The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	0	15160	4718719		Bacillus_phage(100.0%)	13	NA	NA
WP_000344789.1|3322_3697_+	Hha toxicity modulator TomB	NA	NA	NA	NA	NA
WP_001291435.1|3722_3941_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_000102564.1|4112_4664_+	maltose O-acetyltransferase	NA	NA	NA	NA	NA
WP_000136192.1|4779_5250_+	YlaC family protein	NA	NA	NA	NA	NA
WP_001310610.1|5413_6964_+	cyclic-guanylate-specific phosphodiesterase PdeB	NA	NA	NA	NA	NA
WP_000878143.1|7005_7359_-	DUF1428 domain-containing protein	NA	NA	NA	NA	NA
WP_000409911.1|7737_8049_+	MGMT family protein	NA	NA	NA	NA	NA
WP_000779831.1|8079_8652_-	YbaY family lipoprotein	NA	NA	NA	NA	NA
WP_000075876.1|8869_9730_+	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
WP_000685029.1|9778_11065_-	ammonium transporter AmtB	NA	NA	NA	NA	NA
WP_000780338.1|11094_11433_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_001256192.1|11613_13395_-	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	3.1e-42
WP_001235622.1|13387_15160_-	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	2.6e-49
>prophage 2
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	18483	19179	4718719		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817229.1|18483_19179_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
>prophage 3
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	22307	27354	4718719	protease	Bacillus_phage(25.0%)	4	NA	NA
WP_001043542.1|22307_22580_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
WP_001295325.1|22788_25143_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_000130305.1|25330_26605_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_000122253.1|26730_27354_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 4
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	48913	57894	4718719	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_001021161.1|48913_49384_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
WP_001150457.1|49472_50576_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.8	2.8e-54
WP_000543535.1|50579_51029_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001326929.1|51179_51719_+	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_001295328.1|52017_52902_+	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_000974813.1|53078_53426_-	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_000046637.1|53554_54526_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000934822.1|54536_56384_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000007629.1|56411_56744_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000667319.1|56766_57894_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
>prophage 5
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	64846	74923	4718719		Bacillus_phage(60.0%)	7	NA	NA
WP_000893623.1|64846_66142_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.7e-26
WP_000113933.1|66199_66889_-	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_001221319.1|67078_68281_+	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_000698951.1|68277_71424_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001393815.1|71549_72734_+	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_001219309.1|72978_73887_-	fructokinase	NA	NA	NA	NA	NA
WP_001298537.1|74011_74923_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
>prophage 6
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	79212	80328	4718719		Bacillus_phage(100.0%)	1	NA	NA
WP_000484048.1|79212_80328_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
>prophage 7
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	87743	88901	4718719		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830738.1|87743_88901_+	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	3.9e-06
>prophage 8
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	95851	96619	4718719		Planktothrix_phage(100.0%)	1	NA	NA
WP_000939399.1|95851_96619_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.3	1.1e-25
>prophage 9
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	101917	103027	4718719		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000842102.1|101917_103027_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
>prophage 10
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	106408	108369	4718719		Micromonas_sp._RCC1109_virus(50.0%)	2	NA	NA
WP_001013494.1|106408_107422_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	9.2e-44
WP_001704831.1|107418_108369_-	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	34.9	3.3e-35
>prophage 11
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	113779	118059	4718719		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000805902.1|113779_114862_+	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	100.0	7.5e-193
WP_000177905.1|114984_118059_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	99.9	0.0e+00
>prophage 12
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	122599	123499	4718719		Lactobacillus_phage(100.0%)	1	NA	NA
WP_000952503.1|122599_123499_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	4.2e-16
>prophage 13
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	126603	128490	4718719		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000010300.1|126603_128490_-	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	7.0e-53
>prophage 14
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	138518	139535	4718719	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_001310555.1|138518_139535_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
>prophage 15
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	155155	160181	4718719		Acinetobacter_phage(50.0%)	5	NA	NA
WP_072327836.1|155155_157354_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.7	1.9e-38
WP_000121346.1|157363_158320_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111348.1|158298_158709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000617439.1|159193_159481_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_023155323.1|159740_160181_+	hypothetical protein	NA	A0A1W6JPI4	Morganella_phage	68.2	1.8e-44
>prophage 16
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	163466	180542	4718719	integrase	Enterobacteria_phage(25.0%)	18	161665:161724	185315:186082
161665:161724	attL	GGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGC	NA	NA	NA	NA
WP_032328363.1|163466_165572_-	hypothetical protein	NA	A0A2I7QQN9	Vibrio_phage	37.1	4.2e-91
WP_054473707.1|165571_167038_-	phage DNA ejection protein	NA	B6SCW4	Bacteriophage	53.3	2.9e-107
WP_001018522.1|167042_167216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032235469.1|167396_167855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032328654.1|168087_170844_-	TOPRIM and DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.1	8.9e-299
WP_032328337.1|170856_171459_-	hypothetical protein	NA	Q8W653	Enterobacteria_phage	34.7	1.2e-22
WP_000181940.1|171451_171673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024673.1|171669_171933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001065738.1|171929_172124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077891199.1|172116_173184_-	ash family protein	NA	A0A1C9IHV9	Salmonella_phage	37.3	5.2e-13
WP_000476150.1|173177_173360_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_072327840.1|173352_174186_-	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	48.3	1.8e-21
WP_000412538.1|174198_174630_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.0	3.9e-28
WP_000035054.1|174629_174833_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	50.9	4.7e-08
WP_000772646.1|175260_176475_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.2	2.2e-132
WP_000893277.1|176830_178084_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	9.8e-96
WP_001285288.1|178095_179199_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749863.1|179486_180542_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
185315:186082	attR	GGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGCTTCTGTTTCTATCAGCTGTCCCTCCTGTTCAGCTACTGACGGGGTGGTGCGTAACGGCAAAAGCACCGCCGGACATCAGCGCTATCTCTGCTCTCACTGCCGTAAAACATGGCAACTGCAGTTCACTTACACCGCTTCTCAACCCGGTACGCACCAGAAAATCATTGATATGGCCATGAATGGCGTTGGATGCCGGGCAACTGCCCGCATTATGGGCGTTGGCCTCAACACGGTTTTACGTCACTTAAAAAACTCAGGCCGCAGTCGGTAACCTCGCGCATACAACCGGGCAGTGATGTGATTGTCTGCGCGGAAATGGACGAACAGTGGGGCTACGTCGGTGCTAAATCACGTCAGCGCTGGCTGTTTTACGCGTATGACAGGATACGGAGGACAGTTGTGGCGCACGTTTTCGGTGAACGCACTCTGGCCACACTGGCGCGTCTTCTGAGCCTGCTGTCGGCCTTTGAGGTCGTGGTATGGATGACGGATGGCTGGCCGCTGTATGAATCACGCCTGAAGGGAAAGCTGCACGTTATCAGCAAGCGTTACACTCAGCGCATTGAGCGACATAATCTGAATCTGAGACAACATCTGGCAAGGCTGGGACGGAAGTCACTGTCGTTCTCAAAATCGGTGGAGCTGCATGACAAGGTCATCGGGCATTATCTGAACATAAAACACTATCAGTAAGTTGGAGTCACTACC	NA	NA	NA	NA
>prophage 17
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	210441	213399	4718719		Catovirus(50.0%)	2	NA	NA
WP_001143106.1|210441_212886_+	glycosyltransferase	NA	A0A1V0SAN7	Catovirus	43.2	7.2e-34
WP_000859525.1|213003_213399_-	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	50.7	6.6e-30
>prophage 18
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	227376	231285	4718719		Clostridioides_phage(50.0%)	5	NA	NA
WP_001355630.1|227376_228150_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.5	9.3e-20
WP_000729704.1|228335_228596_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_001225679.1|229022_229763_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333380.1|229733_230501_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001355631.1|230706_231285_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.9e-14
>prophage 19
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	248241	255873	4718719		Bradyrhizobium_phage(25.0%)	8	NA	NA
WP_001340895.1|248241_248973_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	4.5e-40
WP_000917883.1|249037_249505_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001326702.1|249501_250224_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052709.1|250257_251013_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|251084_252443_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001230983.1|253117_253918_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648571.1|254158_255073_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997010.1|255069_255873_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
>prophage 20
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	262394	263426	4718719		Planktothrix_phage(100.0%)	1	NA	NA
WP_000594006.1|262394_263426_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.7	9.4e-36
>prophage 21
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	276431	280547	4718719		Saccharomonospora_phage(50.0%)	2	NA	NA
WP_001294774.1|276431_279914_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000569420.1|279950_280547_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	6.7e-26
>prophage 22
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	289375	290134	4718719		Flavobacterium_phage(100.0%)	1	NA	NA
WP_001295562.1|289375_290134_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 23
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	301983	303408	4718719	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753946.1|301983_303408_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 24
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	307337	307682	4718719		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|307337_307682_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 25
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	313716	314514	4718719		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158929.1|313716_314514_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
>prophage 26
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	319655	326461	4718719	tRNA	Niemeyer_virus(50.0%)	6	NA	NA
WP_001355667.1|319655_322085_-	ATP-dependent helicase HrpB	NA	A0A0U2UIE6	Niemeyer_virus	30.3	2.5e-39
WP_001294687.1|322158_322689_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_000396037.1|322703_323408_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001155227.1|323585_324041_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_001396418.1|324107_325004_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_000174643.1|325042_326461_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
>prophage 27
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	336631	337564	4718719	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000339914.1|336631_337564_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	49.8	8.4e-60
>prophage 28
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	340826	347294	4718719		Anomala_cuprea_entomopoxvirus(33.33%)	5	NA	NA
WP_000150637.1|340826_341753_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
WP_000651599.1|341861_342524_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000683335.1|342564_343101_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_001393627.1|343306_345697_+	quinoprotein glucose dehydrogenase	NA	NA	NA	NA	NA
WP_001189582.1|345743_347294_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
>prophage 29
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	355039	356464	4718719		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|355039_356464_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 30
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	365100	365652	4718719		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923727.1|365100_365652_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	31.6	1.5e-11
>prophage 31
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	369897	370941	4718719		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217351.1|369897_370941_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	4.8e-104
>prophage 32
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	409556	413271	4718719	transposase	Staphylococcus_phage(50.0%)	3	NA	NA
WP_001254933.1|409556_410708_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000235652.1|410978_412589_+	thiamine/thiamine pyrophosphate ABC transporter permease ThiP	NA	NA	NA	NA	NA
WP_000916323.1|412572_413271_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	37.2	2.8e-23
>prophage 33
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	419603	425026	4718719		Yellowstone_lake_phycodnavirus(50.0%)	2	NA	NA
WP_000035644.1|419603_421955_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.0e-37
WP_001117011.1|422119_425026_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
>prophage 34
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	432770	435524	4718719		Microcystis_phage(50.0%)	5	NA	NA
WP_000257184.1|432770_433619_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH	NA	A0A075BTY6	Microcystis_phage	42.0	1.1e-08
WP_000796359.1|433643_434243_+	DUF4291 domain-containing protein	NA	NA	NA	NA	NA
WP_001248983.1|434278_434746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000998540.1|434844_435024_-	type II toxin-antitoxin system CcdA family antitoxin	NA	NA	NA	NA	NA
WP_000624375.1|435044_435524_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
>prophage 35
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	443419	449091	4718719		Vibrio_phage(50.0%)	4	NA	NA
WP_000787103.1|443419_444934_+	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
WP_000347117.1|444964_446107_+	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000349932.1|446246_447464_+	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_077891200.1|447537_449091_+	crotonobetaine/carnitine-CoA ligase	NA	Q75ZG1	Hepacivirus	25.4	4.7e-31
>prophage 36
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	454560	455709	4718719		Halovirus(100.0%)	1	NA	NA
WP_001355532.1|454560_455709_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	33.5	1.7e-49
>prophage 37
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	460152	462969	4718719	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001286842.1|460152_462969_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	3.5e-77
>prophage 38
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	470010	480428	4718719	transposase	uncultured_Caudovirales_phage(20.0%)	10	NA	NA
WP_000681368.1|470010_471177_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	53.8	9.2e-88
WP_000935262.1|471705_471915_+	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	73.9	8.0e-19
WP_001393886.1|471992_473105_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_001118475.1|473367_474498_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.3	7.9e-28
WP_000516135.1|474586_476503_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_000843568.1|476879_477284_+	DUF2541 family protein	NA	NA	NA	NA	NA
WP_001102383.1|477309_478023_+	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000528538.1|478171_478738_+	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001295414.1|478772_479360_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000130185.1|479474_480428_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
>prophage 39
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	492208	494322	4718719		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_001219614.1|492208_493633_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.4	1.6e-09
WP_001188659.1|493632_494322_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
>prophage 40
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	497554	502909	4718719		Bacillus_phage(33.33%)	3	NA	NA
WP_000409451.1|497554_499492_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000046749.1|499702_501370_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000093810.1|501676_502909_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
>prophage 41
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	509652	510975	4718719		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477811.1|509652_510975_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
>prophage 42
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	516610	519486	4718719		Salmonella_phage(50.0%)	3	NA	NA
WP_000490275.1|516610_516772_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001355597.1|516898_517504_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000175943.1|517896_519486_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
>prophage 43
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	527383	528663	4718719		Salmonella_phage(50.0%)	2	NA	NA
WP_000098818.1|527383_527923_+	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
WP_000799911.1|527925_528663_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
>prophage 44
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	531885	537253	4718719		Tupanvirus(50.0%)	4	NA	NA
WP_000106034.1|531885_532911_-	L-galactonate oxidoreductase	NA	A0A2K9L7I1	Tupanvirus	26.3	2.7e-11
WP_072327851.1|533049_533964_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000410147.1|534178_535540_+	MFS transporter	NA	NA	NA	NA	NA
WP_000919593.1|535588_537253_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.3	3.6e-13
>prophage 45
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	569583	570042	4718719	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_023486887.1|569583_570042_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	46.6	1.4e-12
>prophage 46
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	585289	586750	4718719		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208195.1|585289_586750_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	9.5e-50
>prophage 47
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	598003	599680	4718719		Escherichia_phage(100.0%)	2	NA	NA
WP_000044711.1|598003_598600_-	type 1 fimbria switch DNA invertase FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
WP_000790583.1|599077_599680_-	type 1 fimbria switch DNA invertase FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
>prophage 48
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	603042	604023	4718719		Escherichia_phage(100.0%)	1	NA	NA
WP_000338799.1|603042_604023_+	sialate O-acetylesterase	NA	H6WZJ9	Escherichia_phage	55.0	1.6e-101
>prophage 49
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	607937	629430	4718719	tRNA,integrase,transposase	Enterobacteria_phage(57.14%)	19	604211:604225	635249:635263
604211:604225	attL	ATTATTTCACTGCCA	NA	NA	NA	NA
WP_001355523.1|607937_608642_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	43.1	1.2e-42
WP_000783700.1|609219_611553_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	83.7	0.0e+00
WP_000844963.1|611567_611888_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_032327981.1|611884_612112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000459282.1|612216_612666_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	67.3	1.3e-45
WP_001133040.1|612658_612958_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	70.1	6.9e-32
WP_001355524.1|612950_613505_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	73.0	6.6e-36
WP_024171719.1|613501_613768_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	64.8	4.7e-24
WP_001297096.1|615049_615829_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_001295213.1|615828_616851_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.8	2.5e-198
WP_000984214.1|617078_617321_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	58.0	1.4e-19
WP_000090076.1|617337_617913_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	51.9	2.3e-39
WP_001299662.1|619143_620163_+	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	8.4e-45
WP_001355687.1|620292_621795_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	6.1e-84
WP_001295681.1|621913_622996_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000584114.1|622995_624096_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_000397144.1|624362_625874_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000786399.1|626131_626575_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000416407.1|626574_629430_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
635249:635263	attR	ATTATTTCACTGCCA	NA	NA	NA	NA
>prophage 50
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	638588	644685	4718719		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_000013046.1|638588_639524_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_000148581.1|639536_639998_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000047539.1|640070_640457_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000471866.1|640662_643359_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_001387276.1|643499_643553_-	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_001181324.1|643737_644685_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
>prophage 51
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	648323	651085	4718719		Vibrio_phage(50.0%)	2	NA	NA
WP_000187778.1|648323_650462_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
WP_001106238.1|650620_651085_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.1	1.1e-52
>prophage 52
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	655400	661888	4718719		Klosneuvirus(33.33%)	6	NA	NA
WP_000853753.1|655400_656399_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_000596015.1|656431_657427_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001355584.1|657413_658436_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205790.1|658449_659952_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.1e-11
WP_000265933.1|660091_661048_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055072.1|661357_661888_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
>prophage 53
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	696768	697932	4718719		Ralstonia_phage(100.0%)	1	NA	NA
WP_000943964.1|696768_697932_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	4.9e-81
>prophage 54
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	701864	773964	4718719	tRNA,protease,integrase,transposase	Stx2-converting_phage(16.67%)	63	717682:717699	770663:770680
WP_000076345.1|701864_704306_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	3.8e-67
WP_001177644.1|704344_704770_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|704974_706273_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|706376_706574_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|706655_707660_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|707662_708922_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460360.1|709007_710288_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|710363_710672_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280345.1|710757_711708_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001122513.1|711700_713548_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	2.6e-60
WP_000990333.1|713557_714895_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_000981977.1|714913_715375_-|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_001355561.1|715346_716894_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_001294219.1|716892_718032_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
717682:717699	attL	GAAGAGGATTTCAGCCCG	NA	NA	NA	NA
WP_010723271.1|718014_718068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295188.1|718811_719357_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_000041970.1|719451_720504_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_000934920.1|720600_721569_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_001236847.1|721590_724914_+	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_001300174.1|725063_726566_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_000004770.1|726784_727762_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	1.2e-27
WP_001192973.1|728086_729895_+	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000829498.1|729887_730622_+	fumarate reductase iron-sulfur protein	NA	NA	NA	NA	NA
WP_000208757.1|730632_731028_+	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_000609663.1|731038_731398_+	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_001300820.1|731460_732594_+	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_001238369.1|732682_733216_+	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
WP_000118482.1|733212_733530_-	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_000239596.1|733704_733851_-	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000977757.1|733961_734087_-	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000257278.1|734138_734705_-	elongation factor P	NA	NA	NA	NA	NA
WP_004099820.1|734746_735775_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_001008049.1|736169_737039_+	YjeJ family protein	NA	NA	NA	NA	NA
WP_000558209.1|737231_737585_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_000729117.1|737722_739369_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|739412_739706_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000015821.1|739981_741238_+	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001267448.1|741253_741730_-	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000069437.1|742066_743503_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_000961959.1|743620_744922_+	anaerobic C4-dicarboxylate transporter DcuA	NA	NA	NA	NA	NA
WP_000883400.1|745037_745376_+	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000068922.1|745351_747049_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_001188520.1|747085_747661_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001218741.1|748019_749210_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	53.1	5.8e-122
WP_021517873.1|749644_750688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000281244.1|750830_752504_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_021517875.1|752569_752767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000766272.1|752906_753173_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_032328150.1|754788_755868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032328152.1|755916_756813_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_024183703.1|757236_757974_-	porin family protein	NA	NA	NA	NA	NA
WP_072145249.1|758152_758383_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_032328154.1|761374_762910_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	40.4	9.5e-101
WP_001282653.1|762926_763682_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	43.8	6.2e-45
WP_021552170.1|764624_765749_+	DNA cytosine methyltransferase	NA	A0A191SB20	Nostoc_phage	30.3	4.6e-36
WP_032252217.1|765705_767208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024190829.1|767670_767859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_187653752.1|767999_769228_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	1.9e-176
WP_032327954.1|769631_770276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032252234.1|770275_770566_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001339397.1|771348_772026_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
770663:770680	attR	CGGGCTGAAATCCTCTTC	NA	NA	NA	NA
WP_000624622.1|772025_772373_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381401.1|772392_773964_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.3	1.9e-168
>prophage 55
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	779409	781211	4718719		Enterobacteria_phage(50.0%)	2	NA	NA
WP_032252208.1|779409_780654_-	GIY-YIG nuclease family protein	NA	Q9MC01	Enterobacteria_phage	64.6	4.9e-79
WP_032252206.1|780809_781211_-	hypothetical protein	NA	A0A0R6PI25	Moraxella_phage	49.2	1.5e-05
>prophage 56
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	786085	786562	4718719		Sodalis_phage(100.0%)	1	NA	NA
WP_000258198.1|786085_786562_+	ProQ/FinO family protein	NA	Q2A0A1	Sodalis_phage	41.1	1.3e-08
>prophage 57
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	789690	796614	4718719	transposase	Stx2-converting_phage(60.0%)	6	NA	NA
WP_032328087.1|789690_790341_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.9	2.2e-14
WP_000624622.1|790340_790688_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_072327867.1|790789_792322_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	34.2	7.7e-42
WP_032328013.1|792372_793944_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	60.7	5.8e-170
WP_000778605.1|794434_794965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310555.1|795597_796614_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
>prophage 58
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	801405	803582	4718719		Yersinia_phage(33.33%)	4	NA	NA
WP_001234693.1|801405_802224_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.0	1.6e-46
WP_000206660.1|802315_802801_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.4	1.2e-12
WP_032328266.1|802815_803292_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692295.1|803360_803582_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.1e-10
>prophage 59
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	807244	808489	4718719	integrase	Stenotrophomonas_phage(100.0%)	1	804376:804387	810643:810654
804376:804387	attL	TCAGTTAATAAA	NA	NA	NA	NA
WP_001219071.1|807244_808489_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	43.4	7.8e-85
WP_001219071.1|807244_808489_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	43.4	7.8e-85
810643:810654	attR	TTTATTAACTGA	NA	NA	NA	NA
>prophage 60
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	811584	813392	4718719		Thermus_virus(50.0%)	2	NA	NA
WP_000214245.1|811584_812685_-	DNA cytosine methyltransferase	NA	A7XXH6	Thermus_virus	40.3	9.0e-61
WP_001222997.1|812918_813392_-	DNA mismatch endonuclease Vsr	NA	E5E3X5	Burkholderia_phage	37.1	3.8e-24
>prophage 61
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	818554	818974	4718719		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000208713.1|818554_818974_+	TIR domain-containing protein	NA	A0A2H4J496	uncultured_Caudovirales_phage	33.3	9.2e-06
>prophage 62
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	826746	826980	4718719		Vibrio_phage(100.0%)	1	NA	NA
WP_000614748.1|826746_826980_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	50.0	8.4e-09
>prophage 63
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	834500	837712	4718719	tRNA	Acinetobacter_phage(50.0%)	2	NA	NA
WP_000856829.1|834500_835958_+	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.4	6.8e-48
WP_001295074.1|836194_837712_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
>prophage 64
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	858913	860416	4718719		Burkholderia_virus(100.0%)	1	NA	NA
WP_001298520.1|858913_860416_-	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.2	2.4e-56
>prophage 65
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	865551	866340	4718719		Cedratvirus(100.0%)	1	NA	NA
WP_001193408.1|865551_866340_+	phosphonate ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.1	6.5e-13
>prophage 66
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	871928	873478	4718719		Bacillus_virus(50.0%)	2	NA	NA
WP_001075518.1|871928_872687_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.2	4.7e-16
WP_000611395.1|872797_873478_+	phosphonate C-P lyase system protein PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.1	4.9e-09
>prophage 67
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	884094	886080	4718719		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001355612.1|884094_886080_+	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.3	1.6e-148
>prophage 68
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	891325	893473	4718719		Escherichia_phage(100.0%)	1	NA	NA
WP_077635527.1|891325_893473_+	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	2.4e-33
>prophage 69
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	903208	905167	4718719		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078209.1|903208_905167_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.9e-90
>prophage 70
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	910750	912100	4718719		Moraxella_phage(100.0%)	1	NA	NA
WP_000106882.1|910750_912100_-	guanine/hypoxanthine transporter GhxP	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 71
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	916307	919920	4718719		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000168305.1|916307_916844_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
WP_000357740.1|917097_919920_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
>prophage 72
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	924107	926655	4718719		Yellowstone_lake_mimivirus(50.0%)	2	NA	NA
WP_001147328.1|924107_925187_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
WP_000918363.1|925239_926655_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
>prophage 73
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	932902	933511	4718719		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|932902_933511_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 74
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	942635	943751	4718719		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|942635_943751_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 75
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	963037	966721	4718719		Dickeya_phage(100.0%)	1	NA	NA
WP_000096011.1|963037_966721_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 76
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	982504	984094	4718719		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187559.1|982504_984094_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	2.9e-68
>prophage 77
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	989456	991220	4718719		Bacillus_phage(50.0%)	3	NA	NA
WP_001044513.1|989456_989729_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
WP_000940106.1|989915_990506_-	YjaG family protein	NA	NA	NA	NA	NA
WP_000362388.1|990548_991220_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
>prophage 78
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1000437	1008766	4718719		Vibrio_phage(50.0%)	2	NA	NA
WP_000653944.1|1000437_1004661_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
WP_000263098.1|1004737_1008766_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
>prophage 79
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1012882	1015935	4718719		Tupanvirus(50.0%)	2	NA	NA
WP_000031784.1|1012882_1014067_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000023081.1|1014984_1015935_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
>prophage 80
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1024442	1026287	4718719		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000591359.1|1024442_1026287_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	7.1e-10
>prophage 81
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1043633	1050880	4718719		Serratia_phage(33.33%)	5	NA	NA
WP_000184868.1|1043633_1045931_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
WP_000161265.1|1045981_1046302_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_032328094.1|1046316_1047396_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001185137.1|1047704_1050206_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_000424840.1|1050217_1050880_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
>prophage 82
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1068178	1072681	4718719		Erwinia_phage(50.0%)	5	NA	NA
WP_001293341.1|1068178_1069510_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000139496.1|1069576_1070503_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|1070595_1071081_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|1071165_1071411_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|1071835_1072681_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
>prophage 83
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1084255	1089117	4718719		Feldmannia_irregularis_virus(33.33%)	5	NA	NA
WP_001033722.1|1084255_1084954_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|1084950_1086324_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001270260.1|1086429_1087104_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_001166063.1|1087252_1088236_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_000122641.1|1088496_1089117_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.3	8.4e-64
>prophage 84
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1100010	1103061	4718719		Escherichia_phage(100.0%)	1	NA	NA
WP_077249888.1|1100010_1103061_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 85
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1110378	1113158	4718719		Escherichia_phage(50.0%)	3	NA	NA
WP_000059678.1|1110378_1111164_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
WP_000621647.1|1111197_1112094_-	sulfofructose kinase	NA	NA	NA	NA	NA
WP_000718901.1|1112261_1113158_+	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	90.7	1.3e-60
>prophage 86
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1130265	1132736	4718719		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_000190577.1|1130265_1131315_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
WP_001188777.1|1131326_1132736_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
>prophage 87
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1136850	1139637	4718719		uncultured_virus(100.0%)	1	NA	NA
WP_000250007.1|1136850_1139637_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	2.2e-71
>prophage 88
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1153493	1154108	4718719		Streptococcus_phage(100.0%)	1	NA	NA
WP_001296979.1|1153493_1154108_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 89
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1162989	1166276	4718719		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000109943.1|1162989_1163766_-	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
WP_000459594.1|1163768_1164284_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_001705575.1|1164287_1164557_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000187530.1|1164635_1166276_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	8.2e-42
>prophage 90
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1178808	1180638	4718719		Catovirus(100.0%)	1	NA	NA
WP_001395096.1|1178808_1180638_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	7.4e-84
>prophage 91
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1186356	1190215	4718719		Bacillus_phage(100.0%)	3	NA	NA
WP_000383406.1|1186356_1188519_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
WP_001213584.1|1188602_1189319_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000130691.1|1189318_1190215_-	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
>prophage 92
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1200524	1202180	4718719		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000406041.1|1200524_1202180_+	arylsulfatase AslA	NA	A0A2P0VMN7	Tetraselmis_virus	29.5	1.4e-44
>prophage 93
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1210264	1216408	4718719		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000612043.1|1210264_1211395_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
WP_001145183.1|1211399_1212074_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000676056.1|1212051_1212933_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001226602.1|1212951_1214019_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	3.0e-101
WP_000006621.1|1214018_1215281_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
WP_000866670.1|1215277_1216408_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.8	3.0e-27
>prophage 94
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1220450	1225862	4718719		Indivirus(33.33%)	4	NA	NA
WP_001280776.1|1220450_1220780_-	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
WP_000047499.1|1220910_1222176_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001299253.1|1222309_1223794_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001238884.1|1223840_1225862_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	4.9e-113
>prophage 95
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1234335	1235982	4718719		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012608.1|1234335_1235982_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	1.6e-66
>prophage 96
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1249374	1255227	4718719		Enterobacteria_phage(33.33%)	5	NA	NA
WP_001056273.1|1249374_1250265_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
WP_000211858.1|1250289_1251255_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_000387770.1|1251259_1252765_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.0e-15
WP_001301979.1|1252772_1253192_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000102319.1|1253358_1255227_-	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
>prophage 97
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1258395	1259388	4718719		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845113.1|1258395_1259388_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.9e-50
>prophage 98
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1271342	1278950	4718719		Chrysochromulina_ericina_virus(25.0%)	6	NA	NA
WP_000933736.1|1271342_1272713_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
WP_000334104.1|1272874_1274704_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.4	1.9e-132
WP_000867146.1|1275017_1276058_+	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
WP_000741620.1|1276144_1277104_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_001251991.1|1277103_1277994_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000063125.1|1278176_1278950_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
>prophage 99
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1289937	1291275	4718719		Moraxella_phage(100.0%)	1	NA	NA
WP_000019348.1|1289937_1291275_+	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 100
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1301473	1308842	4718719		Staphylococcus_phage(33.33%)	8	NA	NA
WP_001307474.1|1301473_1301731_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
WP_000239730.1|1301694_1302054_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_000831330.1|1302070_1302211_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_120795392.1|1302440_1302521_-	protein YsdD	NA	NA	NA	NA	NA
WP_004099059.1|1302817_1304221_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_000673464.1|1304225_1305326_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000060112.1|1305325_1306399_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000072067.1|1306427_1308842_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
>prophage 101
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1313548	1314697	4718719		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705001.1|1313548_1314697_+	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 102
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1319124	1319538	4718719		Cyanophage(100.0%)	1	NA	NA
WP_001243437.1|1319124_1319538_+	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 103
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1326455	1390922	4718719	integrase,transposase	Salmonella_phage(13.33%)	54	1349047:1349071	1391219:1391243
WP_149025152.1|1326455_1326665_+	helix-turn-helix domain-containing protein	NA	A0A1B0VCD8	Salmonella_phage	84.1	4.7e-27
WP_149025153.1|1326689_1327664_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1W6JP07	Morganella_phage	95.4	5.7e-168
WP_000703959.1|1327833_1328181_+	YidH family protein	NA	NA	NA	NA	NA
WP_032328467.1|1328170_1328533_+	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000148061.1|1328529_1329027_+	radical SAM protein	NA	NA	NA	NA	NA
WP_000828746.1|1329034_1330219_-	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	8.9e-14
WP_000060506.1|1330498_1330588_-	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_001300753.1|1331152_1331251_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000168475.1|1331356_1333045_+	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	3.2e-57
WP_001254933.1|1333385_1334537_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000633668.1|1334637_1335228_+	transcriptional regulator UhpA	NA	NA	NA	NA	NA
WP_001295243.1|1335227_1336730_+	signal transduction histidine-protein kinase/phosphatase UhpB	NA	NA	NA	NA	NA
WP_000936566.1|1336739_1338059_+	MFS transporter family glucose-6-phosphate receptor UhpC	NA	NA	NA	NA	NA
WP_000879194.1|1338196_1339588_+	hexose-6-phosphate:phosphate antiporter	NA	NA	NA	NA	NA
WP_001065718.1|1339633_1341400_-	adenine deaminase	NA	NA	NA	NA	NA
WP_002431302.1|1341574_1342909_+	adenine permease AdeQ	NA	A0A0R6PHV4	Moraxella_phage	36.9	9.6e-65
WP_001355577.1|1342961_1343414_+	DUF1198 domain-containing protein	NA	NA	NA	NA	NA
WP_001288549.1|1343624_1344815_+	purine ribonucleoside efflux pump NepI	NA	NA	NA	NA	NA
WP_000805509.1|1344855_1345149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000779419.1|1345370_1346189_+	lipoprotein NlpA	NA	NA	NA	NA	NA
WP_000535961.1|1346192_1347116_-	DMT family transporter	NA	NA	NA	NA	NA
WP_001172882.1|1347226_1348411_-	sugar efflux transporter	NA	NA	NA	NA	NA
1349047:1349071	attL	TTGGCGGAAGATCACAGGAGTCGAA	NA	NA	NA	NA
WP_000839275.1|1350141_1350339_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000761693.1|1350350_1350839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854743.1|1350835_1351213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285298.1|1351302_1351671_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000086754.1|1351720_1352365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000692295.1|1352383_1352605_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.1e-10
WP_032328266.1|1352673_1353150_-	RadC family protein	NA	NA	NA	NA	NA
WP_000206660.1|1353164_1353650_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.4	1.2e-12
WP_001706654.1|1353741_1354563_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	6.1e-46
WP_000820580.1|1354888_1357735_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_001069707.1|1358106_1358979_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000336763.1|1359088_1359460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531236.1|1359606_1360107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001355567.1|1361595_1362168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001095910.1|1362253_1362460_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001531226.1|1362840_1363632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000453335.1|1364516_1364729_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_001189123.1|1366637_1368146_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_001298267.1|1368970_1369753_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000350273.1|1370058_1370979_+	ribokinase	NA	NA	NA	NA	NA
WP_001682518.1|1371006_1372323_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_000107478.1|1372334_1373348_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_000956749.1|1374929_1375745_-	helix-turn-helix domain-containing protein	NA	D0R0F8	Streptococcus_phage	31.6	3.8e-08
WP_085947916.1|1376691_1377784_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.9e-51
WP_000698190.1|1377944_1378661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000773452.1|1378700_1379213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001201092.1|1379281_1381882_+	TcfC E-set like domain-containing protein	NA	NA	NA	NA	NA
WP_001530297.1|1381896_1382991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085947916.1|1384512_1385606_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.9e-51
WP_001682626.1|1386486_1387305_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000952335.1|1387729_1389124_-|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	97.7	9.9e-222
WP_001683391.1|1389740_1390922_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	69.2	1.1e-160
1391219:1391243	attR	TTGGCGGAAGATCACAGGAGTCGAA	NA	NA	NA	NA
>prophage 104
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1397199	1398591	4718719		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|1397199_1398591_-	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 105
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1403027	1412125	4718719		Bordetella_phage(20.0%)	7	NA	NA
WP_000280488.1|1403027_1405136_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
WP_000135054.1|1405154_1405430_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_001295237.1|1405484_1406108_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_032328007.1|1406365_1408048_+	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.3	1.5e-22
WP_000924289.1|1408044_1408662_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_001300958.1|1408952_1409777_-	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	76.6	2.4e-90
WP_000246976.1|1410781_1412125_-	phage DNA ejection protein	NA	A0A0M5M1J8	Salmonella_phage	71.4	1.0e-159
>prophage 106
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1415263	1420382	4718719	integrase	Morganella_phage(50.0%)	7	1418013:1418025	1420491:1420503
WP_001419054.1|1415263_1416331_-	ash family protein	NA	A0A1C9IHV9	Salmonella_phage	38.4	8.6e-16
WP_000476150.1|1416324_1416507_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_072327875.1|1416499_1417333_-	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	48.3	1.4e-21
WP_000412532.1|1417345_1417777_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	50.3	1.8e-28
WP_024169704.1|1417776_1417995_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
1418013:1418025	attL	TGATAGCTCATGA	NA	NA	NA	NA
WP_001059729.1|1418466_1419117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001355495.1|1419113_1420382_-|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	78.6	2.3e-193
1420491:1420503	attR	TGATAGCTCATGA	NA	NA	NA	NA
>prophage 107
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1423723	1428286	4718719		Xanthomonas_phage(25.0%)	7	NA	NA
WP_000976070.1|1423723_1424182_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	9.6e-49
WP_000050139.1|1424159_1425380_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	6.5e-44
WP_001297375.1|1425551_1426220_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_000091955.1|1426436_1426673_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001051798.1|1426693_1426861_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_001114533.1|1426958_1427768_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001171873.1|1427806_1428286_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.6	6.3e-27
>prophage 108
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1435724	1437818	4718719		Archaeal_BJ1_virus(50.0%)	2	NA	NA
WP_000364795.1|1435724_1436750_+	UDP-galactose--(galactosyl) LPS alpha1,2-galactosyltransferase	NA	A0ZYL4	Archaeal_BJ1_virus	25.9	4.2e-12
WP_000064004.1|1436834_1437818_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	38.5	2.4e-12
>prophage 109
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1441217	1451945	4718719		Synechococcus_phage(16.67%)	10	NA	NA
WP_000587760.1|1441217_1442150_-	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	6.5e-36
WP_000842823.1|1442452_1443310_+	protein YibB	NA	NA	NA	NA	NA
WP_001213834.1|1443584_1444781_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
WP_000646007.1|1444790_1445816_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_032328163.1|1446054_1447089_+	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	7.5e-09
WP_000483847.1|1447075_1448035_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001214147.1|1448038_1449322_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_001350558.1|1449331_1450876_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001156181.1|1451120_1451552_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000024392.1|1451693_1451945_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
>prophage 110
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1469103	1479342	4718719	tRNA,transposase	Staphylococcus_phage(33.33%)	6	NA	NA
WP_001254933.1|1469103_1470255_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_072327877.1|1470257_1471022_-	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
WP_069985269.1|1471042_1475176_-	RHS domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	33.3	9.3e-26
WP_000779792.1|1475403_1476012_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_000206275.1|1476109_1477501_+|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_000582468.1|1477497_1479342_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	26.7	5.6e-15
>prophage 111
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1503615	1505157	4718719		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001705522.1|1503615_1505157_-	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	2.5e-16
>prophage 112
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1510476	1511472	4718719		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182650.1|1510476_1511472_-	O-acetyltransferase WecH	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.7	9.1e-12
>prophage 113
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1515309	1517311	4718719	transposase	Macacine_betaherpesvirus(50.0%)	3	NA	NA
WP_085947770.1|1515309_1516679_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_001135738.1|1516758_1516911_+	type I toxin-antitoxin system toxin HokA	NA	NA	NA	NA	NA
WP_000014594.1|1517098_1517311_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 114
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1520965	1523299	4718719		Escherichia_phage(100.0%)	1	NA	NA
WP_000013950.1|1520965_1523299_+	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.2	2.7e-70
>prophage 115
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1533343	1535328	4718719		Planktothrix_phage(50.0%)	2	NA	NA
WP_001196486.1|1533343_1534327_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	3.9e-15
WP_000107012.1|1534323_1535328_+	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	1.1e-17
>prophage 116
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1581289	1581937	4718719		Bacillus_virus(100.0%)	1	NA	NA
WP_001296814.1|1581289_1581937_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 117
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1585330	1587465	4718719		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_000065769.1|1585330_1585756_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.5e-51
WP_000922639.1|1585768_1587058_-	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	4.6e-173
WP_000008957.1|1587111_1587465_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	9.7e-25
>prophage 118
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1590810	1592853	4718719		Indivirus(100.0%)	1	NA	NA
WP_001355503.1|1590810_1592853_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.1	5.2e-46
>prophage 119
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1603650	1606386	4718719		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000149154.1|1603650_1606386_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	5.4e-22
>prophage 120
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1610537	1616189	4718719		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_069985270.1|1610537_1614773_-	rhs element protein RhsB	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.3	9.6e-26
WP_001190062.1|1614975_1615377_-	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_000173631.1|1615382_1616189_-	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	2.6e-17
>prophage 121
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1624082	1628214	4718719		Dickeya_phage(50.0%)	4	NA	NA
WP_001100469.1|1624082_1624748_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.1	2.8e-57
WP_000130621.1|1624968_1625214_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_000106551.1|1625315_1627514_-	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.4	8.5e-119
WP_000964718.1|1627587_1628214_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
>prophage 122
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1631220	1634039	4718719		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000617723.1|1631220_1631889_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
WP_001042003.1|1631881_1632940_+	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000130217.1|1633184_1634039_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
>prophage 123
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1639773	1641256	4718719		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_000082098.1|1639773_1640541_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
WP_000416900.1|1640542_1641256_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
>prophage 124
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1644797	1646608	4718719		Planktothrix_phage(50.0%)	2	NA	NA
WP_000907792.1|1644797_1645868_+	sn-glycerol 3-phosphate ABC transporter ATP binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
WP_000073599.1|1645864_1646608_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	2.9e-10
>prophage 125
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1666619	1669067	4718719		Dickeya_phage(100.0%)	1	NA	NA
WP_000993449.1|1666619_1669067_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 126
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1675122	1676349	4718719		Ralstonia_phage(100.0%)	1	NA	NA
WP_001105504.1|1675122_1676349_+	RNA-splicing ligase RtcB	NA	A0A1L7N133	Ralstonia_phage	60.0	4.0e-134
>prophage 127
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1680728	1683122	4718719		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081908.1|1680728_1683122_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 128
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1689156	1690026	4718719		Sodalis_phage(100.0%)	1	NA	NA
WP_000039073.1|1689156_1690026_-	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.4	1.3e-67
>prophage 129
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1696589	1700356	4718719		Bacillus_phage(66.67%)	3	NA	NA
WP_001157751.1|1696589_1697309_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
WP_001253696.1|1697305_1698658_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_001265681.1|1698733_1700356_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
>prophage 130
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1717260	1718097	4718719		Vibrio_phage(100.0%)	1	NA	NA
WP_000742141.1|1717260_1718097_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	2.9e-67
>prophage 131
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1742344	1751885	4718719		Acinetobacter_phage(25.0%)	9	NA	NA
WP_000601847.1|1742344_1742908_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	55.8	1.2e-61
WP_000963792.1|1742993_1744214_+	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_001295162.1|1744280_1746371_-	FUSC family protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_000242755.1|1746421_1747054_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001148908.1|1747355_1747760_+	OsmC family protein	NA	NA	NA	NA	NA
WP_001274680.1|1747814_1748684_-	phosphoribulokinase	NA	NA	NA	NA	NA
WP_000907085.1|1748737_1748956_-	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_000057356.1|1748949_1749972_-	hydrolase	NA	NA	NA	NA	NA
WP_000634798.1|1749971_1751885_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	4.3e-74
>prophage 132
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1757455	1766014	4718719		uncultured_Caudovirales_phage(40.0%)	8	NA	NA
WP_001209680.1|1757455_1757842_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	3.3e-18
WP_000820714.1|1757841_1758201_+	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	31.0	1.4e-10
WP_000903373.1|1758208_1758496_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000246815.1|1758621_1758996_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_001138043.1|1759092_1759563_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000124700.1|1759659_1761774_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_000031783.1|1761844_1763029_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000773156.1|1763320_1766014_+	bifunctional chitinase/lysozyme	NA	M1HC48	Acanthocystis_turfacea_Chlorella_virus	36.0	8.7e-41
>prophage 133
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1797446	1798918	4718719	tRNA	Prochlorococcus_phage(50.0%)	2	NA	NA
WP_000004473.1|1797446_1798394_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
WP_000114984.1|1798408_1798918_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
>prophage 134
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1810025	1815536	4718719	transposase	Escherichia_phage(66.67%)	6	NA	NA
WP_001295213.1|1810025_1811048_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.8	2.5e-198
WP_001297096.1|1811047_1811827_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_001705482.1|1811877_1812141_-	amino acid ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_001355543.1|1812148_1813252_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000019655.1|1813261_1814443_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000738568.1|1814510_1815536_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	1.8e-71
>prophage 135
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1822040	1822925	4718719		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258895.1|1822040_1822925_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	1.9e-24
>prophage 136
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1833490	1834534	4718719		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|1833490_1834534_+	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 137
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1851309	1853834	4718719	protease	uncultured_archaeal_virus(50.0%)	2	NA	NA
WP_000497723.1|1851309_1852377_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
WP_001295271.1|1852466_1853834_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
>prophage 138
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1857800	1858298	4718719	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366126.1|1857800_1858298_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	2.5e-26
>prophage 139
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1862002	1866372	4718719		Burkholderia_virus(50.0%)	5	NA	NA
WP_000108459.1|1862002_1863493_+	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
WP_000054239.1|1863540_1864230_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000209011.1|1864226_1865102_+	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000979882.1|1865098_1865563_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_072145225.1|1865622_1866372_-	YhcG family protein	NA	A0A0U2BZN7	Salmonella_phage	88.5	3.1e-73
>prophage 140
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1873742	1888537	4718719		Staphylococcus_phage(25.0%)	17	NA	NA
WP_001299745.1|1873742_1874672_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
WP_000809774.1|1874767_1877104_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001397829.1|1877333_1877987_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000047091.1|1877983_1878712_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_000620405.1|1878708_1879341_-	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000216791.1|1879554_1879827_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000243741.1|1879823_1880678_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000183676.1|1880723_1881215_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_001176599.1|1881332_1881620_-	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000809057.1|1881642_1883076_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_000224099.1|1883123_1883849_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000669785.1|1883855_1884413_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000030537.1|1884381_1884957_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000030010.1|1884953_1885520_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.0	9.4e-54
WP_001295557.1|1885540_1886527_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000922901.1|1886540_1887518_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_000438245.1|1887727_1888537_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
>prophage 141
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1892605	1894084	4718719		Vibrio_phage(50.0%)	2	NA	NA
WP_000445413.1|1892605_1892884_-	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
WP_001047336.1|1893112_1894084_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
>prophage 142
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1900858	1903731	4718719	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_001107467.1|1900858_1902793_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
WP_000764731.1|1902882_1903731_+	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
>prophage 143
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1907813	1914452	4718719		Dickeya_phage(50.0%)	4	NA	NA
WP_000207680.1|1907813_1909157_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
WP_001300397.1|1909787_1910240_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_001031057.1|1910267_1911755_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000133044.1|1911779_1914452_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
>prophage 144
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1919933	1921823	4718719		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|1919933_1921823_+	ATP-dependent RNA helicase DeaD	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 145
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1927525	1935319	4718719		Diadromus_pulchellus_ascovirus(25.0%)	10	NA	NA
WP_000189333.1|1927525_1927828_-	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	53.8	7.8e-15
WP_000449030.1|1927878_1928322_+	YhbP family protein	NA	NA	NA	NA	NA
WP_000037608.1|1928301_1928820_-	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_001300423.1|1928947_1929583_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000147571.1|1929655_1930696_+	permease	NA	NA	NA	NA	NA
WP_000646033.1|1930809_1931385_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_001158034.1|1931394_1931985_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000246830.1|1932004_1932400_-	YraN family protein	NA	NA	NA	NA	NA
WP_000249107.1|1932357_1934394_-	penicillin-binding protein activator LpoA	NA	NA	NA	NA	NA
WP_000809262.1|1934458_1935319_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.5e-50
>prophage 146
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1958291	1959437	4718719		Streptococcus_phage(100.0%)	1	NA	NA
WP_001300387.1|1958291_1959437_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	1.7e-49
>prophage 147
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1967530	1969825	4718719		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861734.1|1967530_1969825_+	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	7.4e-158
>prophage 148
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	1990403	1991369	4718719		Escherichia_phage(100.0%)	1	NA	NA
WP_001098794.1|1990403_1991369_-	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	34.1	2.3e-36
>prophage 149
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2004023	2020201	4718719	tRNA	Herpes_simplex_virus(16.67%)	12	NA	NA
WP_001082858.1|2004023_2007116_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	33.9	5.5e-156
WP_000212475.1|2007299_2008283_-	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_000450594.1|2008501_2008834_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_001301395.1|2008875_2010255_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	2.0e-33
WP_000094721.1|2010672_2012193_+	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	51.5	3.1e-35
WP_001705451.1|2012346_2012952_-	DNA-binding transcriptional regulator NfeR	NA	NA	NA	NA	NA
WP_001066494.1|2013239_2014004_+	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000228937.1|2014257_2014764_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_000437375.1|2014842_2016684_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000918827.1|2016878_2018624_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_001144069.1|2018734_2018950_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_001264352.1|2019187_2020201_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
>prophage 150
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2026601	2027840	4718719	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708487.1|2026601_2027840_-|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.9	3.5e-93
>prophage 151
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2032977	2034411	4718719		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869178.1|2032977_2034411_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 152
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2040767	2051730	4718719		Staphylococcus_phage(20.0%)	12	NA	NA
WP_001076997.1|2040767_2041421_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
WP_000469266.1|2041682_2041853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295627.1|2041910_2042684_-	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_001320780.1|2042826_2043615_+	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_000442860.1|2043652_2044813_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_000831543.1|2044818_2045490_-	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000735278.1|2045637_2047119_-	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000917138.1|2047323_2047953_+	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	4.1e-18
WP_000833393.1|2047953_2048376_+	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000444752.1|2048400_2049228_+	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000105733.1|2049227_2049809_+	esterase YqiA	NA	NA	NA	NA	NA
WP_000195296.1|2049837_2051730_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
>prophage 153
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2055557	2055950	4718719		Stx_converting_phage(100.0%)	1	NA	NA
WP_000712658.1|2055557_2055950_+	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 154
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2059259	2068610	4718719		Bacillus_virus(33.33%)	7	NA	NA
WP_001281866.1|2059259_2061518_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.1e-84
WP_000965722.1|2061751_2062489_+	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_000059388.1|2062563_2063976_+	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000095187.1|2064086_2066306_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000848526.1|2066357_2066606_-	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000691619.1|2066656_2067583_-	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000013149.1|2067782_2068610_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
>prophage 155
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2074686	2075571	4718719		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018784.1|2074686_2075571_-	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	9.8e-66
>prophage 156
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2099294	2099963	4718719		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_000590263.1|2099294_2099963_+	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	23.2	1.8e-08
>prophage 157
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2115789	2116773	4718719		Tetraselmis_virus(100.0%)	1	NA	NA
WP_032328464.1|2115789_2116773_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.7	1.1e-36
>prophage 158
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2120355	2165999	4718719	protease,tRNA,integrase,transposase	Stx2-converting_phage(33.33%)	44	2117496:2117513	2155417:2155434
2117496:2117513	attL	ATCATCAGGCTCTTTTTG	NA	NA	NA	NA
WP_000691818.1|2120355_2120577_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	2.5e-10
WP_001398324.1|2120713_2120893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_187653752.1|2122811_2124040_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	1.9e-176
WP_000381401.1|2124165_2125737_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.3	1.9e-168
WP_000624622.1|2125756_2126104_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|2126103_2126781_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_023486738.1|2127655_2128624_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	6.5e-172
WP_001218852.1|2129017_2130280_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.8	7.6e-80
WP_000234526.1|2130658_2131366_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_000839798.1|2131764_2133900_+	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_001355640.1|2133948_2135205_-	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_001355639.1|2135406_2136486_-	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_000091700.1|2136551_2136827_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001355638.1|2136854_2137907_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000786911.1|2138067_2138787_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001107566.1|2138786_2139113_+	YggL family protein	NA	NA	NA	NA	NA
WP_000984795.1|2139296_2140016_+	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_000394103.1|2140191_2141238_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000745256.1|2141354_2142362_+	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000378933.1|2142417_2143719_-	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_000577032.1|2143718_2144222_-	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_000783998.1|2144266_2145253_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000239952.1|2145565_2146702_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_001174736.1|2146694_2147288_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_001277222.1|2147295_2147586_-	YggU family protein	NA	NA	NA	NA	NA
WP_001094831.1|2147582_2148149_-	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_000997795.1|2148166_2148871_-	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001355637.1|2148888_2149869_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000017111.1|2150043_2150460_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001355636.1|2150459_2151023_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000593266.1|2151131_2152082_-	glutathione synthase	NA	NA	NA	NA	NA
WP_001300912.1|2152094_2152826_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000286500.1|2152905_2153613_-	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_000858396.1|2153707_2154205_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_001394761.1|2154281_2155676_-	galactose/proton symporter	NA	NA	NA	NA	NA
2155417:2155434	attR	ATCATCAGGCTCTTTTTG	NA	NA	NA	NA
WP_001062128.1|2156111_2157266_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001303650.1|2157569_2157785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297406.1|2157920_2158052_+	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001295380.1|2158060_2160037_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_000758897.1|2160182_2160914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000105561.1|2161049_2161970_+	agmatinase	NA	NA	NA	NA	NA
WP_001297457.1|2162017_2162776_-|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
WP_001569170.1|2163053_2165045_+	transketolase	NA	NA	NA	NA	NA
WP_000646940.1|2165090_2165999_-	prohibitin family protein	NA	A0A2C9D0H9	Yersinia_phage	56.1	5.2e-54
>prophage 159
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2172479	2173157	4718719		Bacillus_virus(100.0%)	1	NA	NA
WP_000956899.1|2172479_2173157_-	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.6	8.4e-09
>prophage 160
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2191774	2193007	4718719		Catovirus(100.0%)	1	NA	NA
WP_001151603.1|2191774_2193007_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	3.3e-104
>prophage 161
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2201142	2205615	4718719		Prochlorococcus_phage(50.0%)	2	NA	NA
WP_000195059.1|2201142_2204016_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.1	8.2e-263
WP_001394742.1|2204181_2205615_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.1	1.5e-31
>prophage 162
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2209420	2224811	4718719	tRNA	Brevibacillus_phage(14.29%)	13	NA	NA
WP_000806650.1|2209420_2210317_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	1.8e-30
WP_000715224.1|2210341_2211052_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_032328035.1|2211057_2212791_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.3	1.4e-60
WP_001701073.1|2212881_2213979_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000003071.1|2213989_2215507_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001192788.1|2215549_2216098_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_001050745.1|2216219_2216345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295374.1|2216346_2217795_-	urate/proton symporter UacT	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_001355632.1|2218230_2220150_+	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_000838428.1|2220149_2220638_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_000012163.1|2220673_2222041_-	guanine/hypoxanthine transporter GhxQ	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
WP_001336279.1|2222076_2223393_-	guanine deaminase	NA	NA	NA	NA	NA
WP_001280196.1|2223410_2224811_-	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
>prophage 163
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2249270	2250026	4718719		Clostridium_phage(100.0%)	1	NA	NA
WP_001301085.1|2249270_2250026_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 164
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2255249	2257744	4718719		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_000603502.1|2255249_2256011_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
WP_000256438.1|2256325_2257744_+	arabinose-proton symporter AraE	NA	O13311	Aichi_virus	26.9	1.8e-24
>prophage 165
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2267374	2274147	4718719		Moraxella_phage(33.33%)	6	NA	NA
WP_000895624.1|2267374_2268088_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
WP_000082201.1|2268156_2268846_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000564489.1|2269530_2270061_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000957910.1|2270073_2272320_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000204658.1|2272470_2273346_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_032327952.1|2273352_2274147_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.5	1.7e-117
>prophage 166
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2279623	2295061	4718719	tRNA	Bacillus_phage(33.33%)	9	NA	NA
WP_001138201.1|2279623_2282512_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.7	5.3e-68
WP_001397724.1|2282504_2286047_+	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	20.9	1.5e-08
WP_000775955.1|2286046_2287873_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.7	3.5e-25
WP_000237947.1|2287934_2289266_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000016907.1|2289497_2290751_+	N-acetylmuramoyl-L-alanine amidase AmiC	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000678647.1|2291219_2292317_+	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000117728.1|2292555_2293362_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.2e-16
WP_000184261.1|2293412_2293856_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_001300698.1|2293855_2295061_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.8	3.0e-73
>prophage 167
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2307056	2307812	4718719		Bacillus_phage(100.0%)	1	NA	NA
WP_000268232.1|2307056_2307812_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	5.0e-10
>prophage 168
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2312670	2313519	4718719		Vibrio_phage(100.0%)	1	NA	NA
WP_000100421.1|2312670_2313519_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.1	1.0e-40
>prophage 169
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2321053	2325168	4718719		Hokovirus(50.0%)	2	NA	NA
WP_000186450.1|2321053_2323810_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
WP_000046812.1|2323866_2325168_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.9	5.2e-39
>prophage 170
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2329200	2334121	4718719		Only_Syngen_Nebraska_virus(33.33%)	4	NA	NA
WP_000210878.1|2329200_2330838_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
WP_000036723.1|2330925_2332224_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_001268460.1|2332283_2333156_-	YgcG family protein	NA	NA	NA	NA	NA
WP_001199973.1|2333449_2334121_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
>prophage 171
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2338881	2339667	4718719		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000021321.1|2338881_2339667_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	6.5e-21
>prophage 172
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2364439	2366472	4718719		Hokovirus(50.0%)	2	NA	NA
WP_001090386.1|2364439_2365867_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.1	1.1e-29
WP_001173676.1|2365866_2366472_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	3.2e-28
>prophage 173
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2369584	2372245	4718719		uncultured_Mediterranean_phage(66.67%)	3	NA	NA
WP_001295182.1|2369584_2370346_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|2370339_2370966_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272590.1|2371105_2372245_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
>prophage 174
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2375624	2383162	4718719		Escherichia_phage(80.0%)	6	NA	NA
WP_001278994.1|2375624_2376263_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590403.1|2376259_2377522_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_000847985.1|2377518_2378427_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001300386.1|2378622_2379390_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_072327895.1|2380330_2380495_-	serine/threonine-protein phosphatase 2	NA	NA	NA	NA	NA
WP_001272895.1|2380600_2383162_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	4.6e-31
>prophage 175
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2400966	2401977	4718719		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001394680.1|2400966_2401977_+	DNA-binding transcriptional regulator AscG	NA	C6ZCU4	Enterobacteria_phage	28.4	7.1e-28
>prophage 176
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2409452	2410418	4718719		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287431.1|2409452_2410418_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	2.3e-36
>prophage 177
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2415884	2421270	4718719	tRNA	Pseudomonas_phage(25.0%)	5	NA	NA
WP_000132231.1|2415884_2416382_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
WP_000963143.1|2416461_2417523_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000140508.1|2417591_2418092_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_023486977.1|2418219_2420850_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000906486.1|2421084_2421270_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 178
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2434594	2439889	4718719		Bacillus_virus(20.0%)	5	NA	NA
WP_000985494.1|2434594_2435797_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
WP_000777969.1|2436150_2437110_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	3.5e-133
WP_000246527.1|2437119_2439264_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.5	1.7e-196
WP_000080947.1|2439236_2439647_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_001223227.1|2439643_2439889_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
>prophage 179
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2443825	2447877	4718719		Clostridium_phage(50.0%)	4	NA	NA
WP_000522415.1|2443825_2444275_+	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
WP_000156811.1|2444275_2444938_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_072327897.1|2444958_2446359_-	GABA permease	NA	NA	NA	NA	NA
WP_001087612.1|2446596_2447877_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	1.9e-33
>prophage 180
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2456482	2460777	4718719	integrase	Clostridium_phage(33.33%)	3	2444369:2444382	2461087:2461100
2444369:2444382	attL	TACCGCCGCAGTCA	NA	NA	NA	NA
WP_000135613.1|2456482_2458039_-	recombinase family protein	NA	A0A0A7RTP8	Clostridium_phage	30.0	1.9e-19
WP_001062344.1|2458321_2459551_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	86.3	1.0e-206
WP_000162574.1|2460294_2460777_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
2461087:2461100	attR	TGACTGCGGCGGTA	NA	NA	NA	NA
>prophage 181
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2474603	2475674	4718719		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001168037.1|2474603_2475674_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
>prophage 182
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2481580	2484154	4718719		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001235102.1|2481580_2484154_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 183
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2490015	2491314	4718719		Burkholderia_virus(100.0%)	1	NA	NA
WP_000841103.1|2490015_2491314_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
>prophage 184
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2496607	2502866	4718719	tRNA	Achromobacter_phage(25.0%)	7	NA	NA
WP_001098726.1|2496607_2497027_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997403.1|2497233_2498271_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001262716.1|2498318_2499008_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000627807.1|2499312_2499696_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_000189207.1|2499751_2500339_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001351830.1|2500441_2501323_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219193.1|2501531_2502866_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
>prophage 185
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2508637	2512380	4718719		Tupanvirus(50.0%)	3	NA	NA
WP_000790168.1|2508637_2510437_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000002542.1|2510452_2511427_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068343.1|2511699_2512380_+	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
>prophage 186
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2515591	2532484	4718719	tRNA,transposase	Bacillus_phage(33.33%)	12	NA	NA
WP_001196283.1|2515591_2515852_-	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
WP_001351829.1|2515907_2516756_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001254933.1|2517120_2518272_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_001295367.1|2518847_2519384_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000734210.1|2519392_2520937_-	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_032328549.1|2521194_2525082_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.9	1.3e-130
WP_001416677.1|2525639_2527067_+	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
WP_001215861.1|2527231_2527945_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001298983.1|2527934_2529269_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_000717691.1|2529329_2529668_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000883122.1|2529712_2530903_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000919159.1|2531230_2532484_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
>prophage 187
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2538376	2539888	4718719		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000493470.1|2538376_2539888_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.0	2.4e-11
>prophage 188
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2555115	2561453	4718719		Faustovirus(20.0%)	8	NA	NA
WP_001295373.1|2555115_2556330_+	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
WP_000331707.1|2556357_2556744_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_000028953.1|2556760_2557084_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000384413.1|2557179_2557695_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_001196613.1|2557711_2559562_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_001124474.1|2559563_2559899_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_000523616.1|2559910_2560111_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_000133595.1|2560169_2561453_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	3.8e-34
>prophage 189
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2571664	2572096	4718719		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963837.1|2571664_2572096_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 190
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2580926	2587411	4718719		Escherichia_phage(66.67%)	7	NA	NA
WP_000937912.1|2580926_2582297_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	2.4e-42
WP_001299507.1|2582458_2583925_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000138270.1|2583993_2585571_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_000755173.1|2585663_2586203_-	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	100.0	3.4e-45
WP_001295476.1|2586218_2586737_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.3e-62
WP_000076001.1|2587049_2587241_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_000017552.1|2587258_2587411_+	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
>prophage 191
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2593657	2597659	4718719		Prochlorococcus_phage(33.33%)	4	NA	NA
WP_001028614.1|2593657_2594296_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
WP_001295474.1|2594295_2595333_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
WP_001295473.1|2595657_2596284_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000198328.1|2596369_2597659_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
>prophage 192
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2618743	2619457	4718719		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|2618743_2619457_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 193
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2636745	2637696	4718719		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|2636745_2637696_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 194
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2656325	2661445	4718719		Deep-sea_thermophilic_phage(33.33%)	6	NA	NA
WP_000102886.1|2656325_2657195_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
WP_000405996.1|2657408_2657834_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_000842944.1|2657820_2658270_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000838944.1|2658330_2658906_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_000084590.1|2659001_2659901_+	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_001397583.1|2660140_2661445_-	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	25.6	6.2e-08
>prophage 195
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2664923	2665715	4718719		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_032328027.1|2664923_2665715_+	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.6	2.6e-17
>prophage 196
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2668732	2670875	4718719		Bacillus_virus(50.0%)	2	NA	NA
WP_000021036.1|2668732_2669830_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
WP_001336044.1|2669963_2670875_+	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.3	3.8e-57
>prophage 197
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2674529	2682162	4718719		Hokovirus(33.33%)	6	NA	NA
WP_000623140.1|2674529_2676257_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	1.3e-16
WP_000487600.1|2676301_2676559_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000034402.1|2676942_2677914_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000254839.1|2678098_2678860_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_001300494.1|2679089_2680076_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000443661.1|2680146_2682162_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.5	1.7e-150
>prophage 198
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2707578	2708313	4718719		Clostridioides_phage(100.0%)	1	NA	NA
WP_001295458.1|2707578_2708313_-	two-component system response regulator YpdB	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 199
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2712131	2713052	4718719		Morganella_phage(100.0%)	1	NA	NA
WP_000484404.1|2712131_2713052_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
>prophage 200
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2716746	2724323	4718719		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_001283490.1|2716746_2718441_+	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.4e-23
WP_000955028.1|2718510_2719455_+	transporter YfdV	NA	NA	NA	NA	NA
WP_001296867.1|2719528_2720674_+	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_001355656.1|2720729_2724323_-	acid-sensing system histidine kinase EvgS	NA	W8CYM9	Bacillus_phage	40.0	1.1e-09
>prophage 201
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2732248	2733181	4718719		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000368140.1|2732248_2733181_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
>prophage 202
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2751008	2791056	4718719	head,transposase,integrase,capsid,tail,plate,holin,terminase,tRNA	Enterobacteria_phage(83.78%)	51	2760634:2760653	2788032:2788051
WP_001333535.1|2751008_2752094_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	9.1e-90
WP_001043825.1|2752097_2752922_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000447361.1|2752921_2753731_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_001089222.1|2753730_2754279_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000559764.1|2754312_2754591_+	YfcL family protein	NA	NA	NA	NA	NA
WP_000683789.1|2754711_2756718_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000817178.1|2756876_2758097_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000127751.1|2758361_2759540_+	arabinose transporter	NA	NA	NA	NA	NA
WP_000615834.1|2759536_2760532_-	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
2760634:2760653	attL	AAAATCCTTGTTGATGAAAA	NA	NA	NA	NA
WP_001420124.1|2761696_2762029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000078916.1|2762206_2762347_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_001299564.1|2762537_2762798_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_001254933.1|2763747_2764899_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_072327903.1|2764849_2765173_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	100.0	1.1e-43
WP_001397420.1|2765330_2766515_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.2	5.8e-223
WP_000290450.1|2766514_2767027_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000665308.1|2767081_2767447_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_000333495.1|2767455_2767611_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_001394249.1|2767597_2770405_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	93.6	0.0e+00
WP_000979954.1|2770417_2770906_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.6e-86
WP_044316995.1|2772006_2772852_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.8	2.0e-137
WP_001067548.1|2772855_2773185_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	100.0	2.2e-55
WP_001476003.1|2773202_2773769_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	98.4	1.1e-99
WP_032328494.1|2773780_2774416_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	98.6	2.6e-113
WP_000920594.1|2774408_2774876_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_000780572.1|2775013_2775421_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	99.3	9.0e-67
WP_032328493.1|2775417_2775810_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	99.2	1.7e-70
WP_000104350.1|2775806_2776130_-|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000865513.1|2776132_2776333_-|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	98.5	1.3e-31
WP_000063103.1|2776332_2776827_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	1.2e-89
WP_000632352.1|2776928_2777729_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	98.1	1.0e-138
WP_044316994.1|2777774_2778779_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.0	7.4e-179
WP_000599412.1|2781364_2781730_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	95.0	1.3e-59
WP_111986922.1|2781726_2782347_-	ash family protein	NA	S5MQL6	Escherichia_phage	40.4	7.0e-10
WP_000714524.1|2782400_2783231_-	hypothetical protein	NA	A0A0A7NPW9	Enterobacteria_phage	98.9	9.6e-132
WP_001036813.1|2783227_2783431_-	hypothetical protein	NA	A0A0A7NQ74	Enterobacteria_phage	98.5	8.3e-29
WP_001274216.1|2783442_2783742_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	96.0	3.5e-44
WP_000153702.1|2783738_2784005_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	76.1	5.8e-30
WP_000985149.1|2784001_2784205_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	85.1	2.5e-25
WP_001583389.1|2784204_2784468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001363442.1|2784557_2784671_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	97.3	2.8e-10
WP_000514277.1|2784667_2784910_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_032328491.1|2784921_2785209_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	76.8	7.8e-33
WP_000813363.1|2785219_2785561_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	92.2	2.3e-55
WP_000200503.1|2785813_2786020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001705258.1|2786026_2786314_-	regulatory phage cox family protein	NA	A0A0M4RCW1	Salmonella_phage	53.7	1.1e-23
WP_032327937.1|2786427_2786748_+	helix-turn-helix transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	43.2	4.8e-15
WP_000023402.1|2786844_2787849_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	55.7	4.5e-99
WP_001705257.1|2788007_2789165_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	28.8	6.0e-23
2788032:2788051	attR	AAAATCCTTGTTGATGAAAA	NA	NA	NA	NA
WP_001289167.1|2789230_2790244_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001283585.1|2790243_2791056_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
>prophage 203
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2795642	2797160	4718719		Mollivirus(100.0%)	1	NA	NA
WP_000334220.1|2795642_2797160_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
>prophage 204
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2801371	2803232	4718719		Bodo_saltans_virus(50.0%)	2	NA	NA
WP_032327930.1|2801371_2802145_+	histidine ABC transporter ATP-binding protein HisP	NA	A0A2H4UUX5	Bodo_saltans_virus	25.1	2.0e-06
WP_000156149.1|2802341_2803232_+	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	43.9	8.9e-67
>prophage 205
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2813791	2817019	4718719		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_001203392.1|2813791_2814442_+	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	35.4	3.1e-08
WP_001012899.1|2814528_2816361_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_000813859.1|2816419_2817019_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
>prophage 206
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2855858	2860862	4718719		Tupanvirus(50.0%)	4	NA	NA
WP_000860273.1|2855858_2857841_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	1.8e-19
WP_000461657.1|2857840_2858809_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	8.8e-36
WP_001355579.1|2858812_2859952_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	30.1	5.0e-30
WP_000879112.1|2860259_2860862_+	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	4.4e-09
>prophage 207
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2864465	2868976	4718719	transposase	Oenococcus_phage(50.0%)	5	NA	NA
WP_001319848.1|2864465_2865671_+	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	1.2e-26
WP_001295288.1|2865727_2867017_+	MFS transporter	NA	NA	NA	NA	NA
WP_000992954.1|2867034_2867838_+	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_000150333.1|2867878_2868064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000140569.1|2868076_2868976_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	2.5e-69
>prophage 208
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2874868	2881015	4718719		Pseudomonas_phage(50.0%)	5	NA	NA
WP_000779105.1|2874868_2875945_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	3.0e-08
WP_000301050.1|2876407_2877058_+	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000135040.1|2877111_2877366_-	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000332037.1|2877365_2878496_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.1	1.5e-175
WP_001075164.1|2878729_2881015_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	2.5e-283
>prophage 209
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2886459	2889087	4718719		Bacillus_virus(100.0%)	1	NA	NA
WP_001281242.1|2886459_2889087_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
>prophage 210
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2904010	2908853	4718719		Bacillus_phage(50.0%)	2	NA	NA
WP_000559133.1|2904010_2905837_-	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	27.3	1.5e-20
WP_000876011.1|2906003_2908853_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
>prophage 211
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2913130	2918908	4718719		Enterobacteria_phage(25.0%)	5	NA	NA
WP_000865568.1|2913130_2914234_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.3	5.2e-117
WP_000406064.1|2914345_2915401_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000710375.1|2915474_2916539_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_000884971.1|2916538_2917189_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	33.0	8.3e-06
WP_000422182.1|2917264_2918908_+	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	1.2e-13
>prophage 212
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2928128	2928746	4718719		Bacillus_virus(100.0%)	1	NA	NA
WP_001705237.1|2928128_2928746_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	5.7e-12
>prophage 213
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2940620	2948268	4718719		Vibrio_phage(50.0%)	7	NA	NA
WP_000050793.1|2940620_2941628_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.6	4.1e-84
WP_000494183.1|2941766_2942051_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000578092.1|2942175_2943936_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	4.2e-100
WP_001234850.1|2944084_2944780_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000213361.1|2944807_2945998_+	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	2.2e-20
WP_000202798.1|2946330_2946675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194927.1|2946678_2948268_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	34.0	1.1e-19
>prophage 214
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2954022	2958323	4718719		Clostridioides_phage(50.0%)	4	NA	NA
WP_000241011.1|2954022_2954589_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
WP_000594599.1|2955000_2955714_-	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000198828.1|2955752_2956739_-	zinc-binding GTPase YeiR	NA	NA	NA	NA	NA
WP_001091940.1|2956856_2958323_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.4	2.3e-43
>prophage 215
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2972870	2973728	4718719		Catovirus(100.0%)	1	NA	NA
WP_000873894.1|2972870_2973728_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	34.0	4.0e-24
>prophage 216
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	2977798	2981584	4718719		Acinetobacter_phage(50.0%)	3	NA	NA
WP_000489247.1|2977798_2979790_+	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.0e-13
WP_000425438.1|2979821_2980658_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001139613.1|2980915_2981584_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
>prophage 217
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3005695	3015136	4718719		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569357.1|3005695_3006622_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783115.1|3006626_3007358_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|3007338_3007446_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|3007505_3008237_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|3008458_3010144_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|3010140_3010860_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950409.1|3010906_3011377_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_001295429.1|3011416_3011878_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001355588.1|3012002_3014003_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
WP_001333512.1|3013999_3015136_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
>prophage 218
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3026767	3028801	4718719	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001350533.1|3026767_3028801_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 219
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3039448	3043005	4718719		Paenibacillus_phage(50.0%)	4	NA	NA
WP_001352238.1|3039448_3040267_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	1.9e-23
WP_000434038.1|3040318_3041065_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011958.1|3041038_3042004_-	sugar kinase	NA	NA	NA	NA	NA
WP_000846230.1|3042000_3043005_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	28.7	6.4e-13
>prophage 220
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3055969	3062810	4718719	tRNA	Synechococcus_phage(25.0%)	7	NA	NA
WP_000481293.1|3055969_3056623_+	HAD-IA family hydrolase	NA	A0A1D8KNV9	Synechococcus_phage	24.8	9.0e-08
WP_000807345.1|3056696_3057596_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001394463.1|3058009_3058327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000476014.1|3058656_3060018_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
WP_000929408.1|3060164_3060497_-	YegP family protein	NA	NA	NA	NA	NA
WP_001531819.1|3060687_3061410_-	two-component system response regulator BaeR	NA	NA	NA	NA	NA
WP_000675150.1|3061406_3062810_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
>prophage 221
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3076988	3078341	4718719		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000469697.1|3076988_3078341_-	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	21.1	7.1e-07
>prophage 222
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3083066	3093635	4718719		Catovirus(20.0%)	9	NA	NA
WP_001295424.1|3083066_3083708_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
WP_001234767.1|3083799_3084381_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_001252326.1|3084402_3086256_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001355593.1|3086707_3088291_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_162829205.1|3088491_3088641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000978094.1|3088949_3090089_+	polysaccharide export protein Wza	NA	NA	NA	NA	NA
WP_000482901.1|3090094_3090538_+	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000137174.1|3090540_3092703_+	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	1.1e-17
WP_000654503.1|3092795_3093635_+	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	9.7e-07
>prophage 223
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3097880	3104762	4718719		Synechococcus_phage(25.0%)	6	NA	NA
WP_000048190.1|3097880_3099002_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
WP_000043590.1|3099004_3099970_+	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	1.3e-87
WP_000479833.1|3099972_3100452_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000699766.1|3100448_3101672_+	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_000079302.1|3101674_3103111_+	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	5.7e-47
WP_001355594.1|3103391_3104762_+	colanic acid biosynthesis phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.7	9.9e-33
>prophage 224
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3110474	3112937	4718719		Klebsiella_phage(50.0%)	2	NA	NA
WP_001115981.1|3110474_3111869_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.5	1.3e-19
WP_000183060.1|3112043_3112937_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
>prophage 225
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3118935	3127035	4718719		Tupanvirus(20.0%)	6	NA	NA
WP_001024185.1|3118935_3119943_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	48.6	2.2e-82
WP_001076405.1|3119963_3121169_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_001297922.1|3121158_3122598_+	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	30.8	2.7e-57
WP_000096783.1|3122680_3124051_+	colanic acid biosynthesis phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.9	3.8e-32
WP_000043484.1|3124213_3125620_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.4e-37
WP_000704860.1|3125868_3127035_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.2	1.7e-110
>prophage 226
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3134387	3135287	4718719		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131782.1|3134387_3135287_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 227
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3142526	3144992	4718719	transposase	Shigella_phage(50.0%)	2	NA	NA
WP_088895425.1|3142526_3143755_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_032145576.1|3143828_3144992_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	98.7	9.7e-223
>prophage 228
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3149333	3151492	4718719		Klebsiella_phage(33.33%)	4	NA	NA
WP_000692323.1|3149333_3149555_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186773.1|3149617_3150094_-	RadC family protein	NA	NA	NA	NA	NA
WP_000860076.1|3150109_3150589_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	8.9e-13
WP_001234530.1|3150670_3151492_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	3.6e-46
>prophage 229
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3166515	3166971	4718719		Escherichia_phage(100.0%)	1	NA	NA
WP_000423152.1|3166515_3166971_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.6e-56
>prophage 230
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3171366	3183733	4718719		Bacillus_phage(28.57%)	12	NA	NA
WP_001362894.1|3171366_3172038_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.6	3.1e-32
WP_000826758.1|3172037_3173396_+	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.5	8.7e-05
WP_000218220.1|3173503_3174355_-	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000824370.1|3174946_3176005_-	porin	NA	Q1MVN1	Enterobacteria_phage	49.3	1.1e-92
WP_001313057.1|3176571_3176937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000365544.1|3176976_3177672_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.8e-07
WP_001157238.1|3177738_3179157_+	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.3	1.8e-101
WP_000786004.1|3179137_3179608_+	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
WP_001212240.1|3179596_3180517_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000922682.1|3180689_3181607_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_000009307.1|3181685_3181868_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_001355498.1|3182038_3183733_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
>prophage 231
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3200282	3202884	4718719	transposase	Helicobacter_phage(33.33%)	3	NA	NA
WP_077891205.1|3200282_3200942_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.1e-43
WP_072327920.1|3200964_3202173_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.3	5.4e-208
WP_000334609.1|3202212_3202884_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	5.6e-82
>prophage 232
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3214797	3215550	4718719		Bacillus_virus(100.0%)	1	NA	NA
WP_001272994.1|3214797_3215550_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
>prophage 233
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3226355	3227258	4718719		Moraxella_phage(100.0%)	1	NA	NA
WP_000515817.1|3226355_3227258_-	WYL domain-containing transcriptional regulator	NA	A0A0R6PH67	Moraxella_phage	31.5	9.7e-37
>prophage 234
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3231637	3232768	4718719	integrase	Ralstonia_phage(100.0%)	1	3230263:3230275	3233393:3233405
3230263:3230275	attL	AGAAGCGGTGTAA	NA	NA	NA	NA
WP_001121921.1|3231637_3232768_-|integrase	site-specific integrase	integrase	A0A221SAN4	Ralstonia_phage	27.6	2.6e-15
WP_001121921.1|3231637_3232768_-|integrase	site-specific integrase	integrase	A0A221SAN4	Ralstonia_phage	27.6	2.6e-15
3233393:3233405	attR	TTACACCGCTTCT	NA	NA	NA	NA
>prophage 235
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3237239	3238748	4718719		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001189123.1|3237239_3238748_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
>prophage 236
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3247189	3248704	4718719		Cedratvirus(100.0%)	1	NA	NA
WP_001187794.1|3247189_3248704_+	arabinose ABC transporter ATP binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.2	2.8e-12
>prophage 237
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3258790	3264434	4718719		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_001297437.1|3258790_3260452_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000483223.1|3260497_3262099_+	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.7	8.3e-15
WP_000204313.1|3262117_3262978_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000036371.1|3262980_3264030_+	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000763864.1|3264044_3264434_+	chemotaxis response regulator CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.0e-06
>prophage 238
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3269686	3271420	4718719	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001025322.1|3269686_3271420_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	3.4e-86
>prophage 239
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3274474	3280087	4718719	tRNA	Escherichia_phage(33.33%)	5	NA	NA
WP_000176798.1|3274474_3276904_+	trimethylamine N-oxide reductase TorZ	NA	A0A077SK27	Escherichia_phage	27.5	2.6e-60
WP_000564725.1|3277068_3278040_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000019588.1|3278036_3278780_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252980.1|3278820_3279216_-	MAPEG family protein	NA	NA	NA	NA	NA
WP_000639274.1|3279268_3280087_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
>prophage 240
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3284105	3291169	4718719		Bacillus_virus(50.0%)	9	NA	NA
WP_001295503.1|3284105_3284627_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_001024904.1|3284628_3285231_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_072094247.1|3285301_3285367_+	stress response small protein YobI	NA	NA	NA	NA	NA
WP_000580327.1|3285505_3286117_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568519.1|3286125_3287136_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000571479.1|3287282_3288068_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000202996.1|3288064_3288820_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_001300644.1|3288898_3289831_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_001184045.1|3289846_3291169_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
>prophage 241
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3295166	3296642	4718719		Cyanophage(100.0%)	1	NA	NA
WP_000301719.1|3295166_3296642_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	3.7e-78
>prophage 242
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3304698	3309168	4718719		Klebsiella_phage(33.33%)	7	NA	NA
WP_000944258.1|3304698_3305361_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000011658.1|3305384_3306041_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000916763.1|3306142_3306373_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000168746.1|3306511_3306886_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000879295.1|3306889_3307762_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000976472.1|3307774_3308116_+	YebY family protein	NA	NA	NA	NA	NA
WP_000812732.1|3308511_3309168_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	8.0e-57
>prophage 243
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3316664	3318713	4718719		Moraxella_phage(100.0%)	1	NA	NA
WP_001055779.1|3316664_3318713_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	8.8e-86
>prophage 244
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3324043	3324253	4718719		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|3324043_3324253_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 245
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3329893	3331450	4718719		Moraxella_phage(100.0%)	1	NA	NA
WP_000394983.1|3329893_3331450_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 246
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3335312	3344616	4718719	tRNA,transposase	Pandoravirus(25.0%)	8	NA	NA
WP_000855022.1|3335312_3336674_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	2.0e-41
WP_000457334.1|3336747_3336927_+	YoaH family protein	NA	NA	NA	NA	NA
WP_001295493.1|3337766_3338111_-	RidA family protein	NA	NA	NA	NA	NA
WP_000128847.1|3338242_3340153_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001220966.1|3340210_3340906_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_077633790.1|3340945_3341962_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	4.9e-186
WP_000290556.1|3342144_3342726_+	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_000758422.1|3342930_3344616_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
>prophage 247
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3359145	3363722	4718719		Bacillus_phage(100.0%)	3	NA	NA
WP_000766131.1|3359145_3360636_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	4.9e-09
WP_000616437.1|3360816_3362292_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000219686.1|3362438_3363722_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
>prophage 248
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3367040	3367895	4718719		Indivirus(100.0%)	1	NA	NA
WP_001186374.1|3367040_3367895_+	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	1.5e-10
>prophage 249
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3377482	3381568	4718719		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000723718.1|3377482_3378463_+	NADH-dependent methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	22.0	2.3e-07
WP_000719088.1|3378599_3379358_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_001300835.1|3379475_3380834_+	MFS transporter	NA	NA	NA	NA	NA
WP_001135058.1|3380926_3381568_-	bifunctional pyrazinamidase/nicotinamidase	NA	A0A2K9L2K0	Tupanvirus	35.4	1.7e-19
>prophage 250
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3386494	3388456	4718719		Streptococcus_phage(100.0%)	1	NA	NA
WP_001235800.1|3386494_3388456_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	3.2e-40
>prophage 251
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3394054	3394708	4718719		Bacillus_phage(100.0%)	1	NA	NA
WP_001300558.1|3394054_3394708_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.0	5.1e-11
>prophage 252
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3401472	3402693	4718719		Klosneuvirus(100.0%)	1	NA	NA
WP_000081986.1|3401472_3402693_+	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	4.2e-27
>prophage 253
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3410169	3410997	4718719		Bacillus_virus(100.0%)	1	NA	NA
WP_000175026.1|3410169_3410997_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	1.7e-72
>prophage 254
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3417326	3419588	4718719		Tupanvirus(100.0%)	1	NA	NA
WP_032328477.1|3417326_3419588_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.3e-143
>prophage 255
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3430883	3450423	4718719	tRNA	Tupanvirus(22.22%)	19	NA	NA
WP_001144202.1|3430883_3432812_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
WP_032328478.1|3432815_3433358_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.3	1.8e-14
WP_001124225.1|3433454_3433652_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|3433704_3434061_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|3434183_3434228_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000018596.1|3434511_3435495_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_000672380.1|3435509_3437897_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229265.1|3437901_3438201_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_001705124.1|3438301_3439282_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001154168.1|3439344_3439896_+	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000029466.1|3439895_3440645_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001209795.1|3440722_3441187_+	endopeptidase	NA	S5MM68	Bacillus_phage	36.9	2.1e-11
WP_001300634.1|3441433_3442147_+	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_000175703.1|3442209_3443646_+	YdiU family protein	NA	NA	NA	NA	NA
WP_001270809.1|3443649_3443841_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_001082229.1|3443972_3445019_-	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_000368046.1|3445175_3446009_-	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_000069375.1|3446341_3448720_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	9.4e-172
WP_001336282.1|3448776_3450423_-	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.3	2.9e-31
>prophage 256
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3469066	3474150	4718719		Lake_Baikal_phage(33.33%)	5	NA	NA
WP_000367160.1|3469066_3469435_+	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	4.3e-15
WP_000089364.1|3469443_3470931_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000948863.1|3470940_3471687_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	31.4	8.4e-10
WP_000907979.1|3471661_3472933_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000577988.1|3472929_3474150_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	4.4e-93
>prophage 257
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3482409	3484676	4718719		Escherichia_phage(50.0%)	3	NA	NA
WP_001310861.1|3482409_3483078_+	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	1.0e-22
WP_001069979.1|3483074_3483860_+	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_000587525.1|3483863_3484676_+	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
>prophage 258
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3490180	3499061	4718719		Orpheovirus(20.0%)	9	NA	NA
WP_000493947.1|3490180_3490822_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
WP_000098896.1|3490861_3492010_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	9.3e-85
WP_001182363.1|3492300_3493512_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000269501.1|3493624_3494557_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000190982.1|3494553_3495579_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000102278.1|3495877_3495967_+	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000701044.1|3496132_3497302_+	MFS transporter	NA	NA	NA	NA	NA
WP_000007283.1|3497536_3498118_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000101193.1|3498245_3499061_-	peptidoglycan DD-endopeptidase MepH	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
>prophage 259
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3507863	3509362	4718719		Indivirus(50.0%)	2	NA	NA
WP_000250656.1|3507863_3508760_+	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	4.7e-07
WP_001296937.1|3508840_3509362_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
>prophage 260
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3516273	3517548	4718719	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|3516273_3517548_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 261
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3537424	3539236	4718719		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945878.1|3537424_3539236_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	100.0	0.0e+00
>prophage 262
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3549312	3550614	4718719		Bacillus_phage(100.0%)	1	NA	NA
WP_000732512.1|3549312_3550614_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.2	3.2e-17
>prophage 263
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3568375	3595798	4718719	transposase	Escherichia_phage(27.78%)	24	NA	NA
WP_000148710.1|3568375_3568990_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526503.1|3569032_3569887_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|3569888_3570506_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001340362.1|3570516_3572940_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_000041677.1|3573000_3575427_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	3.8e-213
WP_001300836.1|3575625_3575931_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|3576038_3576749_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|3576751_3577312_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|3577346_3577688_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|3577822_3578149_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001355548.1|3578354_3579569_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	4.1e-46
WP_001394316.1|3579580_3580600_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	7.4e-17
WP_001389342.1|3580657_3580786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001339397.1|3582043_3582721_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|3582720_3583068_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381401.1|3583087_3584659_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.3	1.9e-168
WP_000005552.1|3584809_3585061_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_040036049.1|3585133_3587590_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.5	8.5e-59
WP_085947916.1|3587731_3588824_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.9e-51
WP_000887491.1|3589940_3590153_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
WP_000836768.1|3591706_3591940_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|3592008_3592122_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000527809.1|3594099_3595560_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.5e-42
WP_000214712.1|3595594_3595798_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 264
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3601164	3602055	4718719		Bacillus_phage(100.0%)	1	NA	NA
WP_000592802.1|3601164_3602055_+	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	6.2e-20
>prophage 265
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3605057	3606436	4718719		Streptococcus_phage(50.0%)	3	NA	NA
WP_000091199.1|3605057_3605441_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_032328330.1|3605461_3605896_-	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
WP_000273128.1|3606115_3606436_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q6UAT3	Klebsiella_phage	42.3	7.2e-19
>prophage 266
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3613674	3615075	4718719		Escherichia_phage(100.0%)	1	NA	NA
WP_001751216.1|3613674_3615075_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	49.2	4.0e-106
>prophage 267
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3622498	3624034	4718719		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001194916.1|3622498_3624034_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	24.0	9.4e-16
>prophage 268
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3631914	3633333	4718719		Bacillus_phage(100.0%)	1	NA	NA
WP_000558033.1|3631914_3633333_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.9e-18
>prophage 269
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3651199	3653428	4718719		Lactobacillus_phage(100.0%)	1	NA	NA
WP_001530084.1|3651199_3653428_-	DEAD/DEAH box helicase family protein	NA	Q9T1H9	Lactobacillus_phage	25.8	3.0e-23
>prophage 270
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3665392	3672328	4718719		Bacillus_phage(50.0%)	3	NA	NA
WP_000628585.1|3665392_3667078_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.3	2.2e-10
WP_000832407.1|3667115_3669488_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_032328081.1|3669544_3672328_+	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	23.8	4.4e-19
>prophage 271
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3677602	3681409	4718719		Bacillus_virus(50.0%)	2	NA	NA
WP_000426299.1|3677602_3678985_+	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
WP_001360132.1|3679009_3681409_+	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
>prophage 272
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3685725	3687631	4718719		Planktothrix_phage(100.0%)	2	NA	NA
WP_000193547.1|3685725_3686712_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	1.4e-17
WP_001285536.1|3686704_3687631_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	4.1e-14
>prophage 273
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3690904	3691915	4718719		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000642435.1|3690904_3691915_+	alcohol dehydrogenase AdhP	NA	A0A0K0KVL7	Prochlorococcus_phage	27.1	4.5e-14
>prophage 274
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3698536	3698827	4718719		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000768384.1|3698536_3698827_+	lipoprotein	NA	Q1MVN1	Enterobacteria_phage	65.1	2.1e-25
>prophage 275
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3705711	3707256	4718719		Escherichia_phage(100.0%)	1	NA	NA
WP_000702535.1|3705711_3707256_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 276
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3713901	3715064	4718719	transposase	Acinetobacter_phage(100.0%)	1	NA	NA
WP_095033723.1|3713901_3715064_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 277
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3718554	3720657	4718719		Salmonella_phage(100.0%)	1	NA	NA
WP_000689363.1|3718554_3720657_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.3	5.3e-134
>prophage 278
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3727788	3734838	4718719		Mycoplasma_phage(25.0%)	7	NA	NA
WP_000220399.1|3727788_3728802_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	55.4	1.1e-25
WP_000047424.1|3728819_3729965_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000760586.1|3730209_3731616_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_001270286.1|3731694_3732111_-	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_000813794.1|3732156_3732333_-	type II toxin-antitoxin system mRNA interferase toxin HicA	NA	A0A0M3LQ86	Mannheimia_phage	57.9	3.6e-12
WP_000494244.1|3732554_3732785_+	YncJ family protein	NA	NA	NA	NA	NA
WP_001355676.1|3732876_3734838_-	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.3	3.5e-23
>prophage 279
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3750544	3751493	4718719		Moraxella_phage(50.0%)	2	NA	NA
WP_000731833.1|3750544_3750718_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_000428998.1|3750962_3751493_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
>prophage 280
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3755431	3759334	4718719		Klosneuvirus(100.0%)	1	NA	NA
WP_000139565.1|3755431_3759334_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 281
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3765418	3766408	4718719		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762236.1|3765418_3766408_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	1.5e-70
>prophage 282
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3771368	3778639	4718719	tRNA	Enterobacteria_phage(20.0%)	6	NA	NA
WP_000837921.1|3771368_3772502_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
WP_001300461.1|3772642_3773077_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_000081417.1|3773253_3774189_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.7	1.1e-144
WP_000123779.1|3774317_3775691_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	8.6e-53
WP_000387388.1|3776168_3777152_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628058.1|3777406_3778639_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 283
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3784965	3785481	4718719		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945011.1|3784965_3785481_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
>prophage 284
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3802877	3803960	4718719		Planktothrix_phage(100.0%)	1	NA	NA
WP_072327938.1|3802877_3803960_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	5.6e-23
>prophage 285
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3817964	3819230	4718719		Klosneuvirus(100.0%)	1	NA	NA
WP_000069229.1|3817964_3819230_-	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.0	2.0e-24
>prophage 286
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3832145	3837802	4718719		Bacillus_virus(50.0%)	5	NA	NA
WP_000573407.1|3832145_3832952_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
WP_072327942.1|3833019_3833373_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_000506490.1|3833740_3834529_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_001335988.1|3834672_3835800_+	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_000484984.1|3835867_3837802_+	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.9	3.1e-32
>prophage 287
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3845898	3846489	4718719		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|3845898_3846489_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 288
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3851413	3856705	4718719	protease	Tupanvirus(33.33%)	4	NA	NA
WP_001355506.1|3851413_3854011_-	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	35.6	3.0e-86
WP_001031530.1|3854390_3854642_+	YciN family protein	NA	NA	NA	NA	NA
WP_000422045.1|3854677_3855727_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559286.1|3855946_3856705_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	4.4e-06
>prophage 289
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3863674	3866632	4718719		Acinetobacter_phage(100.0%)	2	NA	NA
WP_000763511.1|3863674_3865270_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_000983912.1|3865270_3866632_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	1.1e-36
>prophage 290
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3878290	3880305	4718719		Bacillus_virus(50.0%)	2	NA	NA
WP_000994905.1|3878290_3879295_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
WP_000110945.1|3879291_3880305_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
>prophage 291
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3888715	3899255	4718719		Citrobacter_phage(25.0%)	10	NA	NA
WP_000068089.1|3888715_3889333_-	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.7e-53
WP_001287378.1|3889936_3890350_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000718995.1|3890493_3891402_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_000193447.1|3891603_3892617_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_001295622.1|3892708_3893614_-	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_001362540.1|3893726_3894185_+	YchJ family protein	NA	NA	NA	NA	NA
WP_000555849.1|3894234_3895077_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001160110.1|3896332_3897010_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000571699.1|3897009_3897720_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_000702660.1|3897716_3899255_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
>prophage 292
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3910510	3910741	4718719		Spodoptera_litura_granulovirus(100.0%)	1	NA	NA
WP_001146444.1|3910510_3910741_-	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	8.5e-06
>prophage 293
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3913839	3917847	4718719		Cafeteria_roenbergensis_virus(50.0%)	5	NA	NA
WP_000811065.1|3913839_3914694_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
WP_001257044.1|3914729_3915539_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_001705045.1|3915542_3915935_-	SirB family protein	NA	NA	NA	NA	NA
WP_000456454.1|3915931_3916765_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000804732.1|3916764_3917847_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
>prophage 294
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3920983	3923735	4718719		Tupanvirus(50.0%)	2	NA	NA
WP_001298109.1|3920983_3921931_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033352.1|3922055_3923735_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
>prophage 295
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3951103	3952791	4718719		Salmonella_phage(50.0%)	2	NA	NA
WP_000457616.1|3951103_3952372_-	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.4	7.9e-210
WP_001705041.1|3952371_3952791_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	61.3	2.6e-37
>prophage 296
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	3970275	4013119	4718719	portal,integrase,tail,holin,terminase,tRNA	Enterobacteria_phage(29.03%)	53	3983548:3983562	4013221:4013235
WP_000332303.1|3970275_3971007_+	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
WP_000373101.1|3971227_3971632_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_032082692.1|3971684_3971795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795380.1|3972030_3972075_+	protein YmgK	NA	NA	NA	NA	NA
WP_001295666.1|3972330_3972654_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
WP_000444488.1|3972756_3974007_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	3.2e-22
WP_001248691.1|3974178_3974832_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|3974841_3975303_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001297484.1|3975356_3976463_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|3976498_3977140_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423743.1|3977143_3978514_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.1	4.2e-108
WP_001265471.1|3978682_3979354_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735412.1|3979353_3980814_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000456506.1|3980889_3982011_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359434.1|3982059_3983286_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|3983535_3984672_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
3983548:3983562	attL	AAAAAATTGAATAAA	NA	NA	NA	NA
WP_000799406.1|3984655_3985519_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_001394135.1|3985750_3986017_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	81.7	9.2e-20
WP_000239880.1|3986073_3986742_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_071597385.1|3986796_3986895_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	75.0	6.1e-06
WP_000985933.1|3988355_3988985_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	100.0	1.2e-102
WP_001072975.1|3988984_3989197_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_032231177.1|3989193_3991296_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	99.6	0.0e+00
WP_000373426.1|3991295_3991790_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	99.4	2.2e-83
WP_000232223.1|3992239_3992605_-	hypothetical protein	NA	A0A220NRM9	Escherichia_phage	99.1	5.8e-57
WP_001228685.1|3992688_3992874_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	80.3	6.4e-20
WP_001700670.1|3993796_3994330_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	97.2	1.1e-99
WP_000193273.1|3994385_3994700_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	99.0	8.3e-52
WP_000839572.1|3994704_3994920_-|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_000193722.1|3995787_3996666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000024152.1|3996915_3997302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000532210.1|3997315_3997666_-	antitermination protein Q	NA	A0A0P0ZCW0	Stx2-converting_phage	85.7	1.5e-54
WP_000904105.1|3997655_3998027_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.8	2.0e-36
WP_001265281.1|3998039_3999089_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	4.5e-110
WP_032289145.1|3999090_3999363_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	6.1e-11
WP_000481765.1|3999464_4000586_-	ImmA/IrrE family metallo-endopeptidase	NA	B6SBZ6	Clostridium_virus	28.7	2.4e-32
WP_001179382.1|4000596_4001190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001355535.1|4001363_4001483_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	84.8	1.2e-08
WP_000200161.1|4001640_4002687_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001151206.1|4003171_4003627_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.2	2.3e-63
WP_001262390.1|4003667_4004738_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	56.6	2.6e-52
WP_000693853.1|4004809_4005235_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001072337.1|4005231_4005486_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
WP_000233320.1|4005565_4005985_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_000379589.1|4006282_4006438_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001171936.1|4006597_4006816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072327945.1|4006838_4007153_+	hypothetical protein	NA	A0A2L1IV26	Escherichia_phage	100.0	6.2e-07
WP_000202162.1|4007980_4008202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449195.1|4008760_4008949_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083284.1|4008945_4009137_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048555.1|4009229_4011701_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.9	1.6e-57
WP_000003742.1|4011762_4012032_+	excisionase	NA	NA	NA	NA	NA
WP_000074976.1|4012000_4013119_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	44.2	4.5e-84
4013221:4013235	attR	AAAAAATTGAATAAA	NA	NA	NA	NA
>prophage 297
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	4016546	4020287	4718719		Vibrio_phage(50.0%)	4	NA	NA
WP_000952737.1|4016546_4017386_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.7e-23
WP_000291270.1|4017401_4018313_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_001251348.1|4018341_4019586_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_001033694.1|4019585_4020287_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.1e-35
>prophage 298
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	4027575	4027833	4718719		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|4027575_4027833_-	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 299
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	4040138	4041781	4718719		Streptococcus_virus(50.0%)	2	NA	NA
WP_001267959.1|4040138_4041143_-	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	31.8	8.4e-05
WP_001257000.1|4041139_4041781_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
>prophage 300
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	4045053	4046235	4718719		Ralstonia_phage(50.0%)	2	NA	NA
WP_000103754.1|4045053_4045290_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
WP_001008535.1|4045500_4046235_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
>prophage 301
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	4058592	4059534	4718719		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001295441.1|4058592_4059534_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 302
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	4075417	4075663	4718719		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|4075417_4075663_+	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 303
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	4080323	4081244	4718719		Morganella_phage(100.0%)	1	NA	NA
WP_000183364.1|4080323_4081244_+	kdo(2)-lipid IV(A) lauroyltransferase	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 304
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	4090552	4091086	4718719		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857405.1|4090552_4091086_-	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	5.9e-26
>prophage 305
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	4095221	4096055	4718719		Pelagibacter_phage(100.0%)	1	NA	NA
WP_032328053.1|4095221_4096055_+	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	39.7	3.3e-39
>prophage 306
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	4101106	4103668	4718719	transposase	Acinetobacter_phage(50.0%)	2	NA	NA
WP_113705713.1|4101106_4102268_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.2	1.2e-50
WP_000409872.1|4102318_4103668_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.2	1.9e-20
>prophage 307
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	4110487	4111276	4718719		Cronobacter_phage(100.0%)	1	NA	NA
WP_000533522.1|4110487_4111276_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	7.8e-91
>prophage 308
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	4126190	4128464	4718719		Enterobacteria_phage(100.0%)	3	NA	NA
WP_001028083.1|4126190_4126685_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	96.9	1.1e-50
WP_001326838.1|4126705_4128034_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	99.1	3.7e-234
WP_001273658.1|4128290_4128464_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
>prophage 309
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	4132769	4145084	4718719		Klosneuvirus(20.0%)	13	NA	NA
WP_000420621.1|4132769_4133690_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
WP_000024560.1|4133689_4133995_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000209894.1|4134146_4134746_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_001062110.1|4134742_4137289_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.3	2.0e-71
WP_001230242.1|4137288_4138461_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001120125.1|4138590_4139283_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001264933.1|4139255_4140284_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001300633.1|4140366_4143111_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.2	2.7e-37
WP_000829664.1|4143182_4144256_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001019197.1|4144304_4144478_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309400.1|4144467_4144698_-	protein YmcE	NA	NA	NA	NA	NA
WP_071524879.1|4144672_4144861_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066490.1|4144871_4145084_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
>prophage 310
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	4165126	4165786	4718719	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000375136.1|4165126_4165786_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 311
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	4170019	4172074	4718719		Bacillus_phage(100.0%)	1	NA	NA
WP_001295354.1|4170019_4172074_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
>prophage 312
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	4184673	4186581	4718719		Tupanvirus(100.0%)	1	NA	NA
WP_000053099.1|4184673_4186581_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.9e-54
>prophage 313
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	4204054	4215024	4718719	tRNA	Bacillus_virus(16.67%)	8	NA	NA
WP_001090506.1|4204054_4204822_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
WP_000193841.1|4204864_4207477_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	7.0e-19
WP_001704954.1|4207742_4208945_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	32.6	3.2e-43
WP_000117881.1|4209113_4210514_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_000977902.1|4211116_4212205_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000462687.1|4212389_4213580_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_001109486.1|4213801_4214449_-	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_001295932.1|4214475_4215024_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
>prophage 314
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	4229729	4234271	4718719		Bacillus_phage(100.0%)	3	NA	NA
WP_000551270.1|4229729_4231478_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_000705764.1|4231514_4233779_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|4233986_4234271_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
>prophage 315
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	4239357	4240446	4718719		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057138.1|4239357_4240446_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
>prophage 316
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	4244544	4247759	4718719		Tetraselmis_virus(100.0%)	2	NA	NA
WP_001292822.1|4244544_4246827_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_000111043.1|4247018_4247759_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
>prophage 317
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	4254067	4277788	4718719	tRNA,protease	Escherichia_phage(16.67%)	16	NA	NA
WP_000213098.1|4254067_4254685_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_032328499.1|4254695_4257140_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.7	2.5e-220
WP_000886683.1|4257378_4258671_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067770.1|4258761_4260105_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.8e-80
WP_001295343.1|4260115_4260727_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077052.1|4260881_4264910_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|4265044_4265539_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|4266083_4267049_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043621.1|4267171_4268938_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001202201.1|4268938_4270660_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	4.9e-21
WP_001241677.1|4270701_4271406_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|4271690_4271909_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934034.1|4272594_4274871_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.1e-166
WP_000520781.1|4274901_4275222_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_001351689.1|4275544_4275769_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188180.1|4275841_4277788_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
>prophage 318
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	4287085	4288804	4718719		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815362.1|4287085_4288804_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	5.2e-31
>prophage 319
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	4292391	4295129	4718719		Roseobacter_phage(50.0%)	4	NA	NA
WP_001255167.1|4292391_4293222_-	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160737.1|4293218_4293542_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270734.1|4293667_4294183_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|4294400_4295129_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
>prophage 320
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	4298489	4307639	4718719		Streptococcus_phage(25.0%)	11	NA	NA
WP_001149756.1|4298489_4299617_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.0	6.0e-28
WP_000389260.1|4299657_4300146_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061665.1|4300205_4301051_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_001093854.1|4301047_4302001_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996005.1|4302010_4303144_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000126073.1|4303238_4304351_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|4304701_4305178_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|4305265_4306168_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000189159.1|4306228_4306951_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201560.1|4306934_4307222_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195240.1|4307381_4307639_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
>prophage 321
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	4316054	4317257	4718719		Stx2-converting_phage(100.0%)	1	NA	NA
WP_001300708.1|4316054_4317257_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	1.1e-99
>prophage 322
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	4328592	4330464	4718719		Planktothrix_phage(100.0%)	1	NA	NA
WP_001301279.1|4328592_4330464_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	5.2e-16
>prophage 323
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	4333679	4342021	4718719		Synechococcus_phage(33.33%)	6	NA	NA
WP_001336208.1|4333679_4334342_-	fructose-6-phosphate aldolase	NA	C7BV14	Synechococcus_phage	32.5	2.8e-25
WP_001295295.1|4334472_4335372_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_000209342.1|4335377_4337810_+	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	44.9	1.6e-09
WP_000114272.1|4337955_4338771_+	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_000168797.1|4338922_4340188_+	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_001706190.1|4340428_4342021_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	9.0e-62
>prophage 324
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	4347018	4352243	4718719		Escherichia_phage(33.33%)	7	NA	NA
WP_001295296.1|4347018_4347534_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
WP_120795379.1|4347586_4347652_-	protein YliM	NA	NA	NA	NA	NA
WP_001295297.1|4347886_4348774_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_000100800.1|4349072_4349576_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_000843877.1|4349979_4350726_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_001159065.1|4350864_4351524_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000569083.1|4351520_4352243_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	42.7	5.6e-35
>prophage 325
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	4355927	4370738	4718719		Erwinia_phage(14.29%)	13	NA	NA
WP_000710619.1|4355927_4356188_+	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
WP_000430057.1|4356452_4358735_+	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000990177.1|4358776_4359454_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
WP_000146340.1|4359527_4359794_+	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
WP_000849301.1|4360058_4360319_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000443530.1|4360547_4361633_-	hydroxycarboxylate dehydrogenase HcXB	NA	NA	NA	NA	NA
WP_000386551.1|4361773_4362736_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_001340191.1|4362763_4364914_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	3.7e-42
WP_001145126.1|4365033_4365516_+	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.0	9.8e-36
WP_000007101.1|4365746_4367111_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001296991.1|4367339_4368011_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000743444.1|4368013_4369009_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_000996107.1|4369001_4370738_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
>prophage 326
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	4382112	4383021	4718719		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295302.1|4382112_4383021_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
>prophage 327
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	4389502	4394871	4718719		Klosneuvirus(33.33%)	4	NA	NA
WP_001295303.1|4389502_4390792_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.5	5.3e-20
WP_000767389.1|4390850_4391327_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_000586337.1|4392072_4393404_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	3.2e-20
WP_001171282.1|4393908_4394871_+	hypothetical protein	NA	A0A0A7NV63	Enterobacteria_phage	91.1	4.0e-174
>prophage 328
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	4398803	4399918	4718719	lysis	Enterobacteria_phage(66.67%)	3	NA	NA
WP_001228696.1|4398803_4398989_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001135263.1|4399205_4399703_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	97.0	9.3e-90
WP_000839596.1|4399702_4399918_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
>prophage 329
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	4404042	4405516	4718719	integrase	Enterobacteria_phage(66.67%)	3	4391418:4391432	4405590:4405604
4391418:4391432	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_000545741.1|4404042_4404210_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	4.9e-27
WP_001303849.1|4404249_4404468_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533646.1|4404445_4405516_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	99.7	1.9e-201
4405590:4405604	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 330
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	4415319	4421893	4718719		Planktothrix_phage(33.33%)	7	NA	NA
WP_000891692.1|4415319_4416378_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.9	1.5e-20
WP_001704886.1|4416380_4417070_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000101984.1|4417069_4417843_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000891515.1|4418009_4418159_-	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_001147447.1|4418287_4419076_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000096869.1|4419143_4420616_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	7.2e-13
WP_001265438.1|4420876_4421893_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	6.1e-80
>prophage 331
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	4426246	4429766	4718719		Klebsiella_phage(33.33%)	4	NA	NA
WP_001109196.1|4426246_4427299_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	3.4e-81
WP_000784351.1|4427614_4427995_+	YbgS-like family protein	NA	NA	NA	NA	NA
WP_000951292.1|4428108_4429050_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	2.2e-23
WP_000345410.1|4429046_4429766_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	9.2e-22
>prophage 332
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	4465943	4466735	4718719		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114026.1|4465943_4466735_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	31.5	2.2e-08
>prophage 333
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	4470113	4473163	4718719		Acinetobacter_phage(50.0%)	2	NA	NA
WP_001032689.1|4470113_4471595_+	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	2.5e-45
WP_001704798.1|4471744_4473163_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.4	4.0e-61
>prophage 334
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	4484206	4490187	4718719		Paramecium_bursaria_Chlorella_virus(33.33%)	4	NA	NA
WP_000087946.1|4484206_4486255_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.0	2.4e-27
WP_001300431.1|4486263_4486836_+	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_001310640.1|4486828_4489513_+	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.8	5.0e-12
WP_000186076.1|4489509_4490187_+	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	30.6	2.0e-26
>prophage 335
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	4499216	4499981	4718719		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000773301.1|4499216_4499981_+	esterase	NA	A0A1J0GVH7	Mycobacterium_phage	35.4	4.4e-06
>prophage 336
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	4504261	4508140	4718719	tRNA	Escherichia_phage(50.0%)	2	NA	NA
WP_001287154.1|4504261_4505926_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.1	0.0e+00
WP_001023104.1|4506193_4508140_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
>prophage 337
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	4512906	4514571	4718719		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337077.1|4512906_4514571_+	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.5	6.1e-85
>prophage 338
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	4518705	4519746	4718719		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001018040.1|4518705_4519746_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.1e-47
>prophage 339
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	4525629	4529162	4718719		Planktothrix_phage(50.0%)	3	NA	NA
WP_000631384.1|4525629_4526355_+	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
WP_001207520.1|4526472_4527408_+	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000367904.1|4527491_4529162_+	molecular chaperone HscC	NA	E5ESM6	Bathycoccus_sp._RCC1105_virus	32.4	2.6e-75
>prophage 340
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	4536101	4538684	4718719	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001340834.1|4536101_4538684_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.5	1.0e-184
>prophage 341
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	4545694	4548133	4718719		Synechococcus_phage(50.0%)	2	NA	NA
WP_001231430.1|4545694_4546783_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
WP_001092082.1|4546921_4548133_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
>prophage 342
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	4552947	4553594	4718719		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_000939737.1|4552947_4553331_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	8.9e-24
WP_000034825.1|4553384_4553594_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
>prophage 343
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	4569019	4571134	4718719		Morganella_phage(50.0%)	2	NA	NA
WP_000278509.1|4569019_4569448_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
WP_000887629.1|4569568_4571134_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
>prophage 344
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	4574317	4575538	4718719		Streptococcus_phage(100.0%)	1	NA	NA
WP_000029821.1|4574317_4575538_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	33.0	1.2e-58
>prophage 345
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	4590686	4597506	4718719		Klosneuvirus(50.0%)	2	NA	NA
WP_000140647.1|4590686_4591502_+	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
WP_000077805.1|4593624_4597506_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.0	1.6e-59
>prophage 346
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	4602485	4655192	4718719	integrase,transposase,protease,tRNA,lysis	Enterobacteria_phage(45.45%)	47	4591708:4591767	4663641:4664408
4591708:4591767	attL	GGTAGTGACTCCAACTTACTGATAGTGTTTTATGTTCAGATAATGCCCGATGACCTTGTC	NA	NA	NA	NA
WP_001393886.1|4602485_4603598_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000956455.1|4603674_4603827_-	type I toxin-antitoxin system toxin HokE	NA	NA	NA	NA	NA
WP_001130653.1|4604279_4605398_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_000682524.1|4605463_4605712_+	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
WP_000360951.1|4605776_4606145_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000351480.1|4606238_4606892_+	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_001153148.1|4606999_4608247_+	mechanosensitive ion channel YbdG	NA	NA	NA	NA	NA
WP_000786320.1|4608314_4609691_-	phenylalanine transporter	NA	NA	NA	NA	NA
WP_000573945.1|4609792_4612936_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	2.2e-59
WP_000717157.1|4612947_4614171_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
WP_000709870.1|4614186_4614519_-	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF	NA	NA	NA	NA	NA
WP_000074234.1|4614676_4616050_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel CusC	NA	NA	NA	NA	NA
WP_000770953.1|4616206_4616890_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_000253838.1|4616879_4618328_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	NA	NA	NA	NA
WP_032327979.1|4619064_4620966_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.5	9.6e-26
WP_001160804.1|4620993_4621455_+	DcrB-related protein	NA	NA	NA	NA	NA
WP_001289021.1|4621474_4625728_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_071608736.1|4625734_4625992_+	RHS repeat-associated core domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	52.9	1.4e-12
WP_000889443.1|4626024_4626285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001300892.1|4626410_4626572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072327956.1|4627535_4628672_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001355527.1|4631166_4634139_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001224564.1|4634139_4635030_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177481.1|4635212_4635974_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
WP_001201820.1|4636487_4637441_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001393528.1|4638475_4639216_-	DNA-binding transcriptional activator AppY	NA	NA	NA	NA	NA
WP_000355602.1|4639891_4640185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000235988.1|4640195_4640900_-	hypothetical protein	NA	A0A1X7QGH6	Escherichia_phage	61.1	3.0e-57
WP_000654156.1|4640909_4641191_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	4.1e-18
WP_001395371.1|4641187_4641880_-	hypothetical protein	NA	A0A0E3M194	Enterobacteria_phage	41.8	1.1e-40
WP_000453611.1|4642290_4642836_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_001415975.1|4643224_4643419_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.9	4.3e-27
WP_000738423.1|4643778_4644072_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|4644162_4644345_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001135280.1|4644561_4645059_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.6	1.1e-90
WP_000839596.1|4645058_4645274_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737293.1|4645862_4646945_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	79.8	3.5e-166
WP_001204791.1|4647134_4647518_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_001393963.1|4647603_4647744_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	65.1	3.6e-07
WP_001099705.1|4647740_4648103_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	9.5e-60
WP_000488419.1|4648172_4648451_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	98.9	1.7e-48
WP_000051902.1|4648649_4649813_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_001310555.1|4650691_4651708_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_000729160.1|4652061_4652928_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|4652929_4653142_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143558.1|4653249_4653771_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912345.1|4653806_4655192_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
4663641:4664408	attR	GACAAGGTCATCGGGCATTATCTGAACATAAAACACTATCAGTAAGTTGGAGTCACTACCGACTACCGGTACCCGATATTGCGCCATTAAGGCTTTCGCCTGTTCAAAGGCTGGCGCAATATCTTCCGGTTTGAAGACCCGAATAGCTTTACAACCTAAACCTTCCGCTACTTTTACGTGGTCAACACCGTAGCCATTCACTTCACTGGAGTTGATATTCTCGAAAGCGAGTTGCACGCAGTAGTCCATGTCAAAAGCGCGTTGTGACTGACGAATCAGGCCGAGATAGGCGTTATTCACCAGCACATGGATGTACGGAATGTTGAACTGCGCGCCAACGGCTAACTCTTCAATCAGGAACTGGAAGTCAAAGTCGCCAGAAATCGCCACCACATTGCGTTTCGGATCAGCGGCACAAACCCCCAGCGCCGCCGGAATCGTCCAGCCTAACGGACCAGCCTGACCACAGTTGATCCAGTGGCGGTCTTTAAAGACATGCAGCATTTGTGCCGCAGCGATTTGTGACAGACCAATGGTGGTGACATAGCAAACATCGCGACCAAAGGCTTTGTTCATCTCTTCATACACGCGCTGCGGTTTCACCGGCACGTTGTCGAAATGGGTTTTGCGCAGCAAAGTGCGTTTGCGCTGCTGGCAGTCGGCGACCCATTCTTTACGACACGGCAGACGACCCGCTTTTTGCATCTCCTGCGCCACTTCAACCAGCAGTGTCAGCGCCGCTTTAGCATCAGAGACAATGCCGAGATC	NA	NA	NA	NA
>prophage 347
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	4670948	4683017	4718719	transposase	Stx2-converting_phage(50.0%)	8	NA	NA
WP_000381401.1|4670948_4672520_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.3	1.9e-168
WP_000624622.1|4672539_4672887_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001704819.1|4672886_4673564_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_001300714.1|4674091_4674802_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.9	7.2e-19
WP_000877768.1|4674801_4675170_-	YbbC/YhhH family protein	NA	NA	NA	NA	NA
WP_072327958.1|4675209_4679490_-	rhs element protein RhsD	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.1	1.7e-22
WP_000561872.1|4679919_4682334_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001110573.1|4682330_4683017_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
>prophage 348
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	4686153	4686831	4718719		Bacillus_virus(100.0%)	1	NA	NA
WP_001157540.1|4686153_4686831_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	1.4e-27
>prophage 349
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	4691370	4694532	4718719		uncultured_virus(50.0%)	2	NA	NA
WP_000083955.1|4691370_4693875_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	2.9e-115
WP_032328471.1|4694190_4694532_-	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	74.5	1.2e-40
>prophage 350
NZ_CP017844	Escherichia coli strain FMU073332 chromosome, complete genome	4718719	4702776	4711338	4718719		Acanthamoeba_polyphaga_moumouvirus(25.0%)	8	NA	NA
WP_000801850.1|4702776_4703736_+	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.3	6.5e-15
WP_001250088.1|4703732_4704695_-	ferrochelatase	NA	NA	NA	NA	NA
WP_001220233.1|4704930_4705575_-	adenylate kinase	NA	NA	NA	NA	NA
WP_072327962.1|4705755_4707630_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	2.3e-117
WP_001195025.1|4707739_4708345_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_000467098.1|4708344_4708674_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_000122013.1|4708726_4710658_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000127356.1|4710786_4711338_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
>prophage 1
NZ_CP017848	Escherichia coli strain FMU073332 plasmid pEcoFMU07332d	137665	3182	52085	137665	integrase,transposase	Escherichia_phage(31.25%)	51	2231:2243	22934:22946
2231:2243	attL	TTTTTCAGTTTTT	NA	NA	NA	NA
WP_000016960.1|3182_3989_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	93.9	1.7e-53
WP_001159871.1|3989_4295_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_072328065.1|4296_4515_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_000343095.1|5036_5294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032328642.1|5293_5836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160371899.1|6079_6922_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_064734538.1|6924_8013_+	putative hexosyltransferase CapU	NA	NA	NA	NA	NA
WP_032328199.1|8017_8968_+	virulence factor VirK	NA	NA	NA	NA	NA
WP_001420717.1|9032_9977_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_000115001.1|10893_11403_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.0	8.8e-19
WP_000865086.1|11779_12067_-	helix-turn-helix transcriptional regulator	NA	O64356	Escherichia_phage	87.4	5.1e-40
WP_000483538.1|12066_12378_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2I6TCA4	Escherichia_phage	93.1	3.6e-47
WP_072328067.1|13349_14207_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001365705.1|14199_14274_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000083830.1|14510_14765_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001393319.1|15004_15595_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_001393151.1|15746_16373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297500.1|16784_16994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000840475.1|17124_17685_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_000704511.1|17787_18648_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.0	2.3e-11
WP_000138370.1|20383_20776_-	F-type conjugal transfer protein TrbF	NA	NA	NA	NA	NA
WP_071594518.1|20729_21104_-	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_001230775.1|21515_22244_-	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_000399782.1|22230_22797_-	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_000012113.1|22818_23130_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
22934:22946	attR	TTTTTCAGTTTTT	NA	NA	NA	NA
WP_001098998.1|23134_23497_-	type IV conjugative transfer system pilin TraA	NA	NA	NA	NA	NA
WP_000089263.1|23529_23757_-	conjugal transfer relaxosome protein TraY	NA	NA	NA	NA	NA
WP_072328069.1|23893_24565_-	conjugal transfer transcriptional regulator TraJ	NA	NA	NA	NA	NA
WP_001310555.1|24686_25703_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_000124827.1|25957_26341_-	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_013188482.1|26663_27266_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_001393327.1|27561_28383_-	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	1.7e-43
WP_000107522.1|28499_28787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001272235.1|28942_29245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072328073.1|30159_30318_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001276221.1|30588_31308_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_000845954.1|31304_31739_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001254933.1|34256_35408_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_013188479.1|36631_37006_-	heat-labile enterotoxin LT subunit B	NA	D1GID8	Vibrio_virus	79.8	3.7e-51
WP_001378495.1|37002_37779_-	heat-labile enterotoxin LT subunit A	NA	A0A023W6A1	Vibrio_virus	80.2	6.5e-122
WP_000019162.1|38094_38367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001189123.1|40800_42309_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_013188501.1|44659_44878_-	heat-stable enterotoxin ST-I group b	NA	NA	NA	NA	NA
WP_000471255.1|45867_46197_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	43.0	2.6e-08
WP_000780221.1|46177_46459_+	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	37.0	6.5e-08
WP_000710536.1|46781_47726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001393279.1|47792_48143_-	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_000959870.1|48145_49108_-	plasmid segregation protein ParM	NA	A0A222YXF2	Escherichia_phage	53.9	4.1e-94
WP_000219392.1|49574_50591_+|transposase	IS110-like element ISShdy1 family transposase	transposase	NA	NA	NA	NA
WP_000343720.1|50706_51915_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.7	9.6e-48
WP_044307862.1|51911_52085_+|transposase	transposase domain-containing protein	transposase	A0A0P0ZBS5	Stx2-converting_phage	65.9	2.3e-11
>prophage 1
NZ_CP017846	Escherichia coli strain FMU073332 plasmid pEcoFMU073332b	47563	6126	17232	47563	transposase	Stx2-converting_phage(37.5%)	10	NA	NA
WP_001178556.1|6126_6645_+	hypothetical protein	NA	G9L6B3	Escherichia_phage	68.5	1.3e-57
WP_000775238.1|6820_6982_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001272251.1|7891_8188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001705702.1|8298_9105_+	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.1	1.9e-44
WP_000381401.1|9131_10703_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.3	1.9e-168
WP_000624622.1|10722_11070_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|11069_11747_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_072328008.1|12516_14049_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	35.0	3.1e-43
WP_001254933.1|14337_15489_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000361613.1|16254_17232_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	59.5	3.9e-100
>prophage 1
NZ_CP017847	Escherichia coli strain FMU073332 plasmid pEcoFMU073332c, complete sequence	113343	0	113089	113343	tRNA,integrase,portal,transposase,terminase,tail	Salmonella_phage(87.0%)	115	102105:102124	112696:112715
WP_162992118.1|1061_1544_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	69.9	1.8e-50
WP_023145136.1|1599_2376_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	41.1	1.4e-52
WP_024175975.1|2454_3567_-	hypothetical protein	NA	J9Q720	Salmonella_phage	93.8	2.6e-209
WP_000137333.1|3714_5055_-	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	93.5	3.4e-235
WP_001295213.1|5519_6542_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.8	2.5e-198
WP_001297096.1|6541_7321_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000342417.1|8080_8848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160378290.1|8900_9254_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.4e-44
WP_000161228.1|9259_9928_-	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	91.4	1.7e-110
WP_001351987.1|10246_10516_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_000072677.1|10523_11045_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000901559.1|11213_11465_-	hypothetical protein	NA	J9Q7R6	Salmonella_phage	75.6	2.0e-24
WP_012640731.1|11466_12159_-	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	93.9	1.8e-123
WP_001717323.1|12172_12496_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	89.7	5.9e-45
WP_077891209.1|12698_15365_-|tail	tail fiber protein	tail	A0A0E3GML4	Enterobacteria_phage	55.1	6.5e-04
WP_049592658.1|16820_21548_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	74.2	0.0e+00
WP_001293195.1|21565_22159_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	90.9	2.0e-99
WP_000526939.1|22146_22944_-	C40 family peptidase	NA	J9Q7R4	Salmonella_phage	93.6	1.3e-154
WP_000511445.1|22936_23635_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	96.6	1.5e-133
WP_072328011.1|23717_24053_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	85.5	1.5e-51
WP_072328014.1|24095_28673_-	tape measure protein	NA	J9Q712	Salmonella_phage	80.8	0.0e+00
WP_000952686.1|28680_28905_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	94.6	8.8e-32
WP_000163861.1|29030_29348_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	96.2	8.6e-49
WP_000072377.1|29403_30150_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	93.5	2.8e-122
WP_021512326.1|30224_30608_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	81.9	2.3e-56
WP_000523628.1|30609_31083_-	hypothetical protein	NA	J9Q711	Salmonella_phage	90.4	3.3e-76
WP_001027663.1|31073_31418_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	95.6	2.3e-55
WP_033803027.1|31497_32331_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	91.7	1.8e-141
WP_000801186.1|32330_32765_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	81.9	1.9e-59
WP_072328016.1|32809_33730_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	83.9	2.8e-132
WP_001130339.1|33803_34679_-	hypothetical protein	NA	J9Q710	Salmonella_phage	93.8	4.2e-154
WP_072328019.1|34704_35592_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	88.9	2.1e-132
WP_000422362.1|35613_37188_-|portal	phage portal protein	portal	J9Q7R1	Salmonella_phage	93.1	6.4e-286
WP_001007299.1|37214_38471_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	96.4	7.5e-245
WP_021520109.1|38470_39103_-	hypothetical protein	NA	J9Q6D4	Salmonella_phage	83.8	2.4e-90
WP_000176292.1|39299_39566_-	hypothetical protein	NA	J9Q757	Salmonella_phage	88.6	1.4e-36
WP_000129633.1|39575_40466_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	98.6	2.6e-167
WP_001717191.1|40462_41128_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	98.6	2.8e-110
WP_000161986.1|41124_41793_-	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	89.6	5.6e-106
WP_063091540.1|41792_42473_-	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	88.1	2.7e-108
WP_012640739.1|42555_44115_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	91.9	3.2e-277
WP_001291061.1|44117_44396_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	58.2	4.6e-22
WP_012640740.1|44428_45028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063277800.1|45412_46213_-	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	32.5	1.2e-06
WP_012640742.1|46315_46837_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	79.1	3.4e-66
WP_072328021.1|47132_47783_+	hypothetical protein	NA	J9Q754	Salmonella_phage	84.7	4.9e-99
WP_072328024.1|47830_48061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001009193.1|48677_49160_-	hypothetical protein	NA	J9Q805	Salmonella_phage	69.8	7.9e-62
WP_001711139.1|49364_49646_-	hypothetical protein	NA	J9Q753	Salmonella_phage	80.6	9.4e-39
WP_001755487.1|49981_50356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001717183.1|50473_50869_-	hypothetical protein	NA	J9Q7I1	Salmonella_phage	53.8	1.6e-31
WP_000749407.1|50995_51307_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	63.1	5.7e-29
WP_021533329.1|51460_51790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047659412.1|53362_54553_-	hypothetical protein	NA	J9Q803	Salmonella_phage	55.6	3.1e-123
WP_024269800.1|54723_55023_-	hypothetical protein	NA	J9Q750	Salmonella_phage	42.9	1.8e-19
WP_001755492.1|55184_57218_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	24.1	2.2e-44
WP_000004356.1|57375_58476_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_072328026.1|58513_58903_-	DNA repair protein	NA	A0A077SK24	Escherichia_phage	92.2	5.6e-66
WP_072328028.1|59067_59253_-	DNA polymerase III subunit theta	NA	Q71T70	Escherichia_phage	91.8	2.1e-23
WP_001755496.1|59610_61167_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.9	1.9e-104
WP_001293038.1|61163_62411_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_000149672.1|62532_65649_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.2	2.2e-27
WP_001090450.1|65707_66184_-	hypothetical protein	NA	J9Q747	Salmonella_phage	89.2	6.0e-78
WP_000467663.1|66287_66902_-	hypothetical protein	NA	A0A0E3GMH9	Enterobacteria_phage	82.4	2.7e-99
WP_000335122.1|67240_67810_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	61.4	1.4e-52
WP_000893471.1|67949_68108_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000900262.1|68107_68533_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	80.1	4.4e-56
WP_001104328.1|68626_68815_-	hypothetical protein	NA	J9Q800	Salmonella_phage	51.6	9.4e-11
WP_001348724.1|68824_69319_-	hypothetical protein	NA	J9Q6J9	Salmonella_phage	55.4	5.2e-24
WP_000208893.1|69467_70058_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	82.2	5.8e-91
WP_000121544.1|70644_70875_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	84.2	5.9e-31
WP_021520510.1|71061_71655_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	85.8	1.7e-98
WP_072328032.1|71838_72648_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	52.9	5.2e-66
WP_000208156.1|72808_73366_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	83.6	2.8e-87
WP_000490619.1|73375_73795_-	hypothetical protein	NA	J9Q743	Salmonella_phage	71.9	1.9e-51
WP_000386470.1|73856_74501_-	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	81.8	4.6e-97
WP_014962281.1|74500_74977_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	89.2	1.3e-80
WP_000289389.1|74973_75375_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	87.2	5.1e-62
WP_001308885.1|75388_76492_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	87.7	1.3e-192
WP_001011861.1|76662_77532_-	hypothetical protein	NA	J9Q742	Salmonella_phage	80.6	5.3e-133
WP_000122502.1|77609_78752_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	88.7	2.6e-196
WP_063277822.1|78852_81168_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	84.4	0.0e+00
WP_000037962.1|81241_81811_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	86.8	1.1e-91
WP_000008655.1|81820_82564_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	47.2	2.0e-51
WP_072328034.1|82553_84470_-	AAA family ATPase	NA	J9Q741	Salmonella_phage	73.2	3.4e-249
WP_072328036.1|84699_85785_-	metallophosphoesterase	NA	J9Q7S9	Salmonella_phage	87.3	3.0e-186
WP_000364573.1|86039_86684_-	hypothetical protein	NA	J9Q739	Salmonella_phage	86.3	2.9e-107
WP_001293471.1|87427_88483_+	replication protein RepA	NA	J9Q7H0	Salmonella_phage	91.0	5.4e-172
WP_012640712.1|88971_89184_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	92.9	1.3e-32
WP_000644408.1|89183_89519_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	73.9	6.6e-39
WP_012640713.1|89734_90010_-	hypothetical protein	NA	J9Q738	Salmonella_phage	73.6	5.8e-33
WP_000125192.1|90065_90491_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	75.4	5.0e-60
WP_000715581.1|90582_91413_-	hypothetical protein	NA	J9Q7Z4	Salmonella_phage	94.9	3.1e-122
WP_072328039.1|91416_91617_-	hypothetical protein	NA	J9Q6J0	Salmonella_phage	57.6	3.6e-08
WP_042063068.1|91709_94049_-	recombinase RecA	NA	J9Q736	Salmonella_phage	85.1	1.8e-29
WP_072328041.1|94051_94318_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	77.3	2.6e-30
WP_001755518.1|94317_95262_-	5'-3' exonuclease SAM fold family protein	NA	J9Q7S6	Salmonella_phage	88.9	1.0e-161
WP_001717300.1|95322_96351_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	86.3	1.4e-143
WP_001090697.1|96468_96900_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	83.9	9.9e-64
WP_001351985.1|97154_97379_+	hypothetical protein	NA	J9Q735	Salmonella_phage	56.9	2.2e-14
WP_001240351.1|97439_98003_+	hypothetical protein	NA	J9Q7G7	Salmonella_phage	67.7	1.3e-66
WP_000066497.1|98332_98548_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	77.1	2.9e-24
WP_072328043.1|98851_102370_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	93.0	0.0e+00
102105:102124	attL	AATGATTCCATACATCTCAT	NA	NA	NA	NA
WP_001717302.1|102550_103786_-	AAA family ATPase	NA	J9Q733	Salmonella_phage	81.3	2.3e-198
WP_072328045.1|103881_105990_-	cobalamin biosynthesis protein CobT	NA	J9Q7G6	Salmonella_phage	66.2	4.8e-228
WP_012640719.1|106088_106301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001282576.1|106552_106939_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000797845.1|106933_108037_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	33.8	1.3e-27
WP_072328047.1|108210_108621_-	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
WP_169017105.1|108630_109239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072328049.1|109334_109580_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	44.9	3.5e-13
WP_001755525.1|109753_110662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000067985.1|112274_112565_-	hypothetical protein	NA	J9Q7S1	Salmonella_phage	79.2	2.4e-37
WP_072328051.1|112710_112926_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	71.0	7.4e-20
112696:112715	attR	ATGAGATGTATGGAATCATT	NA	NA	NA	NA
WP_016607331.1|112909_113089_-	hypothetical protein	NA	J9Q729	Salmonella_phage	70.7	8.4e-17
