The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010121	Escherichia coli strain C4 chromosome, complete genome	4990476	1752962	1835583	4990476	protease,integrase,portal,tRNA,head,holin,terminase,plate,tail,capsid	Shigella_phage(49.09%)	85	1764795:1764816	1803808:1803829
WP_001224626.1|1752962_1753532_-	tyrosine-type DNA invertase IpuB	NA	A0A2L1IV36	Escherichia_phage	52.2	7.0e-49
WP_001181151.1|1754280_1754910_+	tyrosine-type DNA invertase IpuA	NA	A0A2L1IV36	Escherichia_phage	99.0	4.1e-119
WP_000243047.1|1755227_1755848_+	LuxR family transcriptional regulator	NA	A0A2L1IV08	Escherichia_phage	99.5	3.5e-118
WP_073461845.1|1755872_1763786_+	phase-variable autotransporter adhesin UpaE	NA	A0A2L1IV38	Escherichia_phage	95.5	0.0e+00
WP_021564489.1|1763845_1764364_+	hypothetical protein	NA	A0A2L1IV11	Escherichia_phage	95.9	4.4e-82
1764795:1764816	attL	TGATAAATGGTGTCCCCTGCAG	NA	NA	NA	NA
WP_001163428.1|1764889_1765090_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_000206059.1|1765221_1765566_-	hypothetical protein	NA	U5P0J0	Shigella_phage	79.5	1.7e-29
WP_000135680.1|1768064_1768427_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_001306230.1|1769027_1769303_-	hypothetical protein	NA	Q8SBF7	Shigella_phage	96.7	3.5e-46
WP_001083098.1|1769311_1769515_-	hypothetical protein	NA	A0A1C9II97	Salmonella_phage	75.5	2.0e-14
WP_000450737.1|1769699_1770326_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	1.9e-47
WP_000205494.1|1770423_1770624_+	cell division protein	NA	NA	NA	NA	NA
WP_000515869.1|1770661_1771219_+	protein YmfL	NA	U5P4K1	Shigella_phage	96.8	8.8e-97
WP_001250269.1|1771394_1771574_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_016240451.1|1771563_1772505_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	99.0	5.6e-152
WP_001306226.1|1772501_1772996_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	95.7	1.2e-84
WP_001306225.1|1772995_1773649_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.2	2.8e-126
WP_000210170.1|1773645_1773972_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_000767113.1|1773968_1774358_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_001061444.1|1774377_1775187_+	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_073461846.1|1775194_1776184_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	7.3e-195
WP_029393279.1|1776201_1776555_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	85.8	4.5e-54
WP_047645442.1|1776565_1777606_-	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	39.9	2.2e-64
WP_072002824.1|1777609_1779370_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_061300875.1|1779679_1780006_+|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	98.1	4.4e-56
WP_042024491.1|1780009_1780486_+	glycoside hydrolase family 104 protein	NA	S5FV07	Shigella_phage	95.6	1.3e-85
WP_042024493.1|1780469_1780862_+	DUF2570 domain-containing protein	NA	U5P0U9	Shigella_phage	92.3	2.8e-57
WP_061300873.1|1781122_1781407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061300872.1|1781657_1782008_+	HNH endonuclease	NA	Q8SBD7	Shigella_phage	94.8	5.8e-62
WP_000929173.1|1782133_1782628_+|terminase	phage terminase small subunit P27 family	terminase	Q8SBI1	Shigella_phage	100.0	1.3e-88
WP_065312442.1|1782861_1784358_+|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.6	1.7e-299
WP_000605604.1|1784369_1784552_+	hypothetical protein	NA	M1FJ83	Enterobacteria_phage	100.0	1.7e-25
WP_000466255.1|1784551_1785793_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_001193631.1|1785770_1786421_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_000257509.1|1786435_1787641_+|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.8	5.3e-224
WP_000601360.1|1787690_1787891_+	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
WP_000927711.1|1787893_1788217_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000702391.1|1788213_1788624_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	93.4	9.7e-69
WP_000224835.1|1788598_1789105_+	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	92.9	1.3e-83
WP_000779294.1|1789101_1789662_+	hypothetical protein	NA	Q8SBH4	Shigella_phage	99.5	1.8e-105
WP_000497751.1|1789670_1789841_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_073461847.1|1789824_1791321_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1FN90	Enterobacteria_phage	98.6	1.1e-271
WP_000090998.1|1791320_1791677_+|tail	phage tail tube protein	tail	U5P076	Shigella_phage	100.0	5.3e-63
WP_000661056.1|1791676_1791946_+|tail	phage tail assembly protein	tail	S5FNR3	Shigella_phage	98.9	3.9e-42
WP_053295887.1|1792087_1793920_+|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	98.4	2.6e-302
WP_000679482.1|1794011_1794542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001306862.1|1794603_1795932_+	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	97.5	4.3e-243
WP_000999496.1|1795928_1797008_+	hypothetical protein	NA	Q8SBG7	Shigella_phage	98.9	1.0e-205
WP_001259091.1|1797007_1797556_+|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	98.9	5.1e-97
WP_000424732.1|1797555_1797981_+	phage GP46 family protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_000785330.1|1797967_1799026_+|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.0	5.8e-198
WP_000383575.1|1799016_1799601_+	YmfQ family protein	NA	O22003	Shigella_phage	98.5	7.8e-112
WP_000554675.1|1799604_1800537_+	hypothetical protein	NA	U5P0I1	Shigella_phage	96.2	5.5e-51
WP_000998154.1|1800537_1800942_+|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	62.5	3.8e-17
WP_000845327.1|1801230_1802352_-	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	26.4	2.0e-23
WP_000958658.1|1802495_1803653_-|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.2	4.1e-221
WP_000368134.1|1803964_1804897_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.7	2.7e-167
1803808:1803829	attR	TGATAAATGGTGTCCCCTGCAG	NA	NA	NA	NA
WP_000776768.1|1805190_1805946_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000937801.1|1806124_1807372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001362313.1|1807738_1809079_-	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_001314905.1|1809450_1809735_+	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_000531926.1|1809916_1811227_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000425029.1|1811226_1813371_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_001195819.1|1813573_1814059_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000033306.1|1814721_1815288_+	fimbrial protein	NA	NA	NA	NA	NA
WP_001114070.1|1815371_1818011_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000170518.1|1818030_1818780_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000826022.1|1818795_1819287_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000826834.1|1819283_1819763_+	fimbrial protein	NA	NA	NA	NA	NA
WP_001037531.1|1819759_1820305_+	fimbrial protein	NA	NA	NA	NA	NA
WP_001520950.1|1820306_1821170_+	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000730805.1|1821239_1821791_-	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001309606.1|1821956_1822889_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_073461848.1|1822923_1824009_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.1	1.4e-90
WP_001043808.1|1824012_1824837_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000447361.1|1824836_1825646_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_001089220.1|1825645_1826194_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000559764.1|1826227_1826506_+	YfcL family protein	NA	NA	NA	NA	NA
WP_000683773.1|1826626_1828633_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000817178.1|1828791_1830012_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000127790.1|1830286_1831465_+	MFS transporter	NA	NA	NA	NA	NA
WP_000615814.1|1831461_1832457_-	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000699155.1|1832555_1833692_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	28.8	5.0e-22
WP_001289182.1|1833757_1834771_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001283590.1|1834770_1835583_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP010121	Escherichia coli strain C4 chromosome, complete genome	4990476	2056234	2064544	4990476		Enterobacteria_phage(83.33%)	9	NA	NA
WP_000569374.1|2056234_2057161_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783144.1|2057165_2057897_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|2057877_2057985_-	protein YohO	NA	NA	NA	NA	NA
WP_001240398.1|2058044_2058776_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001309587.1|2058997_2060683_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	7.3e-304
WP_001314877.1|2060679_2061399_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|2061445_2061916_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|2061957_2062419_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001314876.1|2062543_2064544_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
>prophage 3
NZ_CP010121	Escherichia coli strain C4 chromosome, complete genome	4990476	2188638	2225098	4990476	integrase,portal,lysis,coat,holin,terminase	Enterobacteria_phage(52.63%)	58	2180290:2180304	2219316:2219330
2180290:2180304	attL	CAAAGTAACGGCATT	NA	NA	NA	NA
WP_038976908.1|2188638_2189817_+|integrase	site-specific integrase	integrase	A0A0P0ZDN8	Stx2-converting_phage	99.7	2.0e-231
WP_000132739.1|2189797_2189989_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_000545737.1|2190328_2190496_-	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	100.0	9.8e-28
WP_038977008.1|2190568_2190853_-	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	93.6	2.1e-46
WP_063120229.1|2190852_2191113_-	hypothetical protein	NA	A0A077SLR0	Escherichia_phage	96.5	1.6e-40
WP_073461860.1|2191109_2191850_-	DUF551 domain-containing protein	NA	K7P7E4	Enterobacteria_phage	46.8	5.7e-59
WP_073461861.1|2191846_2192521_-	ead/Ea22-like family protein	NA	K7P6T4	Enterobacteria_phage	78.7	7.6e-95
WP_073461862.1|2192517_2193057_-	hypothetical protein	NA	K7PJM1	Enterobacteria_phage	73.7	6.8e-62
WP_001214452.1|2193053_2193218_-	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	98.1	4.6e-22
WP_000753555.1|2193234_2193549_-	hypothetical protein	NA	K7PLT4	Enterobacteria_phage	100.0	1.2e-50
WP_059274451.1|2193560_2194043_-	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	98.8	2.5e-79
WP_000065846.1|2194026_2194929_-	recombinase RecT	NA	K7PKG9	Enterobacteria_phage	88.4	5.2e-147
WP_000604105.1|2194925_2195234_-	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	99.0	2.5e-53
WP_001243353.1|2195318_2195471_-	host cell division inhibitory peptide Kil	NA	K7P837	Enterobacteria_phage	100.0	4.7e-21
WP_000972063.1|2195455_2195590_-	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	100.0	3.1e-16
WP_023565733.1|2195673_2196090_-	hypothetical protein	NA	A0A0U2DAF7	Escherichia_phage	66.4	2.6e-53
WP_021499330.1|2196380_2196677_-	hypothetical protein	NA	K7PH98	Enterobacteria_phage	99.0	4.3e-50
WP_000394305.1|2196716_2196968_-	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	98.8	1.4e-41
WP_000219337.1|2196976_2197276_-	hypothetical protein	NA	A5VW99	Enterobacteria_phage	99.0	3.4e-31
WP_000856967.1|2197590_2198241_-	LexA family transcriptional regulator	NA	A5VW98	Enterobacteria_phage	100.0	1.1e-122
WP_000276886.1|2198321_2198507_+	Cro/Cl family transcriptional regulator	NA	A5VW97	Enterobacteria_phage	100.0	1.6e-26
WP_000251072.1|2198613_2198907_+	lambda phage CII family protein	NA	A5VW96	Enterobacteria_phage	100.0	1.7e-46
WP_001244621.1|2198929_2199202_+	hypothetical protein	NA	G9L679	Escherichia_phage	100.0	2.7e-43
WP_073462043.1|2199264_2200152_+	replication protein	NA	A5VW95	Enterobacteria_phage	90.8	3.8e-142
WP_000806596.1|2200148_2201525_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	99.8	1.3e-253
WP_073461863.1|2201598_2202039_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	99.3	2.0e-80
WP_073461864.1|2202035_2202563_+	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	98.9	1.8e-99
WP_001254255.1|2202559_2202736_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_073461865.1|2202738_2203098_+	DUF2591 family protein	NA	G8EYI2	Enterobacteria_phage	95.0	2.7e-62
WP_000950944.1|2203097_2203274_+	protein ninF	NA	Q76H71	Enterobacteria_phage	98.3	1.1e-26
WP_001108033.1|2203266_2203878_+	recombination protein NinG	NA	K7PHM2	Enterobacterial_phage	99.5	4.6e-99
WP_000144614.1|2203874_2204081_+	phage NinH family protein	NA	Q716C0	Shigella_phage	100.0	7.3e-33
WP_058905802.1|2204058_2204724_+	serine/threonine protein phosphatase	NA	A0A2D1GLI5	Escherichia_phage	98.2	2.1e-129
WP_001235461.1|2204720_2205344_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	100.0	3.0e-114
WP_000783734.1|2205777_2206101_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_000229390.1|2206084_2206561_+	glycoside hydrolase family protein	NA	G5DA94	Enterobacteria_phage	100.0	9.8e-89
WP_073461866.1|2206557_2206995_+|lysis	lysis protein	lysis	K7PJN9	Enterobacteria_phage	99.3	2.6e-72
WP_000839225.1|2207196_2207694_+	KilA-N domain-containing protein	NA	A0A220NRM9	Escherichia_phage	100.0	1.1e-93
WP_073461867.1|2207690_2207954_+	hypothetical protein	NA	A0A1V0E5Q1	Salmonella_phage	98.6	2.1e-32
WP_149025252.1|2208169_2208355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000807788.1|2208494_2208737_+	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_000729922.1|2208772_2209261_+	DNA-packaging protein	NA	A0A0M3ULC0	Salmonella_phage	100.0	5.0e-88
WP_001404864.1|2209238_2210738_+|terminase	terminase large subunit	terminase	A0A2D1GLW6	Escherichia_phage	99.8	2.4e-306
WP_073461868.1|2210738_2212904_+|portal	portal protein	portal	G5DA97	Enterobacteria_phage	99.6	0.0e+00
WP_000373006.1|2212917_2213829_+	scaffold protein	NA	A0A2D1GLN7	Escherichia_phage	100.0	1.3e-161
WP_073461869.1|2213829_2214345_-	HNH endonuclease	NA	A0A291AXK2	Shigella_phage	39.5	3.2e-24
WP_073461870.1|2214418_2215714_+|coat	coat protein	coat	A0A2D1GLV2	Escherichia_phage	97.9	2.0e-240
WP_000115359.1|2215757_2216357_+	hypothetical protein	NA	I6S1J7	Salmonella_phage	61.8	6.0e-59
WP_073461871.1|2216334_2216835_+	recombinase RmuC	NA	G8EYJ2	Enterobacteria_phage	98.8	1.9e-90
WP_073461872.1|2216835_2218254_+	packaged DNA stabilization protein gp10	NA	Q716G7	Shigella_phage	98.7	3.0e-274
WP_073461873.1|2218253_2219207_+	hypothetical protein	NA	Q716G6	Shigella_phage	84.5	3.5e-93
WP_073461874.1|2219206_2219662_+	DUF2824 family protein	NA	Q716G5	Shigella_phage	98.0	2.6e-86
2219316:2219330	attR	AATGCCGTTACTTTG	NA	NA	NA	NA
WP_073461875.1|2219664_2220357_+	DNA transfer protein	NA	A5VW66	Enterobacteria_phage	97.4	9.8e-114
WP_023156998.1|2220367_2221843_+	DNA transfer protein	NA	B6SCW4	Bacteriophage	59.4	6.1e-129
WP_073461876.1|2221842_2223969_+	DNA transfer protein	NA	B9UDL1	Salmonella_phage	98.2	0.0e+00
WP_065273934.1|2223969_2224293_-	hypothetical protein	NA	B9UDL2	Salmonella_phage	100.0	8.3e-15
WP_073461877.1|2224410_2224830_+	hypothetical protein	NA	B9UDL3	Salmonella_phage	97.1	5.6e-72
WP_021560234.1|2224846_2225098_-	Arc family DNA-binding protein	NA	E7C9U8	Salmonella_phage	90.4	1.5e-35
>prophage 4
NZ_CP010121	Escherichia coli strain C4 chromosome, complete genome	4990476	3058094	3110787	4990476	integrase,portal,lysis,tRNA,head,terminase,holin,tail,capsid	Enterobacteria_phage(50.94%)	66	3080516:3080530	3110685:3110699
WP_000332298.1|3058094_3058826_+	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	3.5e-53
WP_000373101.1|3059046_3059451_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_032140204.1|3059503_3059614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795380.1|3059850_3059895_+	protein YmgK	NA	NA	NA	NA	NA
WP_001309448.1|3060153_3060477_+	anti-adapter protein IraM	NA	Q20GJ2	Phage_258-320	63.6	1.3e-39
WP_000539892.1|3060579_3060732_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	1.6e-21
WP_073461897.1|3061243_3065698_-	hypothetical protein	NA	A0A2H4PQV1	Staphylococcus_phage	32.5	7.4e-45
WP_073462044.1|3066229_3066517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073461898.1|3066559_3067600_-|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	79.6	4.4e-150
WP_073461899.1|3067609_3067891_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	46.7	1.7e-16
WP_077897313.1|3067890_3070266_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1X7QGG5	Escherichia_phage	69.3	1.4e-167
WP_001523192.1|3070330_3070930_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.0	4.4e-102
WP_073461901.1|3070997_3074477_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.2	0.0e+00
WP_021514630.1|3074537_3075185_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.4	4.0e-109
WP_073461902.1|3075082_3075826_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	1.0e-148
WP_001152511.1|3075831_3076530_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	1.2e-130
WP_073461903.1|3076529_3076859_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	92.7	4.4e-56
WP_073461904.1|3076855_3079417_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	94.7	0.0e+00
WP_000459473.1|3079409_3079844_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	88.3	3.8e-55
WP_000479205.1|3079825_3080248_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	94.3	1.4e-67
WP_073462045.1|3080263_3081004_-|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	97.2	1.2e-128
3080516:3080530	attL	GCCGGTTGCCGCCGT	NA	NA	NA	NA
WP_000683142.1|3081011_3081407_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	2.9e-70
WP_073461905.1|3081403_3081982_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.4	2.5e-78
WP_000752965.1|3081993_3082347_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.2e-61
WP_001586767.1|3082358_3082754_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	91.7	1.2e-55
WP_000063252.1|3082795_3083821_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.1	3.9e-191
WP_073461906.1|3083876_3084209_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	1.4e-54
WP_073461907.1|3084218_3085538_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.6	1.4e-233
WP_073461908.1|3085518_3087120_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.4	7.7e-311
WP_000198149.1|3087116_3087323_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_073461909.1|3087319_3089245_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000453558.1|3089219_3089765_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_073461912.1|3090780_3091242_-|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	67.8	1.1e-47
WP_073461913.1|3091238_3091715_-	glycoside hydrolase family protein	NA	A5VW81	Enterobacteria_phage	94.3	3.6e-83
WP_000544528.1|3091701_3092007_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_073461914.1|3092328_3093018_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	47.6	3.2e-56
WP_073461915.1|3093014_3093155_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	68.9	2.5e-08
WP_073461916.1|3093151_3093514_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	93.2	8.9e-58
WP_021524013.1|3093510_3093801_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	8.7e-48
WP_000224907.1|3093793_3093964_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_073461917.1|3093963_3094419_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	68.9	7.5e-62
WP_072157016.1|3094415_3094517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073461918.1|3094618_3095137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073461919.1|3095495_3095921_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_073461920.1|3096296_3096542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073461921.1|3096538_3096829_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	5.9e-44
WP_073461922.1|3096825_3097527_-	Replication protein P	NA	M1FJ72	Enterobacteria_phage	97.9	5.4e-128
WP_077897314.1|3097523_3098543_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.1	3.3e-110
WP_073461923.1|3098539_3099079_-	toxin YdaT domain-containing protein	NA	M9NZI6	Enterobacteria_phage	65.6	9.8e-61
WP_000184665.1|3099109_3099337_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_000712399.1|3099447_3100140_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	2.5e-109
WP_061092792.1|3100220_3100490_+	hypothetical protein	NA	A0A2H4FNC7	Salmonella_phage	75.3	4.8e-32
WP_073461924.1|3100621_3100939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000233576.1|3101525_3101732_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995439.1|3101807_3102104_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|3102109_3102895_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_073461925.1|3102891_3103572_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000149533.1|3103568_3103727_+	DUF1317 family protein	NA	M1FJ61	Enterobacteria_phage	88.5	6.4e-21
WP_029797208.1|3104941_3105160_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	94.4	7.0e-34
WP_000488406.1|3105207_3105447_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	94.9	3.9e-38
WP_000088653.1|3105586_3105823_+	excisionase	NA	NA	NA	NA	NA
WP_000741335.1|3105812_3106955_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000444487.1|3107080_3108331_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248702.1|3108502_3109156_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|3109165_3109627_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001295972.1|3109680_3110787_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
3110685:3110699	attR	GCCGGTTGCCGCCGT	NA	NA	NA	NA
>prophage 5
NZ_CP010121	Escherichia coli strain C4 chromosome, complete genome	4990476	3340560	3431824	4990476	protease,integrase,portal,lysis,tRNA,head,terminase,plate,tail,capsid	Salmonella_phage(60.71%)	93	3333521:3333536	3434395:3434410
3333521:3333536	attL	GTTACCGCCATCGCCA	NA	NA	NA	NA
WP_000886683.1|3340560_3341853_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067755.1|3341943_3343287_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001305929.1|3343297_3343909_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077077.1|3344067_3348174_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|3348308_3348803_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537432.1|3349348_3350314_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
WP_001043583.1|3350436_3352203_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001202195.1|3352203_3353925_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	3.8e-21
WP_001241678.1|3353966_3354671_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3354955_3355174_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|3356037_3358314_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|3358344_3358665_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|3358987_3359212_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_073461943.1|3359284_3361231_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000746460.1|3361227_3362343_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_131727183.1|3362493_3363450_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000599797.1|3363446_3365105_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_073461944.1|3365530_3366226_+	aquaporin Z	NA	NA	NA	NA	NA
WP_000491136.1|3366698_3367598_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000458817.1|3367741_3369394_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_021564119.1|3369405_3370374_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815339.1|3370506_3372225_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.4	3.1e-31
WP_000566378.1|3372261_3373263_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_001136542.1|3373273_3374704_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001305933.1|3374802_3375816_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001255163.1|3375812_3376643_-	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	3.3e-07
WP_001160737.1|3376639_3376963_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000456099.1|3377173_3378973_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_001270657.1|3379587_3380103_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|3380320_3381049_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_000756575.1|3381066_3381798_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001687.1|3381804_3382521_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000464491.1|3382520_3383189_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001295905.1|3383414_3384146_+	ABC transporter substrate-binding protein ArtJ	NA	NA	NA	NA	NA
WP_001149752.1|3384174_3385302_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	28.0	7.9e-28
WP_000389260.1|3385342_3385831_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061664.1|3385890_3386736_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000105436.1|3386732_3387686_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996007.1|3387695_3388829_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000126075.1|3388923_3390036_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|3390386_3390863_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|3390950_3391853_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000189134.1|3391913_3392636_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201580.1|3392619_3392907_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195231.1|3393066_3393324_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
WP_000681108.1|3393353_3393731_-	inner membrane protein YbjM	NA	NA	NA	NA	NA
WP_001024883.1|3394000_3395686_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000972391.1|3395921_3396140_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_021513027.1|3396230_3397331_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.7	4.9e-176
WP_001581520.1|3397327_3397813_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	4.8e-67
WP_021513026.1|3397809_3400887_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	62.1	0.0e+00
WP_000763311.1|3400879_3400999_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_021513025.1|3401013_3401316_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	88.0	2.0e-39
WP_021513024.1|3401370_3401886_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	94.7	6.2e-89
WP_001522722.1|3401895_3403068_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.5	1.6e-204
WP_021513022.1|3403752_3404625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021513021.1|3404648_3404927_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	82.7	1.0e-29
WP_021513020.1|3404898_3405492_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	64.8	5.4e-60
WP_021513019.1|3405491_3406997_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	66.6	6.8e-176
WP_021513018.1|3406993_3407599_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	91.0	2.2e-109
WP_021513017.1|3407591_3408500_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	1.3e-142
WP_021513016.1|3408486_3408846_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	84.9	2.3e-50
WP_021513015.1|3408842_3409421_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	85.9	2.3e-92
WP_050483768.1|3409503_3410400_+	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	47.0	1.4e-72
WP_021513013.1|3410396_3410840_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.9	4.3e-62
WP_001039945.1|3410832_3411264_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	94.4	4.4e-72
WP_021513012.1|3411359_3411788_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	91.5	1.1e-59
WP_001069911.1|3411784_3412300_-	lysozyme	NA	E5G6N1	Salmonella_phage	93.6	1.9e-90
WP_000171569.1|3412280_3412496_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	78.9	3.1e-26
WP_000868175.1|3412499_3412703_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000673523.1|3412702_3413167_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
WP_000059198.1|3413262_3413913_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.8	2.5e-111
WP_000742511.1|3413916_3414975_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
WP_021513011.1|3414991_3415825_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	87.4	7.4e-124
WP_001098431.1|3415967_3417734_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
WP_032204462.1|3417733_3418759_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	86.2	8.4e-170
WP_021513009.1|3418794_3419925_-	DUF4935 domain-containing protein	NA	NA	NA	NA	NA
WP_021513008.1|3419941_3420442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000834899.1|3420879_3421305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|3421464_3421698_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|3421708_3421897_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_021513007.1|3422049_3424464_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.1	0.0e+00
WP_021513006.1|3424460_3425318_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.5	3.9e-160
WP_000752613.1|3425314_3425542_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_021513005.1|3425541_3425775_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.4e-32
WP_021513004.1|3425842_3426184_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	97.3	6.6e-55
WP_000934004.1|3426266_3426515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021513003.1|3426600_3426897_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.4	6.4e-22
WP_021513002.1|3426904_3427414_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.7e-86
WP_000188448.1|3427446_3427668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071779736.1|3427756_3428692_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.5	1.2e-34
WP_021513000.1|3428711_3430694_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001595551.1|3430771_3431824_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	55.8	4.8e-104
3434395:3434410	attR	TGGCGATGGCGGTAAC	NA	NA	NA	NA
>prophage 6
NZ_CP010121	Escherichia coli strain C4 chromosome, complete genome	4990476	3513017	3552647	4990476	protease,integrase,portal,lysis,head,terminase,plate,tail,capsid	Shigella_phage(58.49%)	57	3512660:3512674	3552721:3552735
3512660:3512674	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_000931964.1|3513017_3513380_+	GtrA family protein	NA	U5P0S6	Shigella_phage	86.7	3.9e-53
WP_000703623.1|3513376_3514291_+	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	88.5	8.1e-156
WP_000174193.1|3514292_3515759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000998154.1|3516042_3516447_-|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	62.5	3.8e-17
WP_000554675.1|3516447_3517380_-	hypothetical protein	NA	U5P0I1	Shigella_phage	96.2	5.5e-51
WP_016243480.1|3517383_3517968_-	YmfQ family protein	NA	O22003	Shigella_phage	99.0	7.0e-113
WP_000785306.1|3517958_3519017_-|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	99.4	9.5e-201
WP_000424732.1|3519003_3519429_-	phage GP46 family protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_001259091.1|3519428_3519977_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	98.9	5.1e-97
WP_023149017.1|3519976_3521056_-	bacteriophage Mu P protein	NA	U5P0H6	Shigella_phage	99.2	1.0e-205
WP_024258724.1|3521052_3522381_-	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	97.7	1.9e-243
WP_000866660.1|3522434_3523112_-	hypothetical protein	NA	A0A0R6PJY5	Moraxella_phage	46.1	5.0e-46
WP_000807206.1|3523193_3525035_-|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	99.0	4.2e-305
WP_000661056.1|3525176_3525446_-|tail	phage tail assembly protein	tail	S5FNR3	Shigella_phage	98.9	3.9e-42
WP_000090998.1|3525445_3525802_-|tail	phage tail tube protein	tail	U5P076	Shigella_phage	100.0	5.3e-63
WP_073461847.1|3525801_3527298_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1FN90	Enterobacteria_phage	98.6	1.1e-271
WP_000497751.1|3527281_3527452_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000779294.1|3527460_3528021_-	hypothetical protein	NA	Q8SBH4	Shigella_phage	99.5	1.8e-105
WP_000224835.1|3528017_3528524_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	92.9	1.3e-83
WP_000702391.1|3528498_3528909_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	93.4	9.7e-69
WP_000927711.1|3528905_3529229_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000601360.1|3529231_3529432_-	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
WP_000257509.1|3529481_3530687_-|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.8	5.3e-224
WP_001193631.1|3530701_3531352_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_000466265.1|3531329_3532571_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	1.5e-242
WP_000605606.1|3532570_3532753_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_096954127.1|3532764_3534261_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	100.0	8.8e-301
WP_000929173.1|3534494_3534989_-|terminase	phage terminase small subunit P27 family	terminase	Q8SBI1	Shigella_phage	100.0	1.3e-88
WP_001135206.1|3535114_3535465_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	100.0	5.0e-66
WP_000699783.1|3535530_3535734_-	hypothetical protein	NA	A0A1W6JPG4	Morganella_phage	52.9	4.9e-13
WP_001544773.1|3535851_3536226_-	hypothetical protein	NA	M1FPD9	Enterobacteria_phage	100.0	3.9e-64
WP_001544774.1|3536264_3536708_-|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	99.3	2.6e-75
WP_001135290.1|3536704_3537202_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	99.4	9.9e-92
WP_000839582.1|3537201_3537417_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
WP_023148940.1|3537605_3538337_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000592546.1|3538688_3539648_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_001544776.1|3539840_3540365_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	53.5	7.1e-48
WP_001204777.1|3540520_3540898_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.2	7.3e-55
WP_024258735.1|3540915_3541905_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	98.5	3.1e-193
WP_023149087.1|3541912_3542755_-	KilA-N domain-containing protein	NA	S5MC03	Escherichia_phage	91.1	7.0e-138
WP_000767113.1|3542774_3543164_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_023149086.1|3543160_3543487_-	LexA DNA-binding domain protein	NA	A0A0N7KZF7	Stx2-converting_phage	95.4	1.2e-50
WP_023149085.1|3543486_3543981_-	PerC family transcriptional regulator	NA	Q8SBF0	Shigella_phage	99.4	2.5e-87
WP_024258733.1|3543977_3544919_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.4	1.2e-143
WP_001250269.1|3544908_3545088_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_024258732.1|3545263_3545815_-	protein YmfL	NA	S5FXP0	Shigella_phage	98.4	7.6e-101
WP_000649477.1|3545858_3546059_-	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848748.1|3546149_3546824_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000549623.1|3547058_3547265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016392.1|3547236_3547671_-	hypothetical protein	NA	U5P096	Shigella_phage	99.3	7.1e-78
WP_000135665.1|3548139_3548502_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	2.5e-60
WP_021564087.1|3548567_3549392_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.3	2.3e-149
WP_001371719.1|3549519_3550056_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.3	2.0e-98
WP_000335007.1|3550046_3550925_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	93.1	6.3e-166
WP_000206057.1|3550921_3551266_+	hypothetical protein	NA	U5P0J0	Shigella_phage	79.5	2.0e-30
WP_001303849.1|3551380_3551599_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533656.1|3551576_3552647_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	99.7	1.5e-201
3552721:3552735	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 7
NZ_CP010121	Escherichia coli strain C4 chromosome, complete genome	4990476	4106348	4194387	4990476	transposase,plate	Escherichia_phage(23.08%)	60	NA	NA
WP_073461977.1|4106348_4107545_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_047651740.1|4107615_4107852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073461978.1|4108489_4108825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077897319.1|4108825_4109857_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_071531845.1|4110277_4110463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073461979.1|4112404_4112764_-	DUF596 domain-containing protein	NA	NA	NA	NA	NA
WP_073461980.1|4112760_4113300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000171783.1|4113598_4113973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001420115.1|4122989_4123517_-	toxin-activating lysine-acyltransferase	NA	NA	NA	NA	NA
WP_065225089.1|4123526_4125179_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	28.0	2.9e-39
WP_001287885.1|4125858_4126050_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000124171.1|4126102_4126336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000896657.1|4126682_4127168_+	CaiF/GrlA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001406120.1|4127474_4127993_-	OmpH family outer membrane protein	NA	A0A2L1IV11	Escherichia_phage	98.3	6.1e-84
WP_073461981.1|4128052_4135978_-	phase-variable autotransporter adhesin UpaE	NA	A0A2L1IV38	Escherichia_phage	96.1	0.0e+00
WP_073461982.1|4136008_4136641_-	helix-turn-helix transcriptional regulator	NA	A0A2L1IV08	Escherichia_phage	54.3	2.0e-60
WP_000226576.1|4141872_4142085_-	DUF1187 family protein	NA	NA	NA	NA	NA
WP_149025256.1|4144304_4145460_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	1.0e-67
WP_000273844.1|4147088_4149509_+	NTPase	NA	NA	NA	NA	NA
WP_073461986.1|4149810_4150374_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_073462055.1|4151346_4152780_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000120392.1|4153028_4153256_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000266639.1|4153361_4153589_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_073461987.1|4154279_4155917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001384291.1|4156003_4156600_-	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	87.9	5.0e-98
WP_000893271.1|4157100_4158354_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	4.4e-96
WP_001285288.1|4158365_4159469_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_073461988.1|4159756_4160812_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	1.0e-117
WP_000174684.1|4160850_4161252_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189541.1|4161309_4162554_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|4162645_4163104_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293009.1|4163364_4164822_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_023063669.1|4164878_4165019_-	peptide chain release factor	NA	NA	NA	NA	NA
WP_001059899.1|4165678_4166131_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263485.1|4166140_4166539_-	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_000554758.1|4166541_4166835_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226177.1|4166886_4167942_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000207554.1|4168012_4168798_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001314494.1|4168742_4170482_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_000006263.1|4170920_4171418_-|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_000093873.1|4171594_4172344_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_001225679.1|4172644_4173385_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333380.1|4173355_4174123_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001314493.1|4174227_4174806_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	31.4	4.3e-14
WP_073461989.1|4175045_4177490_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_073461990.1|4177532_4178006_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118020.1|4178159_4178930_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_001306803.1|4179201_4179690_-	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_073461991.1|4179780_4180284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033868195.1|4180403_4181540_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001306804.1|4181986_4183237_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.1	3.6e-29
WP_000400154.1|4183768_4184725_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000536467.1|4185037_4186000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001306805.1|4186114_4187686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000446997.1|4187707_4188547_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_001306807.1|4188546_4190505_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.7	1.9e-24
WP_001142963.1|4190725_4191244_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000041478.1|4191946_4192450_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000111580.1|4192472_4193957_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_001189669.1|4193961_4194387_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 8
NZ_CP010121	Escherichia coli strain C4 chromosome, complete genome	4990476	4453258	4533152	4990476	protease,integrase,portal,lysis,tRNA,terminase,holin,tail	Enterobacteria_phage(37.5%)	90	4483299:4483314	4536368:4536383
WP_001223148.1|4453258_4453945_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001303782.1|4454344_4454485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001194358.1|4454580_4455297_+	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_000920350.1|4455356_4456709_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_001219591.1|4456766_4458191_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.9	1.2e-09
WP_001188679.1|4458190_4458880_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
WP_000875487.1|4458892_4459366_-	protein CreA	NA	NA	NA	NA	NA
WP_000371669.1|4459576_4460446_+	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_000942344.1|4460442_4461090_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_001389639.1|4461141_4461657_+	inosine/xanthosine triphosphatase	NA	NA	NA	NA	NA
WP_000068678.1|4461650_4461977_-	trp operon repressor	NA	NA	NA	NA	NA
WP_000409419.1|4462066_4464004_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000046743.1|4464214_4465882_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.2	8.3e-42
WP_000566334.1|4466036_4466924_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000023622.1|4467057_4468068_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_000762714.1|4468087_4468885_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001140839.1|4468910_4469327_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_000848792.1|4469484_4469697_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_071986483.1|4469745_4469937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000093823.1|4470163_4471396_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.3	2.3e-81
WP_001029698.1|4471416_4472799_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_001132956.1|4472847_4473816_-	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_000124615.1|4473921_4474566_+	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_000105893.1|4474593_4475610_+	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_000566142.1|4475641_4475905_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000224879.1|4476065_4476785_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000816471.1|4476841_4478065_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_000477811.1|4478116_4479439_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
WP_001298497.1|4479516_4480296_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_001143216.1|4480553_4482104_+	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_001088441.1|4482075_4482939_+	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
4483299:4483314	attL	GCGTCGCATCTGGCAT	NA	NA	NA	NA
WP_000563029.1|4483457_4484237_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000531527.1|4484233_4485307_-	patatin family protein	NA	NA	NA	NA	NA
WP_000490275.1|4485428_4485590_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001295748.1|4485716_4486322_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000202563.1|4486714_4488301_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
WP_073461997.1|4488707_4489346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073461998.1|4489342_4491331_-	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_073462000.1|4492011_4492305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073462001.1|4492318_4493020_-	chaperone of endosialidase	NA	A0A1X7QGH6	Escherichia_phage	62.3	7.0e-59
WP_073462002.1|4493029_4493311_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	4.1e-18
WP_073462003.1|4493310_4495683_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1X7QGG5	Escherichia_phage	70.0	3.3e-169
WP_073462004.1|4495741_4499137_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	89.4	0.0e+00
WP_000741576.1|4499197_4499845_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	98.6	2.7e-113
WP_032152077.1|4499742_4500486_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	99.2	4.4e-152
WP_001152385.1|4500490_4501189_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	100.0	6.0e-135
WP_000447253.1|4501198_4501528_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_073462005.1|4501527_4504593_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.0	0.0e+00
WP_073462006.1|4504564_4504894_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	99.1	2.2e-55
WP_001300035.1|4504902_4505289_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211129.1|4505349_4506093_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	99.6	1.0e-132
WP_001079419.1|4506103_4506505_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	99.2	1.9e-72
WP_000677106.1|4506501_4507080_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	100.0	4.2e-102
WP_001283153.1|4507091_4507367_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|4507359_4507683_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_021538845.1|4507769_4509797_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	99.7	0.0e+00
WP_077249742.1|4509741_4511322_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.6	6.2e-289
WP_001072975.1|4511249_4511462_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_001401096.1|4511458_4513561_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	97.4	0.0e+00
WP_000373425.1|4513560_4514055_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_073462008.1|4514629_4515067_-|lysis	lysis protein	lysis	Q9MCN3	Enterobacteria_phage	97.2	1.2e-69
WP_001197752.1|4515063_4515540_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	8.6e-85
WP_001120501.1|4515543_4515879_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	99.1	2.0e-59
WP_073462009.1|4515955_4517008_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	98.3	1.3e-205
WP_000917724.1|4517158_4517362_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_000217632.1|4517585_4518011_-	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	100.0	3.6e-74
WP_001047112.1|4518291_4519044_-	antitermination protein	NA	Q8SBE4	Shigella_phage	98.8	6.9e-137
WP_001360050.1|4519057_4520047_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_001061438.1|4520054_4520864_-	KilA-N domain-containing protein	NA	A5LH75	Enterobacteria_phage	100.0	8.2e-152
WP_000767117.1|4520883_4521273_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PH72	Enterobacteria_phage	100.0	7.1e-69
WP_000210154.1|4521269_4521596_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	2.7e-53
WP_073462010.1|4521592_4522246_-	phage N-6-adenine-methyltransferase	NA	A0A0P0ZCC0	Stx2-converting_phage	99.1	2.1e-126
WP_073462011.1|4522245_4522740_-	PerC family transcriptional regulator	NA	K7PJR0	Enterobacteria_phage	97.5	1.1e-85
WP_000061529.1|4522736_4523555_-	helix-turn-helix domain-containing protein	NA	Q8SBF1	Shigella_phage	100.0	1.8e-122
WP_073462012.1|4523551_4523788_-	hypothetical protein	NA	A0A291AX25	Escherichia_phage	97.4	4.6e-39
WP_073462013.1|4523780_4524617_-	ash family protein	NA	A0A291AWU3	Escherichia_phage	99.3	8.4e-152
WP_000515860.1|4524613_4525165_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	100.0	7.6e-101
WP_059259759.1|4525208_4525409_-	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	98.5	3.9e-31
WP_000859463.1|4525499_4526174_+	LexA family transcriptional repressor	NA	A5LH66	Enterobacteria_phage	100.0	9.2e-133
WP_073462015.1|4526408_4526615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149025258.1|4526586_4527021_-	hypothetical protein	NA	U5P096	Shigella_phage	72.2	1.9e-54
WP_000135680.1|4527490_4527853_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_073462016.1|4527918_4528743_+	DUF2303 family protein	NA	U5P439	Shigella_phage	98.9	6.6e-149
WP_000008178.1|4528871_4529408_+	5'-deoxynucleotidase	NA	A0A0P0ZCH9	Stx2-converting_phage	99.4	2.2e-100
WP_073462017.1|4529398_4529779_+	hypothetical protein	NA	K7PH61	Enterobacteria_phage	98.3	1.0e-64
WP_096964154.1|4529759_4530380_+	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	89.3	9.1e-111
WP_001061365.1|4530379_4530574_+	DNA-binding protein	NA	A5LH59	Enterobacteria_phage	96.9	1.7e-31
WP_021536714.1|4530896_4531085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073462018.1|4531189_4531741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021536712.1|4531928_4533152_-|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	99.3	3.3e-237
4536368:4536383	attR	GCGTCGCATCTGGCAT	NA	NA	NA	NA
