The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018228	Rhizobium leguminosarum strain Vaf-108 chromosome, complete genome	5119898	572649	630501	5119898	holin,protease,transposase	Bacillus_virus(20.0%)	52	NA	NA
WP_072637611.1|572649_573621_+|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	42.7	6.1e-45
WP_072640661.1|574166_575228_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_064247885.1|575269_576028_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_072637613.1|576293_576869_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_072637614.1|577004_578219_+	MFS transporter	NA	NA	NA	NA	NA
WP_072637615.1|578343_579609_+	peptide antibiotic transporter SbmA	NA	NA	NA	NA	NA
WP_072637616.1|579817_580804_-	polysaccharide deacetylase	NA	NA	NA	NA	NA
WP_072637617.1|580925_581510_+	NnrU family protein	NA	NA	NA	NA	NA
WP_072637618.1|581716_582400_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_072637619.1|582418_583843_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_072637620.1|583936_584374_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_072637621.1|584535_585561_+	alpha/beta hydrolase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	45.6	2.5e-73
WP_072637622.1|585567_586752_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_064652000.1|586993_588034_-	glutamine synthetase beta-grasp domain-containing protein	NA	A0A1V0SG77	Hokovirus	43.3	1.4e-71
WP_072637623.1|588466_588658_+	DUF2735 domain-containing protein	NA	NA	NA	NA	NA
WP_072637624.1|588782_589703_-	sugar kinase	NA	NA	NA	NA	NA
WP_072637625.1|589938_590925_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	28.4	1.2e-16
WP_072637626.1|590917_591925_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.2	1.7e-18
WP_018495229.1|591927_592845_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_072637627.1|592841_593765_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_072637628.1|593813_595394_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_072637629.1|595680_597327_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_072637630.1|597330_597540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072640662.1|597581_597782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072637631.1|597840_599538_-	adenine deaminase	NA	NA	NA	NA	NA
WP_072637632.1|599656_600760_-	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_072637633.1|601241_602156_+	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_072640663.1|602328_603654_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_155773338.1|603652_603946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072637634.1|603938_605912_+	PhoX family phosphatase	NA	NA	NA	NA	NA
WP_155773339.1|606028_606788_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	46.9	2.8e-21
WP_072637637.1|607005_607323_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_072637638.1|607438_608188_-	HugZ family protein	NA	NA	NA	NA	NA
WP_027664071.1|608219_609272_-|holin	choline ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	31.8	1.3e-19
WP_017961531.1|609268_610114_-|holin	choline ABC transporter permease subunit	holin	NA	NA	NA	NA
WP_072637639.1|610185_611142_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_065280862.1|611377_611980_+	thymidine kinase	NA	G9I9I2	Pseudomonas_phage	54.8	1.2e-51
WP_072637640.1|612410_613484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072637641.1|613635_614766_+	DUF2333 family protein	NA	NA	NA	NA	NA
WP_017961526.1|614778_615240_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_072637642.1|615286_616012_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_072637643.1|616489_618169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072637644.1|618364_620044_+	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
WP_072637645.1|620260_621274_-	extensin family protein	NA	NA	NA	NA	NA
WP_072637646.1|621483_623742_+	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_072637647.1|624005_626195_+	anthranilate synthase	NA	NA	NA	NA	NA
WP_017961519.1|626321_626561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072637648.1|626576_627248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072637650.1|627401_628316_+	CDF family cation efflux transporter EmfA	NA	NA	NA	NA	NA
WP_026158801.1|628315_628780_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	48.0	9.4e-28
WP_072637651.1|628905_629685_-	DUF2076 domain-containing protein	NA	NA	NA	NA	NA
WP_017961514.1|629916_630501_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	37.9	1.3e-29
>prophage 2
NZ_CP018228	Rhizobium leguminosarum strain Vaf-108 chromosome, complete genome	5119898	738873	753532	5119898	transposase	Vibrio_phage(22.22%)	12	NA	NA
WP_072640668.1|738873_740079_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	2.1e-39
WP_018242983.1|740351_740807_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	38.7	6.9e-15
WP_072637716.1|740809_741700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155773341.1|742003_742309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072640669.1|742370_744380_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	41.5	2.1e-87
WP_072637718.1|744379_746248_+	DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	35.7	1.4e-77
WP_072637719.1|746268_746997_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	42.0	8.9e-49
WP_072637720.1|747063_748251_+	glycine C-acetyltransferase	NA	D2TEZ5	Emiliania_huxleyi_virus	27.5	3.2e-35
WP_065279191.1|748572_749511_+|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	33.3	1.4e-25
WP_072637721.1|749611_750649_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	68.6	7.1e-15
WP_072637722.1|750658_751006_+	GFA family protein	NA	NA	NA	NA	NA
WP_017961411.1|751474_753532_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.6	1.7e-36
>prophage 3
NZ_CP018228	Rhizobium leguminosarum strain Vaf-108 chromosome, complete genome	5119898	881923	946779	5119898	integrase,protease,transposase	Streptococcus_phage(10.0%)	57	877870:877886	942657:942673
877870:877886	attL	CGAAGGCATCGACGTCG	NA	NA	NA	NA
WP_072637808.1|881923_882874_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_072637809.1|882998_883535_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_072637810.1|883817_884408_+	3'-5' exonuclease	NA	A0A1S5SFA9	Streptococcus_phage	37.4	1.3e-21
WP_072637811.1|884485_884980_+	CreA family protein	NA	NA	NA	NA	NA
WP_003541378.1|885256_885727_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_072637812.1|886048_886651_+	SCO family protein	NA	NA	NA	NA	NA
WP_072637813.1|886719_887598_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_003541368.1|888015_888189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072640678.1|888467_890303_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	33.3	9.1e-82
WP_027664277.1|890371_890680_-	AzlD family protein	NA	NA	NA	NA	NA
WP_072637814.1|890683_891415_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_027664279.1|891547_891811_+	DUF2164 domain-containing protein	NA	NA	NA	NA	NA
WP_072637815.1|891930_892596_-	dihydrofolate reductase family protein	NA	NA	NA	NA	NA
WP_072637816.1|892691_893318_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	34.3	4.7e-22
WP_072637817.1|893685_894033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072637818.1|894060_896541_-	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	37.7	2.6e-116
WP_072637819.1|896786_897263_+	VOC family protein	NA	NA	NA	NA	NA
WP_017961269.1|897692_899636_+	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_017961268.1|899648_900923_+	YeaH/YhbH family protein	NA	NA	NA	NA	NA
WP_065280659.1|900919_902470_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_072637820.1|902593_902857_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_072637821.1|902853_903267_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_072637822.1|903447_904368_+	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_072637823.1|904635_905844_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_072637824.1|905840_908996_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	24.8	5.2e-69
WP_072637825.1|909269_910268_+	flagellin C	NA	NA	NA	NA	NA
WP_003541337.1|910558_911224_+	OmpA family lipoprotein	NA	NA	NA	NA	NA
WP_003560946.1|911273_911681_-	DUF2000 family protein	NA	NA	NA	NA	NA
WP_072637826.1|911726_912638_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_072637827.1|912597_913692_-	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_072637829.1|914018_914921_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_072637830.1|915013_916048_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_072637831.1|916210_917623_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_072637832.1|917825_921542_+	AsmA family protein	NA	NA	NA	NA	NA
WP_072637833.1|921634_921859_-	ribbon-helix-helix domain-containing protein	NA	NA	NA	NA	NA
WP_072637834.1|922021_922216_-	DUF4169 family protein	NA	NA	NA	NA	NA
WP_003541317.1|922266_922782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167378955.1|923693_924080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072637836.1|924112_926008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072637837.1|926004_927936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072637838.1|927937_929341_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_072637840.1|930867_931527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155773345.1|931532_932087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072637842.1|932718_933240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081374220.1|933354_934023_-	topoisomerase DNA-binding C4 zinc finger domain-containing protein	NA	NA	NA	NA	NA
WP_072637591.1|934607_936128_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_072637590.1|936117_936912_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	35.3	2.2e-32
WP_072637844.1|936912_938331_-	ATP-binding protein	NA	A0A1V0SG63	Hokovirus	27.8	8.5e-11
WP_072637845.1|938350_938653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167378956.1|938903_939314_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_072640679.1|939829_940624_+	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	68.6	6.0e-107
WP_072637847.1|940637_941156_+	dihydrofolate reductase	NA	A0A1B2IBQ4	Erwinia_phage	42.2	2.4e-24
WP_027668568.1|941304_942387_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_062945356.1|942390_943353_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
942657:942673	attR	CGACGTCGATGCCTTCG	NA	NA	NA	NA
WP_072637848.1|943554_945285_+	Do family serine endopeptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	30.8	2.0e-22
WP_065279017.1|945350_945623_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_065282351.1|945663_946779_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP018228	Rhizobium leguminosarum strain Vaf-108 chromosome, complete genome	5119898	1828131	1838335	5119898		uncultured_Mediterranean_phage(83.33%)	9	NA	NA
WP_003539661.1|1828131_1828641_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	59.4	2.5e-45
WP_072638475.1|1828670_1829243_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	53.2	1.3e-42
WP_064648064.1|1829294_1829789_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	37.2	8.0e-25
WP_072638476.1|1829879_1830143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003539654.1|1830289_1830445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072638477.1|1830799_1833631_-	DNA gyrase subunit A	NA	A0A1B1IVS2	uncultured_Mediterranean_phage	42.2	4.7e-77
WP_012757442.1|1833867_1834515_+	MarC family protein	NA	NA	NA	NA	NA
WP_072638478.1|1834613_1835129_-	single-stranded DNA-binding protein	NA	R9TP78	Rhizobium_phage	74.6	5.5e-45
WP_072638479.1|1835413_1838335_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	62.1	0.0e+00
>prophage 5
NZ_CP018228	Rhizobium leguminosarum strain Vaf-108 chromosome, complete genome	5119898	2099909	2113083	5119898	tRNA	uncultured_Mediterranean_phage(90.91%)	13	NA	NA
WP_072638657.1|2099909_2102450_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	47.8	1.1e-56
WP_003539006.1|2102495_2102843_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	39.1	1.4e-12
WP_072638658.1|2103145_2104018_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_072638659.1|2104072_2105671_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I3PV24	Clostridium_phage	29.2	8.6e-12
WP_011651660.1|2105809_2106463_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	33.5	7.6e-15
WP_017991200.1|2106459_2107233_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	30.2	2.4e-23
WP_072638660.1|2107237_2108521_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.8	3.7e-98
WP_072638661.1|2108618_2109446_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	46.5	1.8e-53
WP_072638662.1|2109442_2110054_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_003538990.1|2110105_2110297_-	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	72.1	8.9e-09
WP_072638663.1|2110480_2111197_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	47.0	2.6e-40
WP_072638664.1|2111193_2112051_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	38.9	1.1e-34
WP_072640746.1|2112069_2113083_-	beta-N-acetylhexosaminidase	NA	A0A1B1IVS3	uncultured_Mediterranean_phage	42.6	1.3e-24
>prophage 6
NZ_CP018228	Rhizobium leguminosarum strain Vaf-108 chromosome, complete genome	5119898	2474299	2483526	5119898		Escherichia_phage(25.0%)	9	NA	NA
WP_072638857.1|2474299_2476267_+	hypothetical protein	NA	F2Y0P4	Organic_Lake_phycodnavirus	35.1	1.5e-05
WP_072638858.1|2476291_2476858_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A218MN57	uncultured_virus	44.4	7.0e-33
WP_072638859.1|2476876_2477932_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	52.1	1.4e-95
WP_072638860.1|2477935_2478823_+	dTDP-4-dehydrorhamnose reductase	NA	A0A1D7XFA3	Escherichia_phage	38.3	7.1e-32
WP_072638861.1|2478833_2479703_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	58.8	5.8e-95
WP_072638862.1|2479822_2480434_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	34.4	6.4e-16
WP_072638863.1|2480433_2481738_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	39.8	7.2e-33
WP_003547190.1|2481741_2482218_-	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_011651299.1|2482227_2483526_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	51.3	2.2e-98
>prophage 7
NZ_CP018228	Rhizobium leguminosarum strain Vaf-108 chromosome, complete genome	5119898	2851649	2907089	5119898	holin,protease,transposase	Klosneuvirus(22.22%)	55	NA	NA
WP_072637735.1|2851649_2852807_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_072639109.1|2853017_2854667_+|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	32.5	4.8e-66
WP_072639110.1|2854781_2855879_-	NADH:flavin oxidoreductase/NADH oxidase	NA	NA	NA	NA	NA
WP_072639111.1|2855973_2856774_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_072639112.1|2856863_2857403_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_027664998.1|2857846_2858254_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_020049059.1|2858258_2858546_-	type II toxin-antitoxin system HigB family toxin	NA	NA	NA	NA	NA
WP_072639114.1|2858655_2859129_-	DUF2214 domain-containing protein	NA	NA	NA	NA	NA
WP_032990873.1|2859151_2859538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003546399.1|2859633_2860080_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_072639115.1|2860500_2861241_+	phosphoadenylyl-sulfate reductase	NA	NA	NA	NA	NA
WP_062942690.1|2861372_2862326_+	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
WP_072639116.1|2862327_2863824_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	28.3	1.5e-26
WP_072639117.1|2864139_2864781_+	AhpC/TSA family protein	NA	NA	NA	NA	NA
WP_072639118.1|2864964_2867250_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_072639119.1|2867413_2867917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072639121.1|2868367_2869549_-	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_072639122.1|2869565_2870945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072639123.1|2870947_2871949_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_072639124.1|2871941_2872769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072639125.1|2872765_2873653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072639126.1|2873649_2875749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072639127.1|2875735_2876896_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_072639128.1|2876922_2877696_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_072638075.1|2877848_2878667_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_072639129.1|2880606_2881560_+	NmrA/HSCARG family protein	NA	A0A1V0SLC2	Klosneuvirus	30.2	3.8e-23
WP_072639130.1|2881664_2882585_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155773374.1|2882711_2883749_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_072639131.1|2884309_2885815_+|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.7	2.1e-23
WP_026158582.1|2885959_2886334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072639132.1|2886406_2886811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011650973.1|2886994_2887294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072639133.1|2887433_2887697_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_072639134.1|2887775_2888138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017959492.1|2888209_2888356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072639135.1|2888440_2888884_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_017959490.1|2889097_2889334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027664969.1|2889450_2889633_+	DUF3606 domain-containing protein	NA	NA	NA	NA	NA
WP_017993327.1|2889943_2890144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065279235.1|2890749_2890935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072639136.1|2891769_2892198_-	DUF1515 domain-containing protein	NA	NA	NA	NA	NA
WP_072639138.1|2893246_2894329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072639139.1|2894718_2896560_-	hypothetical protein	NA	V9QJK2	Rhizobium_phage	76.8	2.1e-264
WP_072639140.1|2896556_2896784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072639141.1|2896788_2897151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072639142.1|2897150_2897615_-	lysozyme	NA	A0A0K1LL70	Rhodobacter_phage	43.4	3.0e-26
WP_072639143.1|2897589_2897844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081374184.1|2898341_2899034_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_072639145.1|2899106_2900309_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	43.9	7.8e-42
WP_072639147.1|2900744_2900960_-	hypothetical protein	NA	A0A0F6WBI7	Sinorhizobium_phage	47.9	3.7e-11
WP_072639148.1|2901099_2902452_-	hypothetical protein	NA	L7TMF7	Rhizobium_phage	60.8	6.1e-75
WP_155773375.1|2902711_2903152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072639149.1|2903247_2904396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072640792.1|2904944_2905895_+	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_072638075.1|2906270_2907089_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP018228	Rhizobium leguminosarum strain Vaf-108 chromosome, complete genome	5119898	2910727	2959177	5119898	capsid,terminase,transposase,tail	Pseudomonas_phage(16.67%)	55	NA	NA
WP_081374185.1|2910727_2910994_+|transposase	transposase	transposase	A0A1B0YZU7	Pseudomonas_phage	45.7	2.4e-07
WP_072639154.1|2911092_2911398_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	37.8	6.2e-12
WP_065283428.1|2911385_2913473_-	recombinase family protein	NA	NA	NA	NA	NA
WP_072638007.1|2913984_2915607_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	40.3	3.7e-103
WP_072638008.1|2915606_2915903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072639155.1|2916178_2917186_+	fatty acid desaturase family protein	NA	NA	NA	NA	NA
WP_072639156.1|2917210_2918167_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_155773377.1|2918532_2918934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072639158.1|2919682_2921101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072639159.1|2921594_2922590_-|tail	tail fiber domain-containing protein	tail	A0A1L7QQ51	Brucella_phage	40.1	7.4e-54
WP_072639160.1|2922555_2922972_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_072639161.1|2922968_2924792_-	hypothetical protein	NA	A0A088F6U1	Sulfitobacter_phage	28.5	9.1e-42
WP_072639162.1|2924788_2925496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072639163.1|2925512_2926085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072639164.1|2926157_2926943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017990701.1|2926965_2927940_-|capsid	phage major capsid protein	capsid	Q94MS1	Myxococcus_phage	51.4	5.1e-84
WP_072639165.1|2927955_2929053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072639166.1|2929164_2929476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072639167.1|2929491_2931624_-	hypothetical protein	NA	X2CY04	Brucella_phage	31.5	1.1e-86
WP_072639168.1|2931623_2933195_-|terminase	terminase	terminase	A0A0H5ARR1	Pseudomonas_phage	43.3	9.4e-112
WP_027664938.1|2933160_2933634_-	hypothetical protein	NA	F8TUR4	EBPR_podovirus	53.7	5.1e-29
WP_072639169.1|2933656_2933893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072639170.1|2934362_2935244_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_072639172.1|2935493_2935823_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_072639173.1|2935819_2936284_+	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_072639174.1|2936327_2936744_+	GFA family protein	NA	NA	NA	NA	NA
WP_072639176.1|2936954_2937746_+	aldolase	NA	NA	NA	NA	NA
WP_072640793.1|2938022_2938490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072639177.1|2938637_2939111_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_072639178.1|2939124_2939544_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_024322788.1|2939540_2939990_-	VOC family protein	NA	A0A2K9L4N3	Tupanvirus	31.4	1.5e-14
WP_072639179.1|2940041_2940644_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_072639180.1|2940697_2941018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072639181.1|2941091_2941811_-	SOS response-associated peptidase	NA	V9IQW7	Stenotrophomonas_phage	33.6	1.2e-24
WP_072639182.1|2941940_2942138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155773378.1|2942191_2942401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072639184.1|2942530_2943121_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_072639185.1|2943191_2943821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072639186.1|2943960_2944593_+	DUF308 domain-containing protein	NA	NA	NA	NA	NA
WP_155773445.1|2944998_2945445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072639187.1|2945783_2947706_+	adenylate/guanylate cyclase domain-containing protein	NA	A0A218MLZ2	uncultured_virus	31.6	7.9e-28
WP_072639188.1|2948241_2948430_+	DUF2934 domain-containing protein	NA	NA	NA	NA	NA
WP_072639189.1|2948684_2949431_+	phosphotransferase	NA	NA	NA	NA	NA
WP_072639190.1|2949455_2949950_-	SRPBCC family protein	NA	NA	NA	NA	NA
WP_072639191.1|2949930_2950293_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_072639192.1|2950708_2951350_-	dihydrofolate reductase family protein	NA	NA	NA	NA	NA
WP_017959459.1|2951493_2951850_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_072640795.1|2951833_2952313_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_072639193.1|2952540_2953779_+	NAD(P)-binding domain-containing protein	NA	NA	NA	NA	NA
WP_072639194.1|2954166_2954499_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_072639195.1|2954491_2954977_+	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_072640796.1|2954984_2955590_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_072639196.1|2955700_2956051_-	ethanolamine utilization protein	NA	NA	NA	NA	NA
WP_072639197.1|2956485_2957424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081374153.1|2957845_2959177_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP018228	Rhizobium leguminosarum strain Vaf-108 chromosome, complete genome	5119898	3072673	3084965	5119898	terminase	uncultured_Mediterranean_phage(30.0%)	19	NA	NA
WP_072639300.1|3072673_3073369_-	hypothetical protein	NA	A0A060RFK0	Pseudomonas_phage	66.7	7.6e-05
WP_072639301.1|3073379_3073727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155773392.1|3073777_3073930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155773393.1|3073976_3074264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072639303.1|3074253_3074622_-	endonuclease VII domain-containing protein	NA	U5NZX3	Erwinia_phage	51.6	4.1e-18
WP_072639304.1|3074720_3075404_-	hypothetical protein	NA	A0A1B1IPQ2	uncultured_Mediterranean_phage	27.2	5.1e-06
WP_072639305.1|3075419_3076334_-	hypothetical protein	NA	A0A1B1IUZ5	uncultured_Mediterranean_phage	37.9	1.2e-42
WP_072639306.1|3076349_3076946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072639307.1|3077048_3077555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072639308.1|3077565_3078468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072639309.1|3078479_3078863_-	co-chaperone GroES	NA	A0A221S2U6	uncultured_virus	44.8	1.0e-27
WP_072639310.1|3078875_3079085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072639311.1|3079081_3079432_-	hypothetical protein	NA	W8VYP4	Pseudomonas_phage	61.5	6.4e-29
WP_072639312.1|3079456_3080005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155773394.1|3080022_3082254_-	hypothetical protein	NA	A0A1B1IUX3	uncultured_Mediterranean_phage	36.6	4.5e-99
WP_072639314.1|3082397_3082868_-	endonuclease VII domain-containing protein	NA	A0A0K0NKS5	Gordonia_phage	33.8	7.1e-15
WP_072640809.1|3082864_3083185_-	hypothetical protein	NA	A0A0A8WEQ1	Clostridium_phage	44.1	6.7e-17
WP_072639315.1|3083205_3083388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167378971.1|3083399_3084965_-|terminase	phage terminase large subunit	terminase	H9C0U8	Aeromonas_phage	38.0	1.1e-75
>prophage 10
NZ_CP018228	Rhizobium leguminosarum strain Vaf-108 chromosome, complete genome	5119898	3102603	3113186	5119898	integrase,transposase	Rhizobium_phage(25.0%)	17	3111853:3111867	3113980:3113994
WP_072639348.1|3102603_3103041_+	hypothetical protein	NA	R9U4A4	Rhizobium_phage	64.5	3.2e-46
WP_072639349.1|3103037_3103250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072639350.1|3103260_3103518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072639351.1|3103740_3104850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072639352.1|3104846_3105314_+	hypothetical protein	NA	A0A2I7QLC5	Vibrio_phage	44.0	1.2e-22
WP_155773405.1|3105310_3106390_+	phage recombination protein Bet	NA	A0A2H4JAQ4	uncultured_Caudovirales_phage	44.2	6.8e-37
WP_072638367.1|3106490_3107441_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_081374224.1|3107568_3107934_+	HNH endonuclease	NA	A0A1V0DYB1	Dinoroseobacter_phage	50.9	5.0e-24
WP_155773406.1|3107980_3108859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072639354.1|3108860_3109133_+	hypothetical protein	NA	A0A076GCZ2	Sinorhizobium_phage	69.8	4.2e-28
WP_072639355.1|3109125_3109812_+	hypothetical protein	NA	Q8W6F5	Sinorhizobium_phage	40.2	9.0e-35
WP_072639356.1|3109808_3110117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072639357.1|3110113_3110371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072639358.1|3110370_3110781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072639359.1|3110777_3111239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155773407.1|3111235_3111952_+	hypothetical protein	NA	A0A2I7RL04	Vibrio_phage	44.3	2.7e-05
3111853:3111867	attL	CGTTGACGCCGGGGA	NA	NA	NA	NA
WP_072640811.1|3112391_3113186_+|integrase	site-specific integrase	integrase	A0A068CCA6	Rhizobium_phage	72.8	1.2e-115
WP_072640811.1|3112391_3113186_+|integrase	site-specific integrase	integrase	A0A068CCA6	Rhizobium_phage	72.8	1.2e-115
3113980:3113994	attR	TCCCCGGCGTCAACG	NA	NA	NA	NA
>prophage 11
NZ_CP018228	Rhizobium leguminosarum strain Vaf-108 chromosome, complete genome	5119898	3195072	3243703	5119898	protease,transposase	Wolbachia_phage(25.0%)	50	NA	NA
WP_072638201.1|3195072_3196020_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_072639418.1|3196266_3196959_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_020048795.1|3196978_3197686_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_072639419.1|3197742_3198567_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_072639420.1|3198583_3199324_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	9.1e-25
WP_072639421.1|3199316_3200807_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_072639422.1|3200803_3201802_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_072639423.1|3201963_3202446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003546005.1|3202442_3203018_+	peroxidase-related enzyme	NA	NA	NA	NA	NA
WP_011650769.1|3203129_3203615_-	peroxiredoxin	NA	M1I839	Pelagibacter_phage	49.2	8.6e-24
WP_072639424.1|3203745_3204585_-	cytochrome C biogenesis protein	NA	NA	NA	NA	NA
WP_017959273.1|3204726_3205332_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_003546001.1|3205446_3205638_+	CsbD family protein	NA	NA	NA	NA	NA
WP_017959272.1|3205789_3206875_+	putative zinc-binding metallopeptidase	NA	NA	NA	NA	NA
WP_072639425.1|3207273_3208245_+|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	42.3	1.5e-43
WP_011650766.1|3208827_3209283_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	55.8	4.7e-40
WP_072639426.1|3209279_3210245_-	homoserine kinase	NA	NA	NA	NA	NA
WP_003545997.1|3210315_3211317_-	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_072639428.1|3211556_3212303_-	SURF1 family protein	NA	NA	NA	NA	NA
WP_003545995.1|3212295_3212676_-	DUF983 domain-containing protein	NA	NA	NA	NA	NA
WP_072639429.1|3212814_3213456_+	chloramphenicol phosphotransferase	NA	NA	NA	NA	NA
WP_065279191.1|3213646_3214585_-|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	33.3	1.4e-25
WP_072639430.1|3215071_3215947_-	cytochrome c oxidase subunit 3	NA	NA	NA	NA	NA
WP_072639431.1|3216008_3216617_-	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_012756322.1|3216613_3216754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072640820.1|3216753_3217704_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_072639432.1|3217770_3219480_-	cytochrome c oxidase subunit I	NA	R9VX24	Flavobacterium_phage	37.2	5.1e-10
WP_072639433.1|3219497_3220382_-	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
WP_032993053.1|3220722_3221364_+	invasion associated locus B family protein	NA	NA	NA	NA	NA
WP_072639434.1|3221666_3223082_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_072639435.1|3223098_3223590_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_072639436.1|3223702_3224020_-	pyrophosphatase	NA	NA	NA	NA	NA
WP_072639437.1|3224118_3225402_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_072639438.1|3225664_3226702_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_072639439.1|3226708_3227329_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_017959254.1|3227394_3227853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072640821.1|3228160_3229348_+	DnaJ domain-containing protein	NA	A0A1V0SBY2	Catovirus	43.1	1.8e-06
WP_072639440.1|3229469_3230288_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_072639441.1|3230311_3230902_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_003588117.1|3230922_3231117_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0M4RCZ9	Salmonella_phage	56.7	6.7e-12
WP_037115447.1|3231121_3231364_-	DUF1902 domain-containing protein	NA	NA	NA	NA	NA
WP_003569889.1|3231499_3231760_-	DUF1344 domain-containing protein	NA	NA	NA	NA	NA
WP_072639442.1|3235403_3236501_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	39.1	1.9e-63
WP_072639443.1|3236514_3237618_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	36.9	1.6e-57
WP_065279191.1|3237688_3238627_-|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	33.3	1.4e-25
WP_072639444.1|3239001_3240192_-	YcaQ family DNA glycosylase	NA	NA	NA	NA	NA
WP_072639445.1|3240497_3241172_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	25.5	3.3e-05
WP_072639446.1|3241171_3241780_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_072640822.1|3241807_3242371_+	biotin transporter BioY	NA	NA	NA	NA	NA
WP_062940050.1|3242671_3243703_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP018228	Rhizobium leguminosarum strain Vaf-108 chromosome, complete genome	5119898	4817922	4829050	5119898	transposase	Mycobacterium_phage(22.22%)	10	NA	NA
WP_072640463.1|4817922_4820133_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	37.3	7.2e-126
WP_072640464.1|4820800_4821022_+	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	50.7	1.0e-16
WP_072640465.1|4821031_4821436_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	43.1	1.1e-16
WP_072640466.1|4821414_4823613_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.9	3.4e-208
WP_065279191.1|4823845_4824784_+|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	33.3	1.4e-25
WP_072640896.1|4824937_4825912_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	74.1	6.2e-138
WP_072640467.1|4826016_4827240_+	adenylate/guanylate cyclase domain-containing protein	NA	M1HLN3	Pelagibacter_phage	29.3	5.4e-14
WP_072640468.1|4827258_4827987_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	39.2	4.0e-41
WP_072640469.1|4827983_4828340_-	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_072640470.1|4828339_4829050_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2P1JXV3	Rhodococcus_phage	48.7	3.9e-49
>prophage 1
NZ_CP018229	Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence	1331126	52234	196371	1331126	transposase,integrase	Stx2-converting_phage(12.9%)	91	105568:105595	199214:199233
WP_072638006.1|52234_52606_+|transposase	transposase	transposase	A0A1B0YZU7	Pseudomonas_phage	45.7	2.5e-07
WP_003554417.1|52602_52950_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	55.2	3.9e-26
WP_072638007.1|53013_54636_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	40.3	3.7e-103
WP_072638008.1|54635_54932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027668222.1|55226_56123_+	LysR family transcriptional regulator ArgP	NA	NA	NA	NA	NA
WP_027668223.1|56216_56888_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_072640924.1|57478_58843_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_072640925.1|58866_60156_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.2	7.2e-09
WP_072640926.1|60192_61242_-	phosphotransferase	NA	NA	NA	NA	NA
WP_065284230.1|63909_64227_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_065284797.1|64441_65146_+|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_065284454.1|65854_66403_-	inclusion body family protein	NA	NA	NA	NA	NA
WP_065284234.1|66508_67081_-	inclusion body family protein	NA	NA	NA	NA	NA
WP_065284235.1|68638_69631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065283446.1|69736_69964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151343737.1|70108_71998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072640927.1|71994_72993_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_072640928.1|72976_73561_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_065283451.1|73557_74241_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_065283452.1|74237_75281_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_065283453.1|75314_75899_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_065283454.1|75904_76435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072638075.1|76754_77573_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_167378984.1|77722_78088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064247060.1|78922_79684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065284455.1|81495_82548_-	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_064245234.1|83531_85091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072641627.1|85343_86252_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_065284240.1|86356_87700_-	cytochrome P450	NA	A0A2I2L481	Orpheovirus	19.2	5.4e-07
WP_081374233.1|87699_90129_-	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	27.3	4.1e-13
WP_072640930.1|90222_91425_-	cytochrome P450	NA	NA	NA	NA	NA
WP_064246338.1|91604_92426_-	ATP-binding protein	NA	E5EQU5	Bathycoccus_sp._RCC1105_virus	31.1	4.1e-18
WP_155773451.1|93702_93975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072640932.1|95527_97045_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.5	3.6e-44
WP_064245495.1|99862_101197_-	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_072641628.1|101769_103050_-	plasmid partitioning protein RepA	NA	A0A240F4U1	Ochrobactrum_phage	37.0	1.9e-62
102295:102314	attL	GATGACGACGACGTCGTAAT	NA	NA	NA	NA
WP_072641629.1|103437_104238_-	hypothetical protein	NA	NA	NA	NA	NA
105568:105595	attL	GTTTATGCCGACCGTCGAACTATGCCGA	NA	NA	NA	NA
WP_027664907.1|105693_106935_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2K9VF00	Mycobacterium_phage	27.0	4.3e-11
WP_027664909.1|107846_108848_+|integrase	tyrosine-type recombinase/integrase	integrase	S5M9V8	Brevibacillus_phage	23.3	3.2e-12
WP_011654616.1|110547_110898_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	53.3	3.5e-27
108937:108964	attR	TCGGCATAGTTCGACGGTCGGCATAAAC	NA	NA	NA	NA
WP_065283608.1|110894_111302_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
108937:108964	attR	TCGGCATAGTTCGACGGTCGGCATAAAC	NA	NA	NA	NA
WP_072641630.1|111699_112683_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	37.1	5.1e-47
WP_072640933.1|112898_113693_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	34.9	4.9e-32
WP_072637591.1|113682_115203_-|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	27.8	5.5e-24
WP_065284756.1|115588_116389_-	anti-sigma factor	NA	NA	NA	NA	NA
WP_155773452.1|116385_117093_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_072640934.1|117629_118619_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	37.1	1.0e-47
WP_072640935.1|118646_119159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072640936.1|119340_119919_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_072640937.1|120712_122236_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_072640938.1|122927_123905_-	oxidoreductase	NA	NA	NA	NA	NA
WP_072640939.1|124689_125739_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_063474879.1|127276_127483_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	50.0	1.8e-10
WP_081374234.1|128844_129435_+|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_072640932.1|131019_132537_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.5	3.6e-44
WP_155773453.1|133618_133894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062945460.1|136699_137020_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	46.5	6.1e-18
WP_081374236.1|137398_137881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065284259.1|137896_138514_+	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_072640940.1|138814_140380_+	Fic family protein	NA	Q9AZ49	Lactococcus_phage	26.7	1.2e-05
WP_065284262.1|141062_141767_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	37.8	1.8e-25
WP_065284263.1|141790_142042_-|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_028744370.1|142244_142853_+	porin family protein	NA	NA	NA	NA	NA
WP_065284457.1|144050_145160_-	hypothetical protein	NA	A0A172Q0S8	Acinetobacter_phage	33.8	1.6e-36
WP_072641631.1|146509_147352_-	hypothetical protein	NA	A0A291LAE0	Escherichia_phage	38.9	6.7e-48
WP_072640942.1|148530_149235_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	37.8	3.0e-25
WP_072640943.1|149276_149840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072640944.1|152135_153263_+	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	23.2	4.3e-18
WP_065284272.1|153313_154303_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	37.1	3.5e-48
WP_064246437.1|154403_155147_+	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_065284262.1|155866_156571_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	37.8	1.8e-25
WP_064245965.1|156830_157379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072640946.1|160038_173199_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	26.5	6.2e-140
WP_027690647.1|173503_173788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065284458.1|174172_174973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072641633.1|175774_176755_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	42.0	8.3e-58
WP_072641634.1|177422_178397_-	DUF1839 family protein	NA	NA	NA	NA	NA
WP_081374237.1|178405_179578_-|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	30.0	4.2e-24
WP_065284280.1|179981_180452_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_064245499.1|181051_181537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151343744.1|181666_182335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065284282.1|182444_182744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065284283.1|183400_184414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072640947.1|184640_188504_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_072640948.1|188658_189732_-	DUF1612 and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_065283527.1|189850_191497_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_065283526.1|191502_192381_+	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_065282911.1|192377_193433_+	TniQ family protein	NA	NA	NA	NA	NA
WP_065282910.1|193437_194133_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	32.7	5.4e-19
WP_151343567.1|194135_195101_-	DUF1403 family protein	NA	NA	NA	NA	NA
WP_065283700.1|195213_196371_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
199214:199233	attR	ATTACGACGTCGTCGTCATC	NA	NA	NA	NA
>prophage 2
NZ_CP018229	Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence	1331126	265487	352790	1331126	transposase	Shigella_phage(14.29%)	54	NA	NA
WP_130718853.1|265487_266634_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	46.7	8.2e-65
WP_065284748.1|268903_269818_-	alpha/beta hydrolase	NA	A0A2P1EM31	Moumouvirus	27.2	2.6e-13
WP_072641000.1|269872_270973_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	27.7	1.8e-24
WP_155773491.1|271046_272519_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_072640934.1|272976_273966_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	37.1	1.0e-47
WP_081374240.1|274632_275091_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_072641002.1|276534_277239_-|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_072640939.1|277515_278565_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_072640938.1|279349_280327_+	oxidoreductase	NA	NA	NA	NA	NA
WP_072641640.1|283785_284364_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_167378987.1|284545_284995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064245488.1|286421_289163_+	benzoate-CoA ligase family protein	NA	A0A2K9KZV5	Tupanvirus	25.5	1.2e-13
WP_072641003.1|289455_290574_-	ferritin-like protein	NA	NA	NA	NA	NA
WP_065284247.1|292924_293104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159458871.1|295078_295237_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_167378988.1|295317_295551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065283598.1|296483_298601_+	recombinase family protein	NA	NA	NA	NA	NA
WP_151343754.1|298571_298817_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_065284391.1|299643_300693_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_065284392.1|300829_301036_-	putative nitrogen fixation protein NifT	NA	NA	NA	NA	NA
WP_017958634.1|301308_301503_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_065284393.1|301519_303013_-	nitrogenase cofactor biosynthesis protein NifB	NA	NA	NA	NA	NA
WP_065284466.1|303227_304787_-	nif-specific transcriptional activator NifA	NA	NA	NA	NA	NA
WP_065284394.1|304982_305279_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_065284395.1|305291_306599_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_065284396.1|306585_307722_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_065284397.1|307739_308591_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_151343755.1|310744_311974_+	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_065284399.1|312589_313816_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_072641004.1|316859_318233_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_065284400.1|318524_319535_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_065284467.1|320701_321961_+	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_065284401.1|322135_323992_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.9	7.9e-33
WP_155773459.1|325569_325743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065284403.1|325806_326994_-	serine hydrolase	NA	NA	NA	NA	NA
WP_062940075.1|327022_327952_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_072641006.1|327964_329416_-	amidase	NA	NA	NA	NA	NA
WP_072641007.1|329405_331070_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.7	9.6e-14
WP_065284406.1|331066_331918_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_062940079.1|331929_332868_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_062940080.1|332906_334454_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_062940081.1|334682_335723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065284407.1|335719_337162_-	biotin carboxylase	NA	NA	NA	NA	NA
WP_151343756.1|337158_337524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065284408.1|337520_339908_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_062940084.1|340990_341884_+	nitrogenase iron protein	NA	NA	NA	NA	NA
WP_065284409.1|341986_343471_+	nitrogenase molybdenum-iron protein alpha chain	NA	NA	NA	NA	NA
WP_065284410.1|343567_345109_+	nitrogenase molybdenum-iron protein subunit beta	NA	NA	NA	NA	NA
WP_065284411.1|345162_346584_+	nitrogenase iron-molybdenum cofactor biosynthesis protein NifE	NA	NA	NA	NA	NA
WP_065284412.1|346637_347987_+	nitrogenase iron-molybdenum cofactor biosynthesis protein NifN	NA	NA	NA	NA	NA
WP_072641008.1|348349_348673_+	ferredoxin III, nif-specific	NA	NA	NA	NA	NA
WP_065284415.1|348965_350003_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_072641009.1|349999_351100_+	uridylate kinase	NA	NA	NA	NA	NA
WP_072637735.1|351632_352790_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP018231	Rhizobium leguminosarum strain Vaf-108 plasmid unnamed3	339300	65909	177363	339300	integrase,transposase	Leptospira_phage(14.81%)	77	71106:71165	178590:181062
WP_072642072.1|65909_67283_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_064246856.1|69196_70525_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.9	5.4e-36
71106:71165	attL	TCCATGAACGCTCCATCCAGCCTCCACGGGACCTGAACCTACTCAGTACATACAGACGCC	NA	NA	NA	NA
WP_064245255.1|71552_72578_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
71106:71165	attL	TCCATGAACGCTCCATCCAGCCTCCACGGGACCTGAACCTACTCAGTACATACAGACGCC	NA	NA	NA	NA
WP_064245254.1|73485_74964_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_081274371.1|74960_75464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064245252.1|75465_77073_+	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	44.3	4.8e-10
WP_065283422.1|77496_79032_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	28.3	3.9e-38
WP_155773507.1|80591_81308_-|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_072642075.1|84400_85621_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.5	1.8e-41
WP_064251309.1|85794_86862_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	23.1	1.5e-15
WP_072642076.1|89274_89661_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_064251307.1|89785_90799_-|integrase	site-specific integrase	integrase	A0A2K9VH72	Gordonia_phage	29.7	1.3e-10
WP_065279017.1|91522_91795_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_065282351.1|91835_92951_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081274687.1|94550_94988_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_064245671.1|98374_99508_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
97409:97470	attR	TCCATGAACGCTCCATCCAGCCTCCACGGGACCTGAACCTACTCAGTACATACAGACGCCAA	NA	NA	NA	NA
WP_065283426.1|99537_101718_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	28.1	3.1e-44
97409:97470	attR	TCCATGAACGCTCCATCCAGCCTCCACGGGACCTGAACCTACTCAGTACATACAGACGCCAA	NA	NA	NA	NA
WP_155773508.1|102019_102388_+|transposase	transposase	transposase	A0A1B0YZU7	Pseudomonas_phage	40.3	6.2e-06
WP_072642077.1|102384_102705_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	52.0	7.0e-22
WP_065283428.1|103062_105150_+	recombinase family protein	NA	NA	NA	NA	NA
WP_072642078.1|105276_106899_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	39.6	2.7e-101
WP_072642079.1|106898_107195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065279141.1|107457_108654_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	44.1	5.7e-77
WP_072642080.1|108705_109056_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_080739709.1|109052_109220_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	52.2	1.1e-05
WP_072642081.1|109232_111323_-	recombinase family protein	NA	NA	NA	NA	NA
WP_046613048.1|111300_111489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072641630.1|111600_112584_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	37.1	5.1e-47
WP_072642082.1|112551_113121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065284764.1|113117_113702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155773509.1|114399_115589_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.2	5.6e-48
WP_072642084.1|115830_117417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065282351.1|117525_118641_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_065279017.1|118681_118954_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_072642134.1|119005_120121_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_065279116.1|120397_121921_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_065283461.1|122953_123184_-	hypothetical protein	NA	B3FJW3	Pseudomonas_phage	38.9	1.0e-06
WP_065283459.1|123594_124407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065283458.1|124547_125486_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_065283457.1|125478_126072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072642085.1|126629_127829_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	47.9	4.4e-93
WP_072642086.1|127950_130584_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_081374272.1|130952_133028_+	DUF4011 domain-containing protein	NA	NA	NA	NA	NA
WP_072637591.1|133083_134604_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	27.8	5.5e-24
WP_072637590.1|134593_135388_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	35.3	2.2e-32
WP_072642088.1|135487_139459_+	DUF3320 domain-containing protein	NA	NA	NA	NA	NA
WP_065283576.1|140049_141201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065279183.1|141431_143039_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	34.9	2.8e-63
WP_018240906.1|143080_143434_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	41.9	9.7e-17
WP_081374273.1|143417_143897_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_065283454.1|144536_145067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065283453.1|145072_145657_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_065283452.1|145690_146734_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_065283451.1|146730_147414_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_072640928.1|147410_147995_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_072640927.1|147978_148977_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_065283448.1|148973_150005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065279116.1|150292_151816_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_155773510.1|152052_152763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065283446.1|152907_153135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065284235.1|153240_154233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151343623.1|155059_156206_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.8	1.4e-48
WP_065283442.1|156365_156671_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	46.7	4.4e-18
WP_065283441.1|156658_158746_-	recombinase family protein	NA	NA	NA	NA	NA
WP_155773511.1|159789_160194_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_065283439.1|160309_161773_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_065283438.1|162668_163109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072639145.1|163579_164782_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	43.9	7.8e-42
WP_072642093.1|167640_168336_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_072642094.1|168646_169648_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A160DCT0	Gordonia_phage	28.9	5.4e-12
WP_065283434.1|169858_170164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167378999.1|170289_170508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025393262.1|170700_170880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081374274.1|170866_172936_+	recombinase family protein	NA	D2KRD2	Lactobacillus_phage	22.6	2.7e-10
WP_065283431.1|174137_175382_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	25.4	3.9e-12
WP_081374275.1|175378_176350_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_065283430.1|176346_177363_+|integrase	site-specific integrase	integrase	A0A0K2CP59	Brevibacillus_phage	25.7	3.9e-18
178590:181062	attR	CTCGACTACGCATTTTGATGCCCCTCCTGGTGAGGCTGAATGATTCTCAGATCGAGGTGATTAATGGTGCGGTTACGAAGGTCGCGAACCGCGTTGACGATCGCTGGGGAATTTTGGAACAAATATGCTCCGGTTGACTGCTGGTCGATGAGCAGGCGCTTCCGCCTGATTTGGACGTAAATCCAATTGACAGGAATATCGAGCCTGGCGGCCAGTTGTACGGCGCTGAGCAAAGTAGGTTCGTGTGTCCATCTGTTGCGCTGCGCCTTTGCCTTGATGCCCGCTGCAAGGCGGAGGCGTTGCACTGTGATCGGCAAAACCTTGTCTTCGCAATTGGGTGAATGGTGTCCTTCGCGCGTCAGTATTTCAGCGATTTGATCGTCGGGCACGCCCGTCAGAGCGAGCTCCAGCAGACGCGCGCGCAGTTCTTCACCGCGCGTGAGCTTGGCGACGGAATTGACTTTCATTTTGACGTGGAGATCAGTCACGGCGCCGCCACGCCACACGATCCTCGCCAAAGCAACGTCGCGCTCACCGCGGTCAAGTACGACTTTTTCGACAAGGCACCGCAATAGTGCCTTGCGATGAGCGTCGGTCGTCGCATCGTTGGCCCAGATTTGGGGAAGGCTATCGAATAACGCAACGACCTTGTTGTTGAGGTCTTTGCTAAACCCACTGCGCTTGGCGGGTTCAGTCGATGCTCGTTGGGCAACGGCATCTTCAGCAGCGCGAAGTTCGCTCAACGCTGCTTCCCATCGACGCTCGAGTTCGGAGGCGACCAGACGATTATCAGGGTCAACGCGATTGAACTGGCGTTCTGCCAGCGCCGCGGCGTAGCGCTTGCGCTCAAGCTCCCGTTCAGCGCCAGCGCGCAAGGCCTTGTTGACCTGCTGTTGTGCCTGCCGAGCCCGCGCTAGCGCGTCAAGCTCCCCAGGCGCCAACGCGGCCAGGAAAGCGTCCGCCACAGCTGCATCGATCTGAGCCGCACGGACACGCTGGCAGTCCGGCAGGCCAGAGTGGGAATGCAGGTGGTTGCAAGCATACTCTCCGCCACCTTTATAGCGGACGTACATCTTGTAGCCACATCGCCCGCACCAGGCGATGCCGTGCAACAGCAATTCGCCATCACGGGGAGCTCCCCTGGTTTTGGCACGCATGTATTCGGCTCTGTTGTCTCGCACAATATCGCGGATCTTCTCATAGGTTGACCAGTCGATGTAGTGGGGGTAGCGATCCTTCACGATGATCCGCCAGTCTTTAATATCCTTGGGTGTTTTCGCCTCTGAACCGCCGTCACGCCCGGCGGCGCGAAAGCGGGTCCGTCCATAAACGAAGGCACCGGCGTAGGCGGGATTCTTCAAGATCCGGGCCACCGCCGAGACCGTTGCTCGCGCCCAGCGTAGTTCGCCAAACCGGTCGCGGCGCGGCAGGGGAAGGTCCCGATCATTTAGGACGCGCATGACCTTGGCGACGGTCCGGAACTTCAGGAATGTCCGGAACACAAGCTCCAGCCGTTCCTGAACACCTAGATCAGGATCTTTTACGACCACCCCGCTCGCATCGCGCACCAAACCAACCGGCAGCATGAGGGCAAGCTCGCCGCGCTCAGCCTTGGCAAGCAGACCTGCGGTCAAACGGCTCCGGATTGTATGCAGCTCAAGCTCTGAGATGGTTCCCTTCAGACCGAGAAGCAAACGACCATTGGCGCTGCCGGGATCATAGACGCCATCGCGATCGGCAATGAGGCAGCCGCGCAGGCCGCAGATATCAAGCAGCGGATACCAATCCGAACAGTTGCGAGCAAGTCGGGTCACGTCGATCGACAGGATCAAACCGATCTCACTCAGACCAACCCGTCCGACGAGTTCCTTAAAGCCGTTCCTGCCGGTCGTAGAGGCCCCACTGATGCCGAGATCGGCATCGATAACGTCAATATCGGCTTCATGCCAGCCAAGTTCACGAGCGCGCTCGCGGAGCGCGTACTGTAGCCGTAGGCTCTCTTGATTGCTTATGACTTGATGCGGTGTCGACTGACGGACGTAAACAACCGCTCTGCGTGCCAGATGGGTGGGCTTGACCAGTTCGGACTTCATGACATACCTCCGCCAGAACTGCGGCGACGTCGTCGAGAATCTGACGCCGCAACGCGGGTGATAACGTCGCCCACAGGTTCTTCGGTTCGATCATCATGACCTTCGAGAGTTTCCGCCACCGCGATAAGATCCCGAACTGCCTCAACGCTAAGTTTAATCTGATTCGTGGCTTCGACATATCCCTGTGTCGCTGACACGGGTATCAGCAAGGTCGATCCACCACGATGTTCAACCTCATACGAAGGCGCGAAGTTGCCGCCTCTACGTCCCACCTCACGGATTACATTAAAGGAGCGTCCAAATAACGGATGGCTCGGATCCAGCACCTCGATCTTGTCCGGTGATGATTCGTCAGACTCACAAGCAGGGATATTTCTGTA	NA	NA	NA	NA
>prophage 2
NZ_CP018231	Rhizobium leguminosarum strain Vaf-108 plasmid unnamed3	339300	184688	251958	339300	integrase,transposase	Salmonella_phage(30.0%)	55	213194:213212	226026:226044
WP_065283479.1|184688_185672_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	37.1	3.0e-47
WP_072642095.1|185952_186387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072642135.1|186412_186964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167377043.1|187236_187410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064245233.1|187561_188524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065283972.1|188527_190462_+	FHIPEP family type III secretion protein	NA	NA	NA	NA	NA
WP_072642096.1|190525_193666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072642097.1|193950_194631_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	40.5	1.2e-36
WP_072642136.1|194662_195367_-|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_028744370.1|195514_196123_+	porin family protein	NA	NA	NA	NA	NA
WP_072642136.1|196787_197492_+|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_072642100.1|198893_199199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072642101.1|199240_200188_-|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	37.0	1.6e-29
WP_081374277.1|200824_202036_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_065283479.1|202057_203041_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	37.1	3.0e-47
WP_065283974.1|203813_204665_-	EscU/YscU/HrcU family type III secretion system export apparatus switch protein	NA	NA	NA	NA	NA
WP_065283975.1|204651_205467_-	flagellar biosynthetic protein FliR	NA	NA	NA	NA	NA
WP_065283976.1|205472_205742_-	flagellar biosynthetic protein FliQ	NA	NA	NA	NA	NA
WP_064245289.1|205745_206399_-	type III secretion system export apparatus subunit SctR	NA	NA	NA	NA	NA
WP_064245288.1|206398_207409_-	type III secretion system cytoplasmic ring protein SctQ	NA	NA	NA	NA	NA
WP_064245287.1|207405_208725_-	FliI/YscN family ATPase	NA	NA	NA	NA	NA
WP_064245294.1|208717_209281_-	type III secretion system stator protein SctL	NA	NA	NA	NA	NA
WP_064245286.1|209277_209895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081374278.1|209894_210716_-	type III secretion inner membrane ring lipoprotein SctJ	NA	NA	NA	NA	NA
WP_064245285.1|210712_211180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065283977.1|211237_211486_-	hypothetical protein	NA	NA	NA	NA	NA
213194:213212	attL	GAGGGCGATGTCACGTTGT	NA	NA	NA	NA
WP_065284796.1|213961_214183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065284795.1|214182_215355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065284794.1|216076_217066_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJ76	Virus_Rctr85	31.0	1.4e-12
WP_065284793.1|217355_218216_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	33.7	6.2e-33
WP_065284792.1|218360_219437_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_065284791.1|220036_220498_+	mobile mystery protein A	NA	NA	NA	NA	NA
WP_065284790.1|220494_221085_+	mobile mystery protein B	NA	NA	NA	NA	NA
WP_064697843.1|222092_223088_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_065284789.1|223419_223713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072642103.1|226285_226972_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	40.5	1.3e-36
226026:226044	attR	ACAACGTGACATCGCCCTC	NA	NA	NA	NA
WP_081374280.1|226941_228603_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.5	2.1e-16
WP_065284786.1|228671_229994_+	NtaA/DmoA family FMN-dependent monooxygenase	NA	NA	NA	NA	NA
WP_065284785.1|232121_234071_-	RiPP maturation radical SAM protein 1	NA	NA	NA	NA	NA
WP_155773512.1|234067_235552_-	radical SAM family RiPP maturation amino acid epimerase	NA	NA	NA	NA	NA
WP_072642104.1|235605_235953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065282351.1|235963_237079_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_065279017.1|237119_237392_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_167379004.1|240250_240673_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_065284781.1|240948_241680_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_065284780.1|241855_243238_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_065284779.1|243378_244131_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	1.9e-41
WP_065284778.1|244653_244929_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_065284777.1|245881_246529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065284776.1|246621_247167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065284775.1|247333_247975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151047553.1|248038_248569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151047551.1|248811_249498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065284774.1|249641_250721_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_065284773.1|250971_251958_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	37.6	4.4e-51
>prophage 1
NZ_CP018233	Rhizobium leguminosarum strain Vaf-108 plasmid unnamed5, complete sequence	255060	0	1821	255060		Tupanvirus(100.0%)	1	NA	NA
WP_072642350.1|606_1821_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L470	Tupanvirus	36.3	7.9e-42
>prophage 2
NZ_CP018233	Rhizobium leguminosarum strain Vaf-108 plasmid unnamed5, complete sequence	255060	21160	23305	255060		Bacillus_phage(100.0%)	1	NA	NA
WP_017957523.1|21160_23305_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	28.2	1.4e-38
>prophage 3
NZ_CP018233	Rhizobium leguminosarum strain Vaf-108 plasmid unnamed5, complete sequence	255060	27859	38455	255060		Brazilian_cedratvirus(25.0%)	8	NA	NA
WP_072642359.1|27859_30835_-	phosphoglycerate dehydrogenase	NA	A0A2R8FDS8	Brazilian_cedratvirus	25.4	9.1e-07
WP_072642361.1|31202_32114_+	acetamidase/formamidase family protein	NA	A0A1V0S8X7	Catovirus	27.1	1.5e-05
WP_072642362.1|32126_33029_-	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_026160358.1|33094_33892_-	LuxR family transcriptional regulator	NA	A0A1I9KF49	Aeromonas_phage	26.6	2.0e-09
WP_072642363.1|34020_34911_+	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_072642364.1|34962_35901_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_072642365.1|35897_36749_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_072642366.1|36745_38455_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.8	1.7e-10
>prophage 4
NZ_CP018233	Rhizobium leguminosarum strain Vaf-108 plasmid unnamed5, complete sequence	255060	43382	44297	255060		Hokovirus(100.0%)	1	NA	NA
WP_072642373.1|43382_44297_+	J domain-containing protein	NA	A0A1V0SF83	Hokovirus	20.8	1.9e-08
>prophage 5
NZ_CP018233	Rhizobium leguminosarum strain Vaf-108 plasmid unnamed5, complete sequence	255060	49428	50961	255060		Staphylococcus_phage(100.0%)	1	NA	NA
WP_072642377.1|49428_50961_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.1	8.5e-17
>prophage 6
NZ_CP018233	Rhizobium leguminosarum strain Vaf-108 plasmid unnamed5, complete sequence	255060	55045	55831	255060		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_072642382.1|55045_55831_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	27.3	1.5e-09
>prophage 7
NZ_CP018233	Rhizobium leguminosarum strain Vaf-108 plasmid unnamed5, complete sequence	255060	60388	61468	255060		Mycoplasma_phage(100.0%)	1	NA	NA
WP_072642388.1|60388_61468_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	45.2	4.4e-20
>prophage 8
NZ_CP018233	Rhizobium leguminosarum strain Vaf-108 plasmid unnamed5, complete sequence	255060	67764	79326	255060		Planktothrix_phage(50.0%)	10	NA	NA
WP_072642395.1|67764_68586_-	sugar ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.3	4.3e-15
WP_029875350.1|68582_69536_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_072642396.1|69574_70597_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	29.9	1.0e-26
WP_072642397.1|70730_71600_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_017957478.1|71611_72541_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_072642398.1|72544_73546_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.9	3.1e-15
WP_072642399.1|73536_74544_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.7	3.2e-12
WP_028743422.1|74730_76365_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_072642400.1|76399_77944_-	alkaline phosphatase family protein	NA	A0A2K9L727	Tupanvirus	23.9	4.9e-12
WP_072642401.1|78255_79326_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.6	4.5e-25
>prophage 9
NZ_CP018233	Rhizobium leguminosarum strain Vaf-108 plasmid unnamed5, complete sequence	255060	89233	89994	255060	transposase	Paenibacillus_phage(100.0%)	1	NA	NA
WP_155773339.1|89233_89994_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	46.9	2.8e-21
>prophage 10
NZ_CP018233	Rhizobium leguminosarum strain Vaf-108 plasmid unnamed5, complete sequence	255060	94078	95563	255060		Staphylococcus_phage(100.0%)	1	NA	NA
WP_072642411.1|94078_95563_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	5.5e-13
>prophage 11
NZ_CP018233	Rhizobium leguminosarum strain Vaf-108 plasmid unnamed5, complete sequence	255060	101735	108989	255060		Planktothrix_phage(40.0%)	8	NA	NA
WP_072642417.1|101735_102530_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.9	1.6e-19
WP_072642418.1|102526_103306_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.0	1.8e-15
WP_072642419.1|103317_104412_+	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_072642420.1|104474_105347_+	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_072642421.1|105288_106167_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_072642422.1|106166_107171_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.3	1.2e-19
WP_072642423.1|107154_107934_-	glycerophosphodiester phosphodiesterase	NA	A0A173GBD0	Staphylococcus_phage	35.2	3.7e-08
WP_072642424.1|107933_108989_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.0	9.7e-28
>prophage 12
NZ_CP018233	Rhizobium leguminosarum strain Vaf-108 plasmid unnamed5, complete sequence	255060	119894	123328	255060		Aureococcus_anophage(50.0%)	2	NA	NA
WP_072642430.1|119894_121640_+	thiol reductant ABC exporter subunit CydD	NA	A0A076FI99	Aureococcus_anophage	27.9	4.0e-10
WP_072642431.1|121636_123328_+	ATP-binding cassette domain-containing protein	NA	A0A2H4UU96	Bodo_saltans_virus	26.0	3.0e-07
>prophage 13
NZ_CP018233	Rhizobium leguminosarum strain Vaf-108 plasmid unnamed5, complete sequence	255060	129270	130353	255060		Planktothrix_phage(100.0%)	1	NA	NA
WP_072642437.1|129270_130353_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	35.0	5.4e-26
>prophage 14
NZ_CP018233	Rhizobium leguminosarum strain Vaf-108 plasmid unnamed5, complete sequence	255060	136788	137619	255060		Bacillus_virus(100.0%)	1	NA	NA
WP_072642442.1|136788_137619_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	41.0	4.0e-29
>prophage 15
NZ_CP018233	Rhizobium leguminosarum strain Vaf-108 plasmid unnamed5, complete sequence	255060	152988	154077	255060		Planktothrix_phage(100.0%)	1	NA	NA
WP_072642453.1|152988_154077_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.4	4.3e-31
>prophage 16
NZ_CP018233	Rhizobium leguminosarum strain Vaf-108 plasmid unnamed5, complete sequence	255060	157849	162614	255060		Ochrobactrum_phage(50.0%)	4	NA	NA
WP_072642457.1|157849_158308_+	helix-turn-helix transcriptional regulator	NA	Q8W6G2	Sinorhizobium_phage	51.2	1.6e-27
WP_020047615.1|158862_160077_+	plasmid partitioning protein RepA	NA	A0A240F4U1	Ochrobactrum_phage	70.2	3.8e-161
WP_072642459.1|160119_161172_+	plasmid partitioning protein RepB	NA	A0A240F4U0	Ochrobactrum_phage	44.8	2.3e-69
WP_072642460.1|161321_162614_+	replication initiation protein RepC	NA	L7TKN6	Rhizobium_phage	28.8	3.8e-18
>prophage 17
NZ_CP018233	Rhizobium leguminosarum strain Vaf-108 plasmid unnamed5, complete sequence	255060	166048	172637	255060		Halovirus(33.33%)	6	NA	NA
WP_062941821.1|166048_166765_-	hypothetical protein	NA	Q7TDH3	Halovirus	44.5	1.1e-43
WP_062941820.1|166836_167568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017957614.1|167564_168107_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_072642461.1|168508_169645_+	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	30.6	6.8e-19
WP_062941905.1|169930_170497_+	sugar transferase	NA	NA	NA	NA	NA
WP_062941818.1|170621_172637_+	polysaccharide biosynthesis protein	NA	L7RD47	Acanthamoeba_polyphaga_moumouvirus	24.3	3.7e-12
>prophage 18
NZ_CP018233	Rhizobium leguminosarum strain Vaf-108 plasmid unnamed5, complete sequence	255060	182357	183980	255060		Tupanvirus(100.0%)	1	NA	NA
WP_072642466.1|182357_183980_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	30.1	1.9e-59
>prophage 19
NZ_CP018233	Rhizobium leguminosarum strain Vaf-108 plasmid unnamed5, complete sequence	255060	188464	195090	255060		Bacillus_virus(50.0%)	6	NA	NA
WP_072642470.1|188464_189394_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	23.7	5.0e-12
WP_072642471.1|189466_190384_+	DMT family transporter	NA	NA	NA	NA	NA
WP_017957589.1|190481_191255_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	28.3	6.6e-18
WP_072642472.1|191377_192892_+	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_072642473.1|192933_194010_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.8	2.9e-19
WP_072642474.1|194019_195090_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.9	2.7e-17
>prophage 20
NZ_CP018233	Rhizobium leguminosarum strain Vaf-108 plasmid unnamed5, complete sequence	255060	202597	204148	255060		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_072642480.1|202597_204148_-	sugar ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	26.2	1.7e-09
>prophage 21
NZ_CP018233	Rhizobium leguminosarum strain Vaf-108 plasmid unnamed5, complete sequence	255060	209892	212026	255060		Escherichia_phage(50.0%)	3	NA	NA
WP_072642488.1|209892_210201_-	HigA family addiction module antidote protein	NA	A0A0N7BS23	Escherichia_phage	34.1	1.4e-08
WP_027667027.1|210330_210783_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_072642489.1|210793_212026_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	44.1	2.8e-26
>prophage 22
NZ_CP018233	Rhizobium leguminosarum strain Vaf-108 plasmid unnamed5, complete sequence	255060	218581	219679	255060		Planktothrix_phage(100.0%)	1	NA	NA
WP_072642495.1|218581_219679_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	34.3	1.8e-21
>prophage 23
NZ_CP018233	Rhizobium leguminosarum strain Vaf-108 plasmid unnamed5, complete sequence	255060	222906	225672	255060		Herpes_simplex_virus(100.0%)	1	NA	NA
WP_072642498.1|222906_225672_+	glycoside hydrolase family 2	NA	L0N6M2	Herpes_simplex_virus	23.4	2.3e-20
>prophage 24
NZ_CP018233	Rhizobium leguminosarum strain Vaf-108 plasmid unnamed5, complete sequence	255060	228983	231138	255060		Prochlorococcus_phage(50.0%)	2	NA	NA
WP_072642502.1|228983_230054_-	GDP-L-fucose synthase	NA	R9S8B8	Prochlorococcus_phage	55.3	7.1e-95
WP_072642503.1|230046_231138_-	GDP-mannose 4,6-dehydratase	NA	M1IBD7	Acanthocystis_turfacea_Chlorella_virus	63.7	6.3e-131
>prophage 25
NZ_CP018233	Rhizobium leguminosarum strain Vaf-108 plasmid unnamed5, complete sequence	255060	246962	248006	255060		Tupanvirus(100.0%)	1	NA	NA
WP_072642512.1|246962_248006_+	SDR family oxidoreductase	NA	A0A2K9KZK0	Tupanvirus	47.8	1.7e-85
>prophage 26
NZ_CP018233	Rhizobium leguminosarum strain Vaf-108 plasmid unnamed5, complete sequence	255060	252886	253990	255060		Bathycoccus_sp._RCC1105_virus(100.0%)	1	NA	NA
WP_072642514.1|252886_253990_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	33.1	8.8e-48
>prophage 1
NZ_CP018234	Rhizobium leguminosarum strain Vaf-108 plasmid unnamed6, complete sequence	236058	1560	60662	236058	transposase	Salmonella_phage(20.0%)	52	NA	NA
WP_072642621.1|1560_2541_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	42.2	1.2e-56
WP_065284780.1|3253_4636_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_072642521.1|4905_5325_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027690684.1|5370_6123_+|transposase	IS6-like element ISRle7 family transposase	transposase	A0A077SL39	Escherichia_phage	43.8	2.1e-40
WP_072642522.1|6449_7730_+	replication initiation protein RepC	NA	L7TKN6	Rhizobium_phage	27.2	4.5e-19
WP_064246438.1|13740_13929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072642525.1|15110_15668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065279017.1|15999_16272_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_065282351.1|16312_17428_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_033181329.1|17444_18524_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155773527.1|18584_19031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155773528.1|19056_19488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072642527.1|19496_19763_-	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_072642528.1|20003_20984_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_072642529.1|21680_22052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072642531.1|23495_23834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072642532.1|23850_24522_-	ParA family protein	NA	A0A0N7E4H5	Mycobacterium_phage	26.0	6.8e-11
WP_072642533.1|24989_25397_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_072642534.1|25389_28638_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_155773530.1|28790_28937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072642537.1|29388_29949_+	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_072642538.1|29945_30449_+	DUF4238 domain-containing protein	NA	NA	NA	NA	NA
WP_065279981.1|30518_31295_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	47.1	1.1e-60
WP_072642539.1|31311_32865_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	44.7	6.2e-108
WP_037471837.1|33956_34244_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_064697722.1|34240_34468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072642540.1|34680_35148_-	nuclease	NA	NA	NA	NA	NA
WP_072642541.1|35152_35488_-	DUF736 family protein	NA	NA	NA	NA	NA
WP_072642542.1|35539_36130_-	succinoglycan biosynthesis protein exoi	NA	NA	NA	NA	NA
WP_072642543.1|36126_36795_-	acyltransferase	NA	NA	NA	NA	NA
WP_072642544.1|36791_37268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072642545.1|37286_37667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072642546.1|37716_38187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072642547.1|38280_38985_+	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	6.7e-17
WP_081374297.1|39002_39356_+	TrbC/VirB2 family protein	NA	NA	NA	NA	NA
WP_064697755.1|39355_39652_+	VirB3 family type IV secretion system protein	NA	NA	NA	NA	NA
WP_072642623.1|42290_42803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072642548.1|42815_43553_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_072642624.1|43841_44804_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_072642550.1|44836_45583_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_072642625.1|45624_46386_+	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_072642551.1|46375_47641_+	type IV secretion system protein VirB10	NA	NA	NA	NA	NA
WP_081374311.1|47615_48719_+	P-type DNA transfer ATPase VirB11	NA	NA	NA	NA	NA
WP_072642553.1|48715_51073_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_072642554.1|51297_51726_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_072642555.1|51722_52034_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	55.2	6.3e-28
WP_065283428.1|52021_54109_-	recombinase family protein	NA	NA	NA	NA	NA
WP_072642556.1|54601_56245_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	42.3	2.1e-101
WP_041365332.1|56213_56459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072642626.1|57689_58631_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	40.5	5.2e-49
WP_155773531.1|59375_59522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033181329.1|59582_60662_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP018234	Rhizobium leguminosarum strain Vaf-108 plasmid unnamed6, complete sequence	236058	71373	151261	236058	transposase,integrase	Stx2-converting_phage(35.29%)	57	87958:88017	128312:128484
WP_072642564.1|71373_72372_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	39.3	1.4e-52
WP_072642565.1|72582_73821_+|integrase	site-specific integrase	integrase	A0A1B1IQT7	uncultured_Mediterranean_phage	24.7	9.6e-11
WP_072642566.1|73817_74762_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_065284798.1|76687_76888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155773532.1|79389_80476_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_072642570.1|80739_81867_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_072642571.1|83890_84934_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_065279116.1|85088_86612_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_072642572.1|86866_87826_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	26.7	1.9e-06
87958:88017	attL	GTGGACGGCCCCCGAACGGCATCGAAATGTGCCAGAGTGAGCTGTTAACGATCTCAAACG	NA	NA	NA	NA
WP_072642573.1|88029_89097_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_027690684.1|89109_89862_-|transposase	IS6-like element ISRle7 family transposase	transposase	A0A077SL39	Escherichia_phage	43.8	2.1e-40
WP_072642574.1|90043_90328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072642576.1|92773_93697_+	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_155773533.1|94204_94813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081374301.1|94763_95606_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	47.7	5.5e-26
WP_072642580.1|97758_98349_+	recombinase family protein	NA	A0A1W5LU24	Ralstonia_phage	47.9	2.7e-35
WP_072642581.1|98332_99682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072642582.1|100128_101274_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_072642583.1|101270_101519_-	prevent-host-death family protein	NA	NA	NA	NA	NA
WP_072642584.1|101531_101909_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_072642585.1|101905_102199_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_131619194.1|102552_102891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072642587.1|104178_105735_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_072642588.1|105876_107433_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_072637590.1|107575_108370_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	35.3	2.2e-32
WP_072637591.1|108359_109880_-|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	27.8	5.5e-24
WP_072642587.1|110057_111614_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_167379012.1|112438_113692_-	AAA family ATPase	NA	A0A240F4U1	Ochrobactrum_phage	35.2	4.2e-54
WP_072642589.1|114237_115281_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_072642590.1|117085_118243_+	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_064244959.1|118235_119573_+	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_064244960.1|119594_120674_+	fatty acid desaturase family protein	NA	NA	NA	NA	NA
WP_072642591.1|120703_121534_+	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_064244962.1|121599_122205_+	LysE family translocator	NA	NA	NA	NA	NA
WP_064244963.1|122237_123806_+	GMC family oxidoreductase	NA	A0A1V0SI18	Klosneuvirus	38.0	1.2e-93
WP_072642592.1|123802_124984_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_072642593.1|125119_126481_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_072642594.1|126489_127884_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_072642595.1|128572_128962_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
128312:128484	attR	GTGGACGGCCCCCGAACGGCATCGAAATGTGCCAGAGTGAGCTGTTAACGATCTCAAACGAAGGAGCCGTCCGTGGATCAGATTATCCGTATTGGCATGGATACGTCAAAGCACGTCTTTCAATTGCATGGTGTGAACGCCGCCGAGCGGCCGATCCTGCGCAAGAAGATGCG	NA	NA	NA	NA
WP_072638008.1|128939_129236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072638007.1|129235_130858_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	40.3	3.7e-103
WP_065283428.1|131369_133457_+	recombinase family protein	NA	NA	NA	NA	NA
WP_072639154.1|133444_133750_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	52.0	4.3e-21
WP_072638006.1|133746_134118_-|transposase	transposase	transposase	A0A1B0YZU7	Pseudomonas_phage	45.7	2.5e-07
WP_064246224.1|134297_134648_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	58.7	7.3e-33
WP_064246225.1|134695_136339_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	42.3	4.6e-101
WP_041365332.1|136307_136553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072642596.1|136836_137109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027689785.1|137320_138064_-	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_065284789.1|141261_141555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072642597.1|141886_142834_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_065284366.1|144135_145659_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_065284022.1|146014_146911_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_072642630.1|147707_148367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065283608.1|148808_149216_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_072642598.1|149270_149567_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	53.9	4.6e-20
WP_155773535.1|149626_151261_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	43.3	2.6e-104
>prophage 1
NZ_CP018235	Rhizobium leguminosarum strain Vaf-108 plasmid unnamed7, complete sequence	227762	14965	60158	227762	integrase,transposase	Streptococcus_phage(54.55%)	37	22508:22523	63345:63360
WP_167379014.1|14965_15067_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_167378988.1|15206_15440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065283598.1|16372_18490_+	recombinase family protein	NA	NA	NA	NA	NA
WP_072642640.1|18460_18697_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_167379015.1|18693_19044_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_072642641.1|20891_21644_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	46.2	1.2e-43
22508:22523	attL	CAGGCTGCGATCCTGC	NA	NA	NA	NA
WP_027690338.1|22596_22809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072642691.1|23094_24591_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	36.5	6.1e-76
WP_072642642.1|26157_27225_-	ATP-dependent DNA ligase	NA	A0A068CDF3	Rhizobium_phage	64.0	7.3e-124
WP_072642643.1|28115_29099_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	36.8	3.9e-47
WP_072642528.1|29933_30914_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_081374304.1|31123_31291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072642603.1|31406_32225_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_064244956.1|32484_32766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065284761.1|32933_33932_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	39.3	4.1e-52
WP_065284762.1|34147_34744_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_065284763.1|34794_36528_+	FAD/NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_065284764.1|36524_37109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072642644.1|37259_37970_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	37.4	1.0e-28
WP_072642645.1|38579_39266_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	41.0	3.9e-38
WP_065284296.1|39664_39838_-	entry exclusion protein TrbK	NA	NA	NA	NA	NA
WP_072642645.1|40212_40899_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	41.0	3.9e-38
WP_155773538.1|41008_41491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072642645.1|41489_42176_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	41.0	3.9e-38
WP_072642646.1|43454_43655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065284680.1|46876_47935_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_072642647.1|47931_48750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072642645.1|49713_50400_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	41.0	3.9e-38
WP_072642648.1|50468_51572_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155773539.1|51578_51917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065283527.1|52206_53853_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_065283526.1|53858_54737_+	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_065282911.1|54733_55789_+	TniQ family protein	NA	NA	NA	NA	NA
WP_065282910.1|55793_56489_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	32.7	5.4e-19
WP_151343567.1|56491_57457_-	DUF1403 family protein	NA	NA	NA	NA	NA
WP_065283700.1|57569_58727_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_072642650.1|59009_60158_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
63345:63360	attR	CAGGCTGCGATCCTGC	NA	NA	NA	NA
>prophage 2
NZ_CP018235	Rhizobium leguminosarum strain Vaf-108 plasmid unnamed7, complete sequence	227762	151872	202114	227762	transposase	Pseudomonas_phage(18.18%)	39	NA	NA
WP_072642669.1|151872_152307_-|transposase	transposase	transposase	A0A1B0YZU7	Pseudomonas_phage	38.8	2.1e-05
WP_064246335.1|152522_152843_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	47.5	7.2e-19
WP_081374317.1|155167_155650_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_072642670.1|155751_156003_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_072642671.1|156002_157184_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_072640244.1|157189_158098_+	amino acid--[acyl-carrier-protein] ligase	NA	NA	NA	NA	NA
WP_072640880.1|158106_159069_+	DUF1839 family protein	NA	NA	NA	NA	NA
WP_072642672.1|159085_161566_+	glycoside hydrolase family 2 protein	NA	NA	NA	NA	NA
WP_018496486.1|164750_165092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062945460.1|167197_167518_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	46.5	6.1e-18
WP_072642669.1|167733_168168_+|transposase	transposase	transposase	A0A1B0YZU7	Pseudomonas_phage	38.8	2.1e-05
WP_151343747.1|170426_170744_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_155773542.1|170877_171549_+|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_072642676.1|171749_172871_-	ROK family protein	NA	NA	NA	NA	NA
WP_072642677.1|173484_174771_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A218MN59	uncultured_virus	21.8	5.3e-12
WP_062943398.1|174902_175574_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_072642678.1|175899_176256_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_065284363.1|176787_177795_+	glycerophosphodiester phosphodiesterase family protein	NA	NA	NA	NA	NA
WP_072642679.1|177842_178913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072642680.1|179984_180698_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155773543.1|180892_181600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072642681.1|183184_184171_-	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_064250620.1|184176_185199_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_064250619.1|185262_185646_-	reactive intermediate/imine deaminase	NA	NA	NA	NA	NA
WP_072642682.1|185826_186747_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_072642693.1|186911_188117_+	aminotransferase class V-fold PLP-dependent enzyme	NA	Q2XUY6	environmental_halophage	25.5	1.3e-31
WP_062943386.1|189388_190168_+	response regulator	NA	W8CYM9	Bacillus_phage	29.3	1.1e-15
WP_155755899.1|190336_190537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072642684.1|191318_192767_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_072642685.1|193241_193463_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_072642686.1|193977_195576_-	asparagine synthase	NA	NA	NA	NA	NA
WP_167379018.1|195649_195808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072638011.1|195986_196427_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_072638010.1|196410_196764_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	45.2	3.0e-18
WP_072638009.1|196835_198425_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	34.7	9.0e-62
WP_065284369.1|198742_199297_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_041365281.1|199647_200076_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_064246224.1|200072_200423_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	58.7	7.3e-33
WP_064246225.1|200470_202114_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	42.3	4.6e-101

