034_14739_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|15849_16554_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000957857.1|17231_17420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064441864.1|17511_18048_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	2.8e-84
WP_000027057.1|18230_19091_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_012372818.1|19260_20016_+	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtB1	NA	NA	NA	NA	NA
WP_001067858.1|20465_21170_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
>prophage 2
NZ_CP026584	Klebsiella pneumoniae strain WCHKP649 plasmid pKPC2_095649, complete sequence	156099	85132	98938	156099	transposase	Enterobacteria_phage(18.18%)	18	NA	NA
WP_032072906.1|85132_85393_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	46.2	4.1e-12
WP_015493073.1|85579_85771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015493074.1|85813_86320_-	antirestriction protein ArdA	NA	A0A1I9S7Y0	Rhodococcus_phage	31.8	4.8e-09
WP_015493075.1|86724_87504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015493076.1|87557_87977_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_015493077.1|87987_88209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211749.1|88208_88886_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	1.6e-28
WP_015493079.1|89244_89916_+	Gifsy-2 prophage protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.7	5.1e-83
WP_015493080.1|90095_90518_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.5	3.1e-30
WP_015493081.1|90517_91789_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.0	6.1e-154
WP_016479949.1|91924_92896_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	68.9	1.4e-113
WP_015493083.1|92892_94098_-	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	89.2	1.1e-205
WP_022652286.1|94460_95093_+	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	31.9	2.5e-07
WP_040219232.1|95146_95347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015493085.1|95493_96444_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	55.6	6.6e-76
WP_015493086.1|96440_97052_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_015493087.1|97048_97444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019445.1|97957_98938_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
>prophage 3
NZ_CP026584	Klebsiella pneumoniae strain WCHKP649 plasmid pKPC2_095649, complete sequence	156099	124774	135933	156099		Escherichia_phage(50.0%)	11	NA	NA
WP_001568041.1|124774_125476_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.2	1.6e-26
WP_001568040.1|125912_126143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013214012.1|126205_126877_-	mediator of plasmid stability	NA	NA	NA	NA	NA
WP_004152353.1|126879_127851_-	mediator of plasmid stability	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_004152765.1|128099_129584_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_009483812.1|129583_129835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568036.1|129993_130425_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
WP_013214011.1|130424_131696_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	7.5e-152
WP_086523286.1|131777_132755_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	53.8	1.4e-86
WP_011977818.1|132751_133957_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	5.3e-163
WP_004118283.1|135066_135933_-	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
