The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018302	Mycobacterium tuberculosis strain I0004000-1, complete genome	4365724	2925329	2960696	4365724	capsid,protease,terminase,head,integrase,tRNA,transposase	Tupanvirus(11.11%)	40	2954131:2954158	2965113:2965140
WP_003413486.1|2925329_2927408_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2927516_2927744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009938541.1|2927740_2929126_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2929470_2929971_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003906873.1|2929987_2930428_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003901437.1|2930574_2931252_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2931236_2931590_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2931602_2932028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003413588.1|2932024_2932699_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2932776_2933598_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2933733_2934627_+	universal stress protein	NA	NA	NA	NA	NA
WP_003413594.1|2934629_2935448_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2935462_2936644_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2936702_2937134_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2937647_2938889_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003899403.1|2939198_2939561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413610.1|2939907_2941032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2941033_2941573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413616.1|2941712_2943011_+	RNA-splicing ligase RtcB	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
WP_003413619.1|2943049_2943331_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2943475_2943961_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_003902325.1|2943987_2944245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899405.1|2946611_2946854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2946854_2947532_+	membrane protein	NA	NA	NA	NA	NA
WP_003413654.1|2947727_2948384_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2948546_2948993_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2949167_2949500_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2949619_2949979_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2950080_2950539_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2950674_2951055_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2951051_2952548_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_085972563.1|2952737_2952974_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
WP_077365235.1|2953046_2953220_+	hypothetical protein	NA	NA	NA	NA	NA
2954131:2954158	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2954264_2954696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2954692_2955691_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2955704_2956169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087902221.1|2956388_2957649_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_003899411.1|2957936_2959376_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2959383_2959917_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003899413.1|2960069_2960696_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
2965113:2965140	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
