The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018303	Mycobacterium tuberculosis strain I0004241-1, complete genome	4386132	2925787	2964059	4386132	protease,tRNA,capsid,integrase,head,terminase	Mycobacterium_phage(30.0%)	48	2954588:2954615	2964212:2964239
WP_003413486.1|2925787_2927866_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2927974_2928202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009938541.1|2928198_2929584_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2929928_2930429_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2930445_2930886_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003901437.1|2931032_2931710_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2931694_2932048_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2932060_2932486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070891024.1|2932482_2933157_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2933234_2934056_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2934191_2935085_+	universal stress protein	NA	NA	NA	NA	NA
WP_003413594.1|2935087_2935906_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2935920_2937102_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2937160_2937592_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2938105_2939347_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003899403.1|2939656_2940019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413610.1|2940365_2941490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2941491_2942031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413616.1|2942170_2943469_+	RNA-splicing ligase RtcB	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
WP_003413619.1|2943507_2943789_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2943933_2944419_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_003902325.1|2944445_2944703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009938544.1|2944703_2947040_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2947068_2947311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2947311_2947989_+	membrane protein	NA	NA	NA	NA	NA
WP_003413654.1|2948184_2948841_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2949003_2949450_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2949624_2949957_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2950076_2950436_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2950537_2950996_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2951131_2951512_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2951508_2953005_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_085972563.1|2953194_2953431_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
WP_077365235.1|2953503_2953677_+	hypothetical protein	NA	NA	NA	NA	NA
2954588:2954615	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2954721_2955153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2955149_2956148_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2956161_2956626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003908028.1|2956613_2956865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899411.1|2957035_2958475_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2958482_2959016_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003899413.1|2959168_2959795_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
WP_052635321.1|2959826_2960150_-	type II toxin-antitoxin system toxin	NA	NA	NA	NA	NA
WP_003899415.1|2960229_2960475_-	antitoxin	NA	NA	NA	NA	NA
WP_003899416.1|2960471_2961899_-	DUF3631 domain-containing protein	NA	NA	NA	NA	NA
WP_003899417.1|2961900_2962293_-	DUF2742 domain-containing protein	NA	NA	NA	NA	NA
WP_003899418.1|2962289_2962550_-	helix-turn-helix domain-containing protein	NA	A0A2P1CHK7	Mycobacterium_phage	64.6	3.0e-15
WP_003900543.1|2962566_2962929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899420.1|2962931_2964059_-|integrase	site-specific integrase	integrase	A0A1X9SFC1	Mycobacterium_phage	40.4	1.5e-66
2964212:2964239	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
