The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018206	Escherichia coli strain MRSN346647 chromosome, complete genome	5041399	337745	405353	5041399	transposase,protease,tRNA	Vibrio_phage(18.75%)	57	NA	NA
WP_001162184.1|337745_339098_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_001232255.1|339152_339539_+	cytochrome b562	NA	NA	NA	NA	NA
WP_001106226.1|339583_340048_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	59.7	2.5e-52
WP_000187791.1|340207_342346_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.6	9.1e-267
WP_038432234.1|342739_344395_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_001299664.1|344444_345866_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001181324.1|345984_346932_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001387276.1|347116_347170_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471866.1|347310_350007_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_000047539.1|350212_350599_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|350671_351133_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|351145_352081_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_001296693.1|352084_352219_-	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000230281.1|352499_352895_-	RidA family protein	NA	NA	NA	NA	NA
WP_000500727.1|353025_353739_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000256656.1|353809_354403_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001336307.1|354547_355000_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_001368705.1|355122_356466_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001309158.1|356452_356683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000012907.1|356783_357788_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000002953.1|357949_358366_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_001398296.1|358411_358915_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001395227.1|359107_360304_+	DUF898 domain-containing protein	NA	NA	NA	NA	NA
WP_016234053.1|360359_363215_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.8e-140
WP_000786399.1|363214_363658_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|364011_365523_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584114.1|365789_366890_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|366889_367972_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001398298.1|368132_369635_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	7.9e-84
WP_001309159.1|369712_370711_-	DNA-binding transcriptional regulator IdnR	NA	NA	NA	NA	NA
WP_001128335.1|370777_372097_-	gnt-II system L-idonate transporter	NA	NA	NA	NA	NA
WP_016234056.1|372161_372926_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_001395232.1|372949_373981_-	L-idonate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000896738.1|374197_374761_+	gluconokinase	NA	NA	NA	NA	NA
WP_001318460.1|374764_375784_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	1.4e-44
WP_000483767.1|380341_381688_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_000179691.1|382296_383514_+	MFS transporter	NA	NA	NA	NA	NA
WP_000611568.1|383525_384644_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_072276551.1|384686_384812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000254999.1|384864_385122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085948656.1|385435_386602_+|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	99.3	1.8e-184
WP_000625671.1|386537_386951_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_001293436.1|387013_389011_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_000336726.1|389164_389983_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
WP_000088391.1|390018_390321_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000177057.1|391254_391512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072617189.1|392068_392836_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	1.4e-12
WP_000684856.1|392836_393793_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000125187.1|393789_394788_-	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000879164.1|394784_395687_-	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000188262.1|395731_398056_-	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_001068910.1|398142_399096_-	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_001283626.1|399092_399614_-	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_000555341.1|401362_401620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000937727.1|401782_401992_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.0	5.9e-06
WP_000823243.1|402370_403729_+	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_072617190.1|403967_405353_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.1	1.7e-258
>prophage 2
NZ_CP018206	Escherichia coli strain MRSN346647 chromosome, complete genome	5041399	752161	825209	5041399	transposase,protease,tRNA,plate	Emiliania_huxleyi_virus(11.11%)	57	NA	NA
WP_001520521.1|752161_753514_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|753543_755976_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|756097_756583_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139287.1|756586_757612_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|757716_758172_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|758175_758964_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_001550626.1|758963_760112_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_049067785.1|760108_760705_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	4.6e-27
WP_001294781.1|760741_764224_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	37.0	2.2e-209
WP_049067789.1|764236_765196_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020973.1|765293_767435_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|767491_767881_+	VOC family protein	NA	NA	NA	NA	NA
WP_001550628.1|767945_769244_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062311.1|769292_769553_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|769539_769740_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185287.1|769905_770451_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635534.1|770447_770870_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_072617202.1|770883_771594_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001550629.1|771624_772449_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260708.1|772501_774220_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094022.1|774330_775038_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|775034_775439_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874224.1|775556_776372_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|776411_777065_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|777057_778089_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140178.1|778275_778848_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997053.1|784604_785408_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	5.4e-39
WP_000648583.1|785404_786319_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|786559_787360_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_001550637.1|787437_788208_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|788254_789613_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052732.1|789684_790440_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001308373.1|790473_791196_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|791192_791660_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001308374.1|791724_792456_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
WP_001086163.1|792994_793780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000908071.1|794404_795319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000002621.1|795362_795845_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001563736.1|795868_797221_-	type VI secretion system protein VasL	NA	NA	NA	NA	NA
WP_122989438.1|797231_800666_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240537.1|800774_802187_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_001550641.1|802191_802935_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_072617203.1|802931_805793_-	AAA domain-containing protein	NA	A0A1C3S747	Escherichia_phage	29.6	2.5e-78
WP_001521863.1|805801_806563_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246418.1|806567_807899_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|807901_808426_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_072617204.1|808422_809703_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348804.1|809727_810810_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001521865.1|810773_812624_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_001521866.1|812627_813041_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_001550644.1|813047_814523_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_001521869.1|814573_814798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037390.1|814832_815333_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|816029_816548_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001550647.1|816757_818899_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	24.8	1.8e-25
WP_001077735.1|823474_823852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024192499.1|824072_825209_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP018206	Escherichia coli strain MRSN346647 chromosome, complete genome	5041399	1152120	1228643	5041399	tRNA,tail,lysis,transposase,capsid,terminase,integrase,protease,head	Enterobacteria_phage(57.14%)	88	1162271:1162317	1220116:1220162
WP_000912345.1|1152120_1153506_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001586752.1|1153541_1154063_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|1154170_1154383_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729155.1|1154384_1155251_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|1155721_1156264_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988364.1|1156483_1157176_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001595419.1|1157206_1159816_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001595421.1|1159828_1160836_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001595422.1|1160846_1161362_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805414.1|1161364_1161997_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
1162271:1162317	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001361259.1|1162330_1163494_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.3	3.4e-199
WP_072018400.1|1163349_1163721_-	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	1.0e-45
WP_000488407.1|1163692_1163971_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000763385.1|1164018_1164237_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_077893262.1|1164329_1164617_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	9.5e-47
WP_000548537.1|1164627_1164819_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_000149544.1|1164791_1164974_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000611716.1|1164970_1165651_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	3.0e-131
WP_000100847.1|1165647_1166433_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995455.1|1166438_1166735_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	8.1e-49
WP_137473802.1|1166810_1167101_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	80.6	5.5e-26
WP_000866321.1|1167492_1167870_-	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	49.2	1.3e-30
WP_000380252.1|1167847_1168909_-	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	42.0	2.9e-64
WP_000712396.1|1168989_1169682_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	85.3	2.5e-109
WP_000184665.1|1169792_1170020_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_001182883.1|1170050_1170590_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.7	6.8e-62
WP_072617395.1|1170676_1171606_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.4	4.3e-112
WP_001545280.1|1171602_1172304_+	replication protein P	NA	M1FJ72	Enterobacteria_phage	98.7	5.4e-128
WP_072617220.1|1172543_1176452_+	adhesin	NA	NA	NA	NA	NA
WP_072198841.1|1176652_1176754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053029.1|1176750_1177206_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	3.7e-61
WP_000224907.1|1177205_1177376_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774479.1|1177368_1177659_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	2.3e-48
WP_072617221.1|1177655_1178018_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	96.5	2.1e-59
WP_000971071.1|1178014_1178155_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	2.5e-08
WP_001204777.1|1178240_1178618_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.2	7.3e-55
WP_000780581.1|1178773_1179298_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
WP_000592546.1|1179490_1180450_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_001146309.1|1180801_1181533_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000839582.1|1181721_1181937_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
WP_001135296.1|1181936_1182434_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	1.6e-89
WP_001228695.1|1182650_1182833_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738421.1|1182923_1183217_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_000453580.1|1183886_1184432_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
WP_001027292.1|1184406_1186332_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	100.0	0.0e+00
WP_000198149.1|1186328_1186535_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_000123307.1|1188112_1189432_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.5	6.7e-236
WP_001297109.1|1189441_1189774_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	100.0	2.2e-55
WP_001365132.1|1189835_1190105_+|capsid	capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	100.0	5.3e-39
WP_000896724.1|1190237_1191473_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	44.9	1.1e-99
WP_000737990.1|1191474_1191705_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_016230965.1|1191722_1192544_+	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_000872983.1|1192675_1193032_-	SWIM zinc finger family protein	NA	NA	NA	NA	NA
WP_024164959.1|1193059_1193251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077893268.1|1193261_1193594_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000999172.1|1193586_1193811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000790823.1|1193813_1194101_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000817023.1|1194097_1195918_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	50.6	4.9e-128
WP_000125506.1|1196205_1196451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126719.1|1196447_1196897_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000228111.1|1197114_1198155_+|capsid	phage capsid protein	capsid	C6ZCY2	Enterobacteria_phage	42.1	5.7e-65
WP_000190773.1|1198164_1198506_+|head	head decoration protein	head	NA	NA	NA	NA
WP_001178672.1|1198517_1198901_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000688840.1|1199499_1200642_-	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_137583706.1|1200875_1201640_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.6	8.3e-138
WP_072617222.1|1201681_1202080_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	90.9	2.2e-57
WP_052931395.1|1202091_1202445_+|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.0e-62
WP_000975070.1|1202456_1203035_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
WP_000683128.1|1203031_1203427_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	6.5e-70
WP_021572152.1|1203434_1204175_+|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	98.8	1.1e-131
WP_000479162.1|1204190_1204613_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	97.1	2.8e-71
WP_000459474.1|1204594_1205029_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	90.0	9.0e-57
WP_072617223.1|1205021_1207583_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	90.3	0.0e+00
WP_000847339.1|1207579_1207909_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	97.2	2.8e-58
WP_001551186.1|1207908_1208607_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	8.9e-131
WP_072617224.1|1208612_1209356_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	7.7e-149
WP_162780150.1|1209292_1209925_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	97.1	1.2e-94
WP_019843055.1|1209985_1213384_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	89.9	0.0e+00
WP_077893270.1|1213442_1215797_+|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	50.1	1.7e-117
WP_001544317.1|1215796_1216066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000256863.1|1216078_1216762_+|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	60.6	4.9e-57
WP_000386784.1|1217740_1218490_+	DNA-binding transcriptional activator AppY	NA	NA	NA	NA	NA
WP_001201842.1|1218738_1219692_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001586781.1|1220213_1220966_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
1220116:1220162	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001586783.1|1221148_1222039_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_049067283.1|1222039_1225012_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000383920.1|1224998_1227236_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_001550768.1|1227506_1228643_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP018206	Escherichia coli strain MRSN346647 chromosome, complete genome	5041399	1564893	1589522	5041399	integrase,protease,transposase	uncultured_Mediterranean_phage(14.29%)	18	1559196:1559209	1573444:1573457
1559196:1559209	attL	ATATCATCAACCGG	NA	NA	NA	NA
WP_000520781.1|1564893_1565214_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|1565244_1567521_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000279862.1|1568395_1569604_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.2	6.5e-44
WP_000164164.1|1569827_1571393_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_001349431.1|1571408_1571657_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001242278.1|1571757_1573581_+	hypothetical protein	NA	NA	NA	NA	NA
1573444:1573457	attR	CCGGTTGATGATAT	NA	NA	NA	NA
WP_000282094.1|1574790_1575354_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000609175.1|1576377_1576743_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	93.8	2.0e-57
WP_012311606.1|1577098_1578718_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_012311662.1|1578743_1578896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000876712.1|1580353_1581121_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000433876.1|1581120_1581861_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	27.2	3.5e-08
WP_001084506.1|1581875_1583768_+	DUF4422 domain-containing protein	NA	NA	NA	NA	NA
WP_000828112.1|1583786_1584941_+	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	41.6	7.7e-79
WP_000683047.1|1584937_1585828_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_160379547.1|1585828_1586974_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_000654812.1|1588257_1589226_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.7	2.1e-186
WP_023154714.1|1589222_1589522_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP018206	Escherichia coli strain MRSN346647 chromosome, complete genome	5041399	2071472	2122875	5041399	tRNA,tail,lysis,holin,terminase,integrase	Escherichia_phage(46.15%)	61	2062368:2062383	2104834:2104849
2062368:2062383	attL	ATCGCAGCAATAAAAA	NA	NA	NA	NA
WP_001314661.1|2071472_2072705_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|2072959_2073943_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001551034.1|2074420_2075794_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157407.1|2075922_2076858_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_072617251.1|2076909_2078145_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.0	1.5e-237
WP_000079604.1|2078146_2078362_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|2078440_2078650_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|2078642_2078837_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|2078892_2079702_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_072617252.1|2079694_2082295_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.4	4.7e-249
WP_001372690.1|2082394_2082670_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	97.8	4.7e-43
WP_065336296.1|2082744_2082915_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	71.4	1.0e-16
WP_000560223.1|2082914_2083136_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_000379561.1|2083557_2083710_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_001420344.1|2084002_2084341_-	peptidase S24	NA	H9C160	Pectobacterium_phage	32.0	2.5e-06
WP_000747951.1|2084732_2084975_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693850.1|2084958_2085384_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262390.1|2085455_2086526_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	56.6	2.6e-52
WP_001151150.1|2086566_2086989_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.6e-64
WP_000761441.1|2086989_2087403_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	2.0e-58
WP_001224662.1|2087496_2087679_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_072617253.1|2088349_2088568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000936611.1|2088542_2088725_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	74.5	2.8e-12
WP_000813256.1|2088825_2088981_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	98.0	5.0e-18
WP_001429486.1|2089439_2089718_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	4.3e-12
WP_069903893.1|2089719_2090769_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.0e-109
WP_069903894.1|2090781_2091138_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.8	5.2e-34
WP_001545909.1|2091152_2091974_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.8e-77
WP_000562553.1|2092869_2093001_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_001333560.1|2093281_2093617_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	1.4e-44
WP_072147991.1|2093862_2094066_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	5.9e-27
WP_072617254.1|2094062_2094224_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	87.0	4.6e-14
WP_000372595.1|2094373_2094589_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_000193293.1|2094593_2094938_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
WP_000370546.1|2094903_2095176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992105.1|2095281_2095815_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	96.0	4.8e-100
WP_001228696.1|2096031_2096217_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001097893.1|2096413_2097871_+	potassium transporter TrkG	NA	NA	NA	NA	NA
WP_001291102.1|2098008_2098797_+	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.9	7.4e-49
WP_072617255.1|2098789_2099722_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.5	7.1e-83
WP_000126788.1|2099699_2099909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072617256.1|2099912_2101007_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	79.8	1.7e-112
WP_072617257.1|2100987_2102289_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.8	8.0e-149
WP_000763709.1|2102291_2103698_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	68.8	8.8e-186
WP_001317036.1|2103681_2104794_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.8	6.0e-113
WP_072617258.1|2104898_2105663_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	66.1	8.7e-87
2104834:2104849	attR	TTTTTATTGCTGCGAT	NA	NA	NA	NA
WP_000918483.1|2105761_2106901_+	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.0	3.3e-159
WP_072617259.1|2107123_2107519_+	protein singed	NA	NA	NA	NA	NA
WP_000524259.1|2107518_2107902_+	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	40.2	3.4e-15
WP_072617260.1|2107902_2108283_+	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	43.6	4.2e-18
WP_000144678.1|2108279_2108672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000094292.1|2108698_2109661_+	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	39.2	4.5e-56
WP_012565075.1|2109811_2110171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072617261.1|2110644_2113878_+|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	33.1	1.1e-101
WP_000024051.1|2113870_2114209_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_072617262.1|2114208_2114907_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	95.3	1.4e-128
WP_072617263.1|2114912_2115656_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	92.7	4.9e-143
WP_072617264.1|2115553_2116201_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	2.5e-111
WP_072617265.1|2116261_2119741_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.3	0.0e+00
WP_072617266.1|2119808_2120408_+	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	89.4	1.6e-99
WP_077893274.1|2120472_2122875_+|tail	phage tail protein	tail	I1TE37	Escherichia_virus	38.4	5.0e-72
>prophage 6
NZ_CP018206	Escherichia coli strain MRSN346647 chromosome, complete genome	5041399	2341039	2398034	5041399	tail,lysis,holin,terminase,protease,integrase,portal	Enterobacteria_phage(44.9%)	68	2371393:2371409	2402728:2402744
WP_001551142.1|2341039_2342500_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.5	2.5e-42
WP_001625267.1|2342588_2343872_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|2344474_2344588_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_069903815.1|2344656_2344890_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.4e-32
WP_000086527.1|2345206_2345797_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000355609.1|2346024_2346318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000235980.1|2346328_2347033_-	hypothetical protein	NA	A0A1X7QGH6	Escherichia_phage	61.7	1.2e-58
WP_000654160.1|2347042_2347324_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	5.9e-17
WP_032166489.1|2347323_2349729_-|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	69.8	1.3e-160
WP_001233058.1|2349793_2350393_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	96.0	2.0e-107
WP_072617278.1|2350460_2353940_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.4	0.0e+00
WP_000090882.1|2354000_2354603_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	6.2e-88
WP_069903863.1|2354539_2355283_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	3.6e-146
WP_001545203.1|2355287_2355986_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.0e-134
WP_000447253.1|2355995_2356325_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_069903862.1|2356324_2359381_-|tail	phage tail tape measure protein	tail	A5LH38	Enterobacteria_phage	97.9	0.0e+00
WP_001161009.1|2359352_2359682_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001298500.1|2359690_2360077_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	100.0	3.3e-66
WP_000211131.1|2360137_2360881_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	97.6	3.6e-130
WP_001079412.1|2360891_2361293_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	97.7	1.2e-71
WP_000677119.1|2361289_2361880_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	79.6	2.1e-80
WP_001283153.1|2361891_2362167_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097055.1|2362159_2362483_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	99.1	2.5e-51
WP_001136590.1|2362569_2364597_-|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.5	0.0e+00
WP_000985923.1|2364541_2366050_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.4	1.1e-287
WP_001072975.1|2366049_2366262_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000507025.1|2366258_2368358_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	99.4	0.0e+00
WP_000421825.1|2368366_2368906_-	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_032201950.1|2369456_2369663_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	80.9	2.0e-22
WP_001019207.1|2369956_2370130_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001443523.1|2370302_2370458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071528545.1|2370605_2370794_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|2370804_2371017_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071778.1|2371380_2371878_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
2371393:2371409	attL	TTTTTTATCTCTTAAAG	NA	NA	NA	NA
WP_001101173.1|2371874_2372408_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.8	1.4e-96
WP_001557934.1|2372521_2372782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072617279.1|2372729_2373281_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	50.6	3.8e-36
WP_000839588.1|2373285_2373501_-|holin	holin	holin	A5LH82	Enterobacteria_phage	91.5	1.2e-30
WP_032201951.1|2373691_2374405_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000780584.1|2375874_2376399_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	52.9	1.0e-46
WP_001204787.1|2376554_2376932_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	82.5	1.8e-53
WP_032201952.1|2376949_2377999_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	58.2	2.3e-114
WP_012775982.1|2378000_2378279_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000981003.1|2378345_2378597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000884073.1|2378813_2379026_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	6.6e-29
WP_001546200.1|2379070_2379178_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	2.5e-08
WP_021514655.1|2379643_2381431_+	DUF4209 domain-containing protein	NA	Q2P9X5	Enterobacteria_phage	23.4	7.1e-15
WP_001151190.1|2381649_2382051_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.7	7.1e-64
WP_000054487.1|2382091_2383057_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	2.6e-56
WP_000705349.1|2383037_2383559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476993.1|2383542_2383770_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003381.1|2383847_2384255_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000379589.1|2384447_2384603_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_000344951.1|2384604_2385180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|2385666_2385855_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083273.1|2385851_2386043_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_072617280.1|2386136_2388608_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_001296941.1|2388695_2388932_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_128550369.1|2388966_2390247_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	1.5e-155
WP_001360138.1|2390266_2390377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836035.1|2390434_2391454_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	5.7e-17
WP_001295394.1|2391465_2392680_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_001314753.1|2392885_2393212_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	2.2e-23
WP_000705205.1|2393346_2393688_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138584.1|2393722_2394283_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001445899.1|2394285_2394996_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001295396.1|2395103_2395409_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001551145.1|2395607_2398034_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	1.7e-213
2402728:2402744	attR	TTTTTTATCTCTTAAAG	NA	NA	NA	NA
>prophage 7
NZ_CP018206	Escherichia coli strain MRSN346647 chromosome, complete genome	5041399	2964789	2974232	5041399		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001551350.1|2964789_2965926_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	5.0e-163
WP_001551351.1|2965922_2967923_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001295429.1|2968047_2968509_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001551352.1|2968550_2969021_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	5.2e-82
WP_001308766.1|2969067_2969787_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2969783_2971469_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240398.1|2971690_2972422_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001216963.1|2972481_2972589_+	protein YohO	NA	NA	NA	NA	NA
WP_000783134.1|2972569_2973301_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569343.1|2973305_2974232_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
>prophage 8
NZ_CP018206	Escherichia coli strain MRSN346647 chromosome, complete genome	5041399	3188462	3263066	5041399	tRNA,tail,holin,capsid,terminase,integrase,protease,head,portal,plate	Enterobacteria_phage(42.19%)	93	3182106:3182121	3231314:3231329
3182106:3182121	attL	ATCACCATCCCCAGCG	NA	NA	NA	NA
WP_001283590.1|3188462_3189275_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289165.1|3189274_3190288_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001596028.1|3190353_3191490_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	28.5	3.8e-22
WP_001596029.1|3191588_3192584_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_001596030.1|3192580_3193759_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817178.1|3194023_3195244_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_001596031.1|3195402_3197409_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|3197464_3197743_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089220.1|3197776_3198325_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447361.1|3198324_3199134_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043808.1|3199133_3199958_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_001551407.1|3199961_3201047_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	5.3e-90
WP_001309606.1|3201081_3202014_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730805.1|3202179_3202731_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_023910349.1|3202854_3203724_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_001551409.1|3203710_3204235_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000822673.1|3204231_3204702_-	fimbrial protein	NA	NA	NA	NA	NA
WP_023156814.1|3204698_3205247_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000170518.1|3205221_3205971_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001114066.1|3205990_3208630_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000033306.1|3208713_3209280_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001195819.1|3209941_3210427_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_001544761.1|3210629_3212774_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531924.1|3212773_3214084_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_001296261.1|3214264_3214549_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001389840.1|3214920_3216261_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_049067919.1|3216626_3217910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000776768.1|3218091_3218847_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368131.1|3219140_3220073_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_072617313.1|3220384_3221542_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.2	8.2e-222
WP_072617314.1|3221705_3222068_+	GtrA family protein	NA	U5P0S6	Shigella_phage	86.4	7.3e-52
WP_072617315.1|3222064_3222982_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	77.2	1.8e-131
WP_032419946.1|3222989_3224462_+	hypothetical protein	NA	A0A192Y7W8	Salmonella_phage	29.4	6.4e-38
WP_072617316.1|3224491_3224893_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	53.6	2.1e-15
WP_072617317.1|3224892_3225864_-	hypothetical protein	NA	U5P0I1	Shigella_phage	80.0	6.3e-50
WP_072617318.1|3225867_3226452_-	YmfQ family protein	NA	O22003	Shigella_phage	99.0	5.4e-113
WP_000785312.1|3226442_3227501_-|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	99.4	8.6e-202
WP_000424732.1|3227487_3227913_-	hypothetical protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_001259084.1|3227912_3228461_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	98.9	5.1e-97
WP_000999510.1|3228460_3229540_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	100.0	5.3e-207
WP_134082275.1|3229536_3230865_-	DNA circularization protein	NA	Q8SBG8	Shigella_phage	99.3	2.9e-247
WP_072617320.1|3230925_3232761_-|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.3	2.9e-306
3231314:3231329	attR	ATCACCATCCCCAGCG	NA	NA	NA	NA
WP_000661054.1|3232902_3233172_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_000090997.1|3233171_3233528_-	hypothetical protein	NA	U5P076	Shigella_phage	99.2	9.0e-63
WP_072617321.1|3233527_3235024_-|tail	phage tail protein	tail	S5FKL0	Shigella_phage	99.0	4.4e-276
WP_000497751.1|3235007_3235178_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000779292.1|3235186_3235747_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	100.0	1.0e-105
WP_000224835.1|3235743_3236250_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	92.9	1.3e-83
WP_072617322.1|3236224_3236635_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	91.2	1.8e-67
WP_000927719.1|3236631_3236955_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000601357.1|3236957_3237158_-	hypothetical protein	NA	S5FNU1	Shigella_phage	95.5	1.4e-25
WP_000257493.1|3237206_3238412_-|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	99.3	1.6e-223
WP_001193631.1|3238426_3239077_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_072617323.1|3239054_3240296_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.3	1.3e-241
WP_032257813.1|3240295_3240478_-	hypothetical protein	NA	M1FJ83	Enterobacteria_phage	98.3	2.9e-25
WP_162780152.1|3240489_3241986_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.6	4.8e-299
WP_072617325.1|3242219_3242714_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	99.4	5.1e-88
WP_040073295.1|3242839_3243190_-	HNH endonuclease	NA	Q8SBD7	Shigella_phage	97.4	6.2e-64
WP_040073296.1|3243373_3243766_-	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	86.2	3.8e-54
WP_001570151.1|3243749_3244226_-	glycoside hydrolase family protein	NA	K7P7Y6	Enterobacteria_phage	100.0	7.5e-89
WP_000783734.1|3244209_3244533_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_001235461.1|3244966_3245590_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	100.0	3.0e-114
WP_000994511.1|3245586_3245775_-	protein ninH	NA	A5VW84	Enterobacteria_phage	98.4	2.7e-26
WP_001008200.1|3245771_3246134_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6I9	Enterobacteria_phage	100.0	9.2e-63
WP_016063209.1|3246130_3246421_-	DUF1364 domain-containing protein	NA	K7PK25	Enterobacteria_phage	100.0	7.6e-52
WP_072617326.1|3246420_3247143_-	DNA-binding protein	NA	A5VW87	Enterobacteria_phage	99.2	7.8e-130
WP_072617327.1|3247135_3247306_-	protein ninF	NA	A0A2I6PIG4	Escherichia_phage	98.2	1.6e-25
WP_001254251.1|3247302_3247485_-	NinE family protein	NA	Q716C5	Shigella_phage	100.0	1.3e-28
WP_000736907.1|3247481_3247922_-	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	99.3	3.5e-80
WP_063080445.1|3247995_3249372_-	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	99.8	1.6e-253
WP_001608293.1|3249368_3250190_-	replication protein	NA	K7PJZ3	Enterobacterial_phage	99.6	2.0e-153
WP_000536662.1|3250373_3250655_-	hypothetical protein	NA	K7PMG0	Enterobacteria_phage	100.0	1.9e-44
WP_000067728.1|3250771_3250987_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	98.6	8.2e-35
WP_001519589.1|3251062_3251758_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	96.5	1.3e-129
WP_072617328.1|3252038_3252425_+	antitermination protein	NA	Q716D8	Shigella_phage	97.3	1.4e-53
WP_000915090.1|3252433_3252571_+	hypothetical protein	NA	Q716D9	Shigella_phage	100.0	1.3e-22
WP_000597940.1|3252969_3253218_+	hypothetical protein	NA	K7P6N6	Enterobacteria_phage	100.0	1.6e-37
WP_000972063.1|3253301_3253436_+	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	100.0	3.1e-16
WP_001243353.1|3253420_3253573_+	host cell division inhibitory peptide Kil	NA	K7P837	Enterobacteria_phage	100.0	4.7e-21
WP_000604110.1|3253657_3253966_+	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	99.0	3.3e-53
WP_000065846.1|3253962_3254865_+	recombinase RecT	NA	K7PKG9	Enterobacteria_phage	88.4	5.2e-147
WP_072617329.1|3254848_3255331_+	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	97.5	1.3e-77
WP_000753555.1|3255342_3255657_+	hypothetical protein	NA	K7PLT4	Enterobacteria_phage	100.0	1.2e-50
WP_000773125.1|3255673_3255955_+	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	98.9	1.9e-44
WP_001214456.1|3255951_3256116_+	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	100.0	1.1e-23
WP_077893281.1|3256112_3256820_+	ead/Ea22-like family protein	NA	Q9MCT8	Escherichia_phage	99.1	5.1e-134
WP_000545732.1|3257791_3257959_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	4.9e-27
WP_072617401.1|3257985_3258330_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	98.2	4.5e-59
WP_001163428.1|3258454_3258655_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_001316510.1|3258952_3259105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072617330.1|3259184_3260432_-	oligosaccharide MFS transporter	NA	NA	NA	NA	NA
WP_001551411.1|3260493_3261417_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_001551412.1|3261632_3263066_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.0	5.3e-29
>prophage 9
NZ_CP018206	Escherichia coli strain MRSN346647 chromosome, complete genome	5041399	3498089	3563411	5041399	transposase,tRNA,tail,lysis,capsid,terminase,integrase,head,portal,plate	Erwinia_phage(41.67%)	73	3494553:3494569	3567190:3567206
3494553:3494569	attL	CATTGCCGCGCTGTACC	NA	NA	NA	NA
WP_001469536.1|3498089_3498827_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|3498958_3500293_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001551513.1|3500325_3501207_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001521088.1|3501309_3501897_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627804.1|3501958_3502342_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_001262721.1|3502646_3503336_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	9.3e-56
WP_001521090.1|3503383_3504421_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|3504627_3505047_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001308860.1|3505115_3505814_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001521091.1|3505845_3508506_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|3508619_3509975_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001696047.1|3510020_3510344_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000841103.1|3510340_3511639_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_100190661.1|3511947_3513296_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.1	5.1e-74
WP_001235102.1|3518876_3521450_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_001551518.1|3521579_3522311_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079112.1|3522307_3523288_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|3523422_3524160_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|3524430_3524772_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|3524875_3524923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200120.1|3525021_3526182_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225221.1|3526224_3527346_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168045.1|3527356_3528427_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_019842457.1|3528635_3529001_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212386.1|3529150_3529669_+	YfiR family protein	NA	NA	NA	NA	NA
WP_001551521.1|3529658_3530885_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589828.1|3530900_3531383_+	OmpA family protein	NA	NA	NA	NA	NA
WP_063960130.1|3531555_3532605_-|integrase	site-specific integrase	integrase	A0A0M4S6G4	Salmonella_phage	88.8	2.7e-187
WP_063960132.1|3532628_3532967_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_072617338.1|3532976_3533840_-	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	84.3	2.4e-141
WP_008502484.1|3533961_3534333_+	hypothetical protein	NA	A0A0M4R4X7	Salmonella_phage	97.6	1.2e-60
WP_038421067.1|3534365_3534875_+	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	95.9	7.5e-87
WP_023338694.1|3534882_3535083_+	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	90.9	4.3e-30
WP_072617339.1|3535046_3535385_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	92.0	2.0e-51
WP_023333493.1|3535452_3535680_+	DUF2732 domain-containing protein	NA	A0A218M4I9	Erwinia_phage	98.7	1.3e-30
WP_070544409.1|3535679_3535901_+	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	95.9	2.7e-33
WP_072617340.1|3535901_3536174_+	DUF5405 family protein	NA	A0A218M4I8	Erwinia_phage	77.0	2.6e-33
WP_070544407.1|3536170_3536452_+	DUF3850 domain-containing protein	NA	A0A0P0I3U9	Klebsiella_phage	51.3	1.5e-12
WP_072617341.1|3536442_3538671_+	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	95.5	0.0e+00
WP_048957943.1|3538784_3538967_+	hypothetical protein	NA	A0A0M5M1G5	Salmonella_phage	90.0	2.7e-23
WP_072617342.1|3539157_3539829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072617343.1|3539840_3540965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023338702.1|3540967_3542026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162780151.1|3542232_3542394_-	hypothetical protein	NA	A0A0M5M1G4	Salmonella_phage	86.2	6.0e-06
WP_072617345.1|3542452_3543499_-|portal	phage portal protein	portal	A0A2I8TV74	Erwinia_phage	95.1	8.8e-191
WP_032448422.1|3543498_3545268_-|terminase	terminase ATPase subunit family protein	terminase	A0A218M4M1	Erwinia_phage	98.1	0.0e+00
WP_072617346.1|3545433_3546288_+|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	96.5	1.9e-154
WP_001248605.1|3546363_3547431_+|capsid	phage major capsid protein, P2 family	capsid	O80304	Escherichia_phage	99.4	2.9e-197
WP_000203478.1|3547434_3548184_+|terminase	terminase endonuclease subunit	terminase	A0A218M4L0	Erwinia_phage	96.4	2.8e-114
WP_000214252.1|3548277_3548787_+|head	head completion/stabilization protein	head	A0A218M4L7	Erwinia_phage	98.2	4.3e-90
WP_000870101.1|3548786_3548990_+|tail	tail protein X	tail	A0A218M4L8	Erwinia_phage	95.5	9.8e-30
WP_001437784.1|3548980_3549202_+	primosomal protein	NA	A0A218M4L5	Erwinia_phage	98.6	8.4e-35
WP_000095316.1|3549185_3549695_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	92.3	3.5e-84
WP_000865794.1|3549691_3550105_+|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	68.6	4.1e-43
WP_001394645.1|3550076_3550250_+	hypothetical protein	NA	S4TNY4	Salmonella_phage	98.2	2.8e-25
WP_001437785.1|3550212_3550680_+|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	100.0	1.4e-84
WP_072617347.1|3550672_3551122_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	96.0	1.9e-70
WP_001094751.1|3551190_3551826_+|plate	phage baseplate assembly protein V	plate	A0A2I8TV69	Erwinia_phage	98.1	9.3e-111
WP_000127178.1|3551822_3552170_+|plate	baseplate assembly protein	plate	A0A218M4K8	Erwinia_phage	99.1	5.5e-57
WP_072617348.1|3552176_3553085_+|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	97.7	5.5e-157
WP_001283830.1|3553077_3553686_+|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	97.5	1.2e-112
WP_072617349.1|3553682_3554729_+|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	74.2	1.2e-134
WP_001029793.1|3554728_3555325_+|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	79.7	3.4e-86
WP_032258479.1|3555456_3556635_+|tail	phage tail sheath protein	tail	Q37844	Escherichia_phage	97.2	1.4e-216
WP_001207674.1|3556650_3557169_+|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	99.4	6.5e-94
WP_077893284.1|3557232_3557568_+|tail	phage tail assembly protein	tail	S4TTB2	Salmonella_phage	98.2	2.3e-52
WP_071687585.1|3557564_3557720_+|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	96.1	9.7e-22
WP_072617350.1|3557712_3560154_+|tail	phage tail tape measure protein	tail	A0A0M3UL85	Salmonella_phage	89.1	0.0e+00
WP_072617351.1|3560165_3560651_+|tail	phage tail protein	tail	S4TUC3	Salmonella_phage	94.4	2.2e-80
WP_072617352.1|3560647_3561814_+	phage late control D family protein	NA	A0A218M4J7	Erwinia_phage	96.4	9.5e-202
WP_072056585.1|3561891_3562110_+	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	94.4	5.2e-37
WP_000065253.1|3562254_3562602_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264776.1|3562643_3563411_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
3567190:3567206	attR	CATTGCCGCGCTGTACC	NA	NA	NA	NA
>prophage 10
NZ_CP018206	Escherichia coli strain MRSN346647 chromosome, complete genome	5041399	3656359	3663499	5041399		Escherichia_phage(83.33%)	6	NA	NA
WP_001272891.1|3656359_3658921_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.7	2.7e-31
WP_001141345.1|3659026_3659683_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	47.0	5.0e-51
WP_001272546.1|3659733_3660531_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	4.5e-70
WP_000847985.1|3660696_3661605_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001551546.1|3661601_3662864_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.2	3.7e-135
WP_001278994.1|3662860_3663499_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 1
NZ_CP018207	Escherichia coli strain MRSN346647 plasmid pMRSN346647_113.1, complete sequence	113140	17103	74827	113140	integrase,transposase	Escherichia_phage(36.84%)	43	28654:28713	73558:74898
WP_001067852.1|17103_17808_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	4.0e-139
WP_001235713.1|19618_20176_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|20358_21219_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_000804064.1|22526_23726_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000164043.1|23831_24482_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_024203663.1|24513_24756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001120891.1|25204_25744_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000480968.1|25715_26552_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|26551_27355_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_001043260.1|27415_28231_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000954592.1|28560_28737_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
28654:28713	attL	GAAAACGGAATCTATGGTCACTCCCGTTTTTGCAACACCGATTTTGACGACAAGTTGGCT	NA	NA	NA	NA
WP_000427619.1|28918_29923_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|31819_32524_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004201280.1|32770_33244_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_000845048.1|33399_34413_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001067852.1|34958_35663_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	4.0e-139
WP_000239590.1|36056_36932_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_001393253.1|36978_37311_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_001516695.1|41572_42229_+	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
WP_001493761.1|43008_44400_-|transposase	ISKra4-like element ISKpn19 family transposase	transposase	NA	NA	NA	NA
WP_001493762.1|44436_45009_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
WP_012477564.1|45145_45736_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_072617410.1|46252_49846_-	acid-sensing system histidine kinase EvgS	NA	A0A1V0SGX0	Hokovirus	31.5	1.9e-35
WP_032214276.1|49850_50465_-	acid-sensing system DNA-binding response regulator EvgA	NA	NA	NA	NA	NA
WP_072617411.1|52298_52556_+	biofilm development YmgB/AriR family protein	NA	NA	NA	NA	NA
WP_001190712.1|53702_53924_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001216034.1|53923_54304_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
WP_001513661.1|54308_54488_+	hypothetical protein	NA	Q71TH5	Escherichia_phage	96.6	3.5e-23
WP_072617413.1|54515_54875_+	pdcB	NA	A0A077SLM1	Escherichia_phage	97.8	1.9e-44
WP_001513659.1|55161_55479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001373486.1|56930_58334_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_000081352.1|58320_59253_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_000192349.1|59361_60408_-	ferric ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.9	8.4e-08
WP_016236297.1|62205_63018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361612.1|63804_64782_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.2	3.9e-100
WP_001066941.1|65060_65801_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_001091225.1|68261_69035_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001194072.1|69100_69802_-	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_006687059.1|69867_70974_-	alkene reductase	NA	NA	NA	NA	NA
WP_000888080.1|71547_71886_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_000210408.1|71890_72472_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053921594.1|72613_73171_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000427619.1|73822_74827_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
73558:74898	attR	GAAAACGGAATCTATGGTCACTCCCGTTTTTGCAACACCGATTTTGACGACAAGTTGGCTTGCTTGAATCTATCCGGCGTCTGAATGGGATTTTATTCCCGCGCCTCGATGAGTTCCGCGCCTGATGAACCTCCAGAAAATATACGGCTTCAATGAGCCTTTCCGTTTTACAGGTTCCTCAACAGGCCGGTGGGCCGTTAGTATCATCAATATCAGTATTCGCAAAACCAGATGAATGATTGTTTAAACTGGTGTATTTCTGCCTTTATGCTTCGTAAGTTTGCTGTCGCGCCGTCAGTGCCCAGGCTATTCTGGCCAGCTTGTTTGCCAGAGCACAGGTGACGACAAAGTTGCTTTTCCGACACAACAACTCCCTGACCCAGTCGGCCAACTTGCCAGACTGGTGTTCCAGTTTTTGTATGAATACCCTGGCACACTGAACCAACAAAGTTCGGATCTTTTTGTTGCCCCGCTTGCTAATCCCTAACAATGTCGTCCGACCTCCCGTGCTGTACTGTCGGGGTACCAGCCCTGTTGCCGCCGCAAAGTCACGGCTGCTGGCGTACTGCTTCCCGTCGCCAATCTCAGTTGAAATAGTACTGGCAGTCAGCGTTCCAACGCAGGGAATACTCAGCAAGCGCTGTCCAACCTCATCTTCGTCCAACTTTCGTTTCAACTGAGATTCCAGATCTTTAATCTGCTCAACAAGATAGTGATAATGCTGTTGTAATTTCAGCAGTAACTGGCTGAGATAAAGAGGCAAACTACTGTCCTCAAGAAGGGTACTCAGTCGACTAATAACGGCAGCACCTCGCGGAACGCTGATACCAAATTCCAGCAGAAAAGCATGCATCTGATTAGTTGTTTTCACCTTATCCTGAACCAGGGATTCACGGACACGATGCAGAGCTCGCATTGCCTGCTGAGATTCGGTTCTGGGCTGCACGAAACGCATAGATGGACGTGATGCTGCTTCACAGATAGCTTCAGCATCAACGAAGTCATTTTTGTTGCTTTTAACGAATGGGCGGACAAATTGCGGTGATATCAGCTTTGGAAAATGCCCTAACTCTTCCAGCTTGCGTGCCATAAAGTGAGAACCGCCACAGGCTTCCATCGCGATGGTTGTTGCCGGGCATGTCGCCAGAAATTCGATTAGCTTTGGTCGGGTGAATTTTTTACGGTAAACGGCCTTCCCACGATGATCCTGACAATGAATATGGAAAGAGTTCTTACCCAGATCGATACCAATAAGCGCAATGTTTTCCATGATGGTTCTCCGAATGAAAGCCTGTCCTCAGCATAGTACTGGGAAGGAGGGAGTGACCATCTCATTAAATA	NA	NA	NA	NA
>prophage 2
NZ_CP018207	Escherichia coli strain MRSN346647 plasmid pMRSN346647_113.1, complete sequence	113140	83687	93554	113140	integrase,transposase	Salmonella_phage(66.67%)	8	83405:83418	91077:91090
83405:83418	attL	CTCCGGAGCCTGTC	NA	NA	NA	NA
WP_001323889.1|83687_85265_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	99.4	1.2e-95
WP_001323888.1|85418_85586_-	hypothetical protein	NA	A0A1B0V7I9	Salmonella_phage	98.2	2.3e-24
WP_001161490.1|85574_86135_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_001138014.1|86138_89105_+|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
WP_000600827.1|89450_90428_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	34.9	1.1e-06
WP_032435955.1|91019_91154_-	hypothetical protein	NA	NA	NA	NA	NA
91077:91090	attR	GACAGGCTCCGGAG	NA	NA	NA	NA
WP_161123773.1|91362_91572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000739198.1|91835_93554_-	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	27.8	2.1e-27
