The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018300	Mycobacterium tuberculosis strain I0002353-6, complete genome	4385578	2926707	2964980	4385578	integrase,capsid,terminase,protease,head,tRNA	Mycobacterium_phage(30.0%)	47	2955509:2955536	2965133:2965160
WP_003413486.1|2926707_2928786_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2928894_2929122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009938541.1|2929118_2930504_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2930848_2931349_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2931365_2931806_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003901437.1|2931952_2932630_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2932614_2932968_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2932980_2933406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003413588.1|2933402_2934077_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2934154_2934976_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2935111_2936005_+	universal stress protein	NA	NA	NA	NA	NA
WP_003413594.1|2936007_2936826_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2936840_2938022_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2938080_2938512_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2939025_2940267_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003899403.1|2940576_2940939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413610.1|2941285_2942410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2942411_2942951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413616.1|2943090_2944389_+	RNA-splicing ligase RtcB	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
WP_003413619.1|2944427_2944709_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2944853_2945339_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_003902325.1|2945365_2945623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009938544.1|2945623_2947960_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2947988_2948231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2948231_2948909_+	membrane protein	NA	NA	NA	NA	NA
WP_003413657.1|2949924_2950371_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2950545_2950878_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2950997_2951357_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2951458_2951917_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2952052_2952433_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2952429_2953926_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_085972563.1|2954115_2954352_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
WP_077365235.1|2954424_2954598_+	hypothetical protein	NA	NA	NA	NA	NA
2955509:2955536	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2955642_2956074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2956070_2957069_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2957082_2957547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003908028.1|2957534_2957786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899411.1|2957956_2959396_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2959403_2959937_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003899413.1|2960089_2960716_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
WP_003899414.1|2960747_2961071_-	type II toxin-antitoxin system toxin	NA	NA	NA	NA	NA
WP_003899415.1|2961150_2961396_-	antitoxin	NA	NA	NA	NA	NA
WP_003899416.1|2961392_2962820_-	DUF3631 domain-containing protein	NA	NA	NA	NA	NA
WP_003899417.1|2962821_2963214_-	DUF2742 domain-containing protein	NA	NA	NA	NA	NA
WP_014585547.1|2963210_2963471_-	helix-turn-helix domain-containing protein	NA	A0A2P1CHK7	Mycobacterium_phage	63.1	1.9e-14
WP_003900543.1|2963487_2963850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899420.1|2963852_2964980_-|integrase	site-specific integrase	integrase	A0A1X9SFC1	Mycobacterium_phage	40.4	1.5e-66
2965133:2965160	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
