The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018305	Mycobacterium tuberculosis strain M0018684-2, complete genome	4359825	2926544	2964816	4359825	tRNA,integrase,capsid,terminase,protease,head	Mycobacterium_phage(30.0%)	48	2955345:2955372	2964969:2964996
WP_003413486.1|2926544_2928623_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2928731_2928959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009938541.1|2928955_2930341_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2930685_2931186_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003906873.1|2931202_2931643_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003901437.1|2931789_2932467_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2932451_2932805_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2932817_2933243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003413588.1|2933239_2933914_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2933991_2934813_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2934948_2935842_+	universal stress protein	NA	NA	NA	NA	NA
WP_003413594.1|2935844_2936663_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2936677_2937859_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2937917_2938349_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2938862_2940104_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003899403.1|2940413_2940776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413610.1|2941122_2942247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2942248_2942788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413616.1|2942927_2944226_+	RNA-splicing ligase RtcB	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
WP_003413619.1|2944264_2944546_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2944690_2945176_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_003902325.1|2945202_2945460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009938544.1|2945460_2947797_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2947825_2948068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2948068_2948746_+	membrane protein	NA	NA	NA	NA	NA
WP_003413654.1|2948941_2949598_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2949760_2950207_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2950381_2950714_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2950833_2951193_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2951294_2951753_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2951888_2952269_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2952265_2953762_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_085972563.1|2953951_2954188_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
WP_077365235.1|2954260_2954434_+	hypothetical protein	NA	NA	NA	NA	NA
2955345:2955372	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2955478_2955910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2955906_2956905_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2956918_2957383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003908028.1|2957370_2957622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899411.1|2957792_2959232_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2959239_2959773_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003899413.1|2959925_2960552_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
WP_003899414.1|2960583_2960907_-	type II toxin-antitoxin system toxin	NA	NA	NA	NA	NA
WP_003899415.1|2960986_2961232_-	antitoxin	NA	NA	NA	NA	NA
WP_003899416.1|2961228_2962656_-	DUF3631 domain-containing protein	NA	NA	NA	NA	NA
WP_003899417.1|2962657_2963050_-	DUF2742 domain-containing protein	NA	NA	NA	NA	NA
WP_003899418.1|2963046_2963307_-	helix-turn-helix domain-containing protein	NA	A0A2P1CHK7	Mycobacterium_phage	64.6	3.0e-15
WP_003900543.1|2963323_2963686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899420.1|2963688_2964816_-|integrase	site-specific integrase	integrase	A0A1X9SFC1	Mycobacterium_phage	40.4	1.5e-66
2964969:2964996	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
