The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018301	Mycobacterium tuberculosis strain I0002801-4, complete genome	4376067	2922735	2961007	4376067	tRNA,head,terminase,protease,capsid,integrase	Mycobacterium_phage(30.0%)	48	2951536:2951563	2961160:2961187
WP_003413486.1|2922735_2924814_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2924922_2925150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009938541.1|2925146_2926532_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2926876_2927377_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2927393_2927834_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_010924555.1|2927980_2928658_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2928642_2928996_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2929008_2929434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003413588.1|2929430_2930105_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2930182_2931004_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2931139_2932033_+	universal stress protein	NA	NA	NA	NA	NA
WP_003413594.1|2932035_2932854_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2932868_2934050_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2934108_2934540_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2935053_2936295_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003899403.1|2936604_2936967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413610.1|2937313_2938438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2938439_2938979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010924557.1|2939118_2940417_+	RNA-splicing ligase RtcB	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
WP_003413619.1|2940455_2940737_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2940881_2941367_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_003902325.1|2941393_2941651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023641824.1|2941651_2943988_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2944016_2944259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2944259_2944937_+	membrane protein	NA	NA	NA	NA	NA
WP_003413654.1|2945132_2945789_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2945951_2946398_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2946572_2946905_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2947024_2947384_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2947485_2947944_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2948079_2948460_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2948456_2949953_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_085972563.1|2950142_2950379_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
WP_077365235.1|2950451_2950625_+	hypothetical protein	NA	NA	NA	NA	NA
2951536:2951563	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2951669_2952101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2952097_2953096_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2953109_2953574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003908028.1|2953561_2953813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899411.1|2953983_2955423_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2955430_2955964_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003899413.1|2956116_2956743_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
WP_003899414.1|2956774_2957098_-	type II toxin-antitoxin system toxin	NA	NA	NA	NA	NA
WP_003899415.1|2957177_2957423_-	antitoxin	NA	NA	NA	NA	NA
WP_003899416.1|2957419_2958847_-	DUF3631 domain-containing protein	NA	NA	NA	NA	NA
WP_003899417.1|2958848_2959241_-	DUF2742 domain-containing protein	NA	NA	NA	NA	NA
WP_003899418.1|2959237_2959498_-	helix-turn-helix domain-containing protein	NA	A0A2P1CHK7	Mycobacterium_phage	64.6	3.0e-15
WP_003900543.1|2959514_2959877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899420.1|2959879_2961007_-|integrase	site-specific integrase	integrase	A0A1X9SFC1	Mycobacterium_phage	40.4	1.5e-66
2961160:2961187	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
