The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	0	20543	5021692	transposase	Enterobacteria_phage(100.0%)	23	NA	NA
WP_000833174.1|863_1253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000273203.1|1317_2376_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_001442995.1|2416_3139_+	beta-ketoacyl synthase chain length factor	NA	NA	NA	NA	NA
WP_001499180.1|3135_3957_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_001148680.1|3931_4189_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_000132059.1|4200_4452_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_001442994.1|4456_5038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001077064.1|5034_6393_+	acyl-CoA synthetase	NA	NA	NA	NA	NA
WP_001323876.1|6379_6733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000115632.1|6723_8400_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_000930894.1|8403_8826_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_000670567.1|8822_9428_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
WP_040074901.1|9396_11715_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_000597702.1|11711_12296_+	DUF3261 domain-containing protein	NA	NA	NA	NA	NA
WP_001323879.1|12297_13467_+	beta-ketoacyl-[acyl-carrier-protein] synthase family protein	NA	NA	NA	NA	NA
WP_000020240.1|13463_13928_+	3-hydroxy-fatty acyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_000091665.1|13927_14659_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_000198472.1|14655_15885_+	beta-ketoacyl-ACP synthase	NA	NA	NA	NA	NA
WP_000416157.1|16724_17756_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.0	8.0e-19
WP_000916811.1|18026_18470_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000705928.1|18485_18773_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000345347.1|18785_20042_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001327567.1|20288_20543_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	62.2	8.0e-21
>prophage 2
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	41501	43636	5021692		Yersinia_phage(33.33%)	4	NA	NA
WP_001234620.1|41501_42320_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	2.0e-44
WP_000849582.1|42374_42860_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	2.6e-12
WP_001186726.1|42875_43352_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692323.1|43414_43636_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
>prophage 3
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	77000	78164	5021692		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_040090102.1|77000_78164_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	30.5	7.9e-39
>prophage 4
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	100377	101262	5021692		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018760.1|100377_101262_+	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 5
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	107104	117927	5021692		Staphylococcus_phage(25.0%)	9	NA	NA
WP_000013152.1|107104_107932_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	1.6e-62
WP_000691598.1|108131_109058_+	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000848528.1|109108_109366_+	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000095187.1|109408_111628_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000059395.1|111738_113151_-	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000965703.1|113225_113963_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_001281881.1|114195_116454_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.4e-84
WP_000183494.1|116999_117482_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000712658.1|117534_117927_-	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 6
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	121754	132716	5021692		Bacillus_virus(20.0%)	12	NA	NA
WP_000195296.1|121754_123647_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
WP_000105733.1|123675_124257_-	esterase YqiA	NA	NA	NA	NA	NA
WP_000444747.1|124256_125084_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000833393.1|125108_125531_-	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000917117.1|125531_126161_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000735278.1|126365_127847_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000831543.1|127994_128666_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000442860.1|128671_129832_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_001299419.1|129869_130658_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_001295627.1|130800_131574_+	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_000469266.1|131631_131802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001076997.1|132062_132716_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
>prophage 7
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	142231	143665	5021692		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869178.1|142231_143665_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 8
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	148802	150041	5021692	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708501.1|148802_150041_+|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.6	5.9e-93
>prophage 9
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	156425	172609	5021692	tRNA	Moraxella_phage(16.67%)	12	NA	NA
WP_001264365.1|156425_157439_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	4.8e-109
WP_001144069.1|157675_157891_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918827.1|158001_159747_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_000437371.1|159941_161783_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000228940.1|161861_162368_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_040090114.1|162621_163386_-	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000018005.1|163662_164286_+	DNA-binding transcriptional regulator NfeR	NA	NA	NA	NA	NA
WP_000094682.1|164439_165960_-	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	52.2	1.4e-35
WP_040090123.1|166377_167757_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	2.0e-33
WP_000450588.1|167798_168131_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_040090115.1|168349_169333_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_040090117.1|169516_172609_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.1	5.9e-158
>prophage 10
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	185030	185996	5021692		Escherichia_phage(100.0%)	1	NA	NA
WP_001098806.1|185030_185996_+	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 11
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	212012	214307	5021692		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861734.1|212012_214307_-	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	7.4e-158
>prophage 12
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	222626	223772	5021692		Streptococcus_phage(100.0%)	1	NA	NA
WP_001299416.1|222626_223772_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	1.7e-49
>prophage 13
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	246761	254646	5021692		Streptococcus_phage(25.0%)	10	NA	NA
WP_000809262.1|246761_247622_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.5e-50
WP_000249103.1|247686_249723_+	penicillin-binding protein activator LpoA	NA	NA	NA	NA	NA
WP_000246830.1|249680_250076_+	YraN family protein	NA	NA	NA	NA	NA
WP_001158034.1|250095_250686_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000646033.1|250695_251271_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_032222356.1|251475_252516_-	permease	NA	NA	NA	NA	NA
WP_000084526.1|252588_253224_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_040090455.1|253351_253870_+	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_000449041.1|253849_254293_-	YhbP family protein	NA	NA	NA	NA	NA
WP_000189326.1|254343_254646_+	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	53.2	1.5e-13
>prophage 14
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	260348	262238	5021692		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|260348_262238_-	ATP-dependent RNA helicase DeaD	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 15
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	267719	274358	5021692		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_000133044.1|267719_270392_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
WP_001031057.1|270416_271904_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_001300397.1|271931_272384_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_040090452.1|273014_274358_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
>prophage 16
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	277560	280433	5021692	protease	Pandoravirus(50.0%)	2	NA	NA
WP_000764731.1|277560_278409_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
WP_001107467.1|278498_280433_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
>prophage 17
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	287207	288684	5021692		Indivirus(50.0%)	2	NA	NA
WP_001047336.1|287207_288179_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
WP_000445413.1|288405_288684_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
>prophage 18
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	292752	307547	5021692		Staphylococcus_phage(25.0%)	17	NA	NA
WP_000438245.1|292752_293562_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
WP_073487868.1|293771_294749_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_001295557.1|294762_295749_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000030016.1|295769_296336_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_000030537.1|296332_296908_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000669785.1|296876_297434_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000224099.1|297440_298166_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000809057.1|298213_299647_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_001176599.1|299669_299957_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000183676.1|300074_300566_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_000243741.1|300611_301466_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000216791.1|301462_301735_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000620405.1|301948_302581_+	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_024237847.1|302577_303306_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_001299134.1|303302_303956_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000809774.1|304185_306522_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001299745.1|306617_307547_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
>prophage 19
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	314296	319029	5021692		Salmonella_phage(50.0%)	5	NA	NA
WP_001543182.1|314296_315409_+	DUF1016 family protein	NA	A0A0U2BZN7	Salmonella_phage	88.5	4.7e-73
WP_000979882.1|315468_315933_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000209004.1|315929_316805_-	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000054239.1|316801_317491_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000108473.1|317538_319029_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.9	4.9e-09
>prophage 20
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	322733	323231	5021692	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366129.1|322733_323231_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
>prophage 21
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	327197	329722	5021692	protease	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001295271.1|327197_328565_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
WP_000497723.1|328654_329722_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
>prophage 22
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	346218	347262	5021692		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|346218_347262_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 23
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	357827	358712	5021692		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258896.1|357827_358712_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	1.9e-24
>prophage 24
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	365216	369370	5021692		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000738579.1|365216_366242_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	2.4e-71
WP_040090442.1|366309_367491_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_040090440.1|367500_368604_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000078338.1|368611_369370_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.2e-19
>prophage 25
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	379866	381338	5021692	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_000114984.1|379866_380376_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
WP_000004454.1|380390_381338_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
>prophage 26
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	401215	406789	5021692		Tupanvirus(33.33%)	7	NA	NA
WP_000031783.1|401215_402400_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000124700.1|402470_404585_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_001138043.1|404681_405152_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000246815.1|405248_405623_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000903377.1|405748_406036_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000820720.1|406043_406403_-	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_001209710.1|406402_406789_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	38.3	5.6e-18
>prophage 27
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	412359	421900	5021692		Tupanvirus(25.0%)	9	NA	NA
WP_000634798.1|412359_414273_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	4.3e-74
WP_000057405.1|414272_415295_+	hydrolase	NA	NA	NA	NA	NA
WP_000907085.1|415288_415507_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_001274680.1|415560_416430_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_001148904.1|416484_416889_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000242755.1|417190_417823_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001295162.1|417873_419964_+	FUSC family protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_000963797.1|420030_421251_-	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_000601847.1|421336_421900_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	55.8	1.2e-61
>prophage 28
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	446128	446965	5021692		Vibrio_phage(100.0%)	1	NA	NA
WP_000742143.1|446128_446965_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	4.9e-67
>prophage 29
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	463943	467710	5021692		Bacillus_phage(66.67%)	3	NA	NA
WP_001265681.1|463943_465566_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
WP_001253696.1|465641_466994_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_001157751.1|466990_467710_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 30
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	474273	475152	5021692		Sodalis_phage(100.0%)	1	NA	NA
WP_000039057.1|474273_475152_+	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.4	4.7e-68
>prophage 31
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	481121	483515	5021692		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081909.1|481121_483515_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 32
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	487893	489120	5021692		Ralstonia_phage(100.0%)	1	NA	NA
WP_001105503.1|487893_489120_-	RNA-splicing ligase RtcB	NA	A0A1L7N133	Ralstonia_phage	59.5	1.3e-132
>prophage 33
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	498348	500796	5021692		Dickeya_phage(100.0%)	1	NA	NA
WP_000993449.1|498348_500796_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 34
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	518189	520000	5021692		Enterococcus_phage(50.0%)	2	NA	NA
WP_000073590.1|518189_518933_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	6.4e-10
WP_000907790.1|518929_520000_-	sn-glycerol 3-phosphate ABC transporter ATP binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
>prophage 35
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	523541	525024	5021692		Planktothrix_phage(50.0%)	2	NA	NA
WP_000416895.1|523541_524255_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
WP_000082110.1|524256_525024_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
>prophage 36
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	530757	533576	5021692		Salicola_phage(50.0%)	3	NA	NA
WP_000130217.1|530757_531612_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
WP_001042003.1|531856_532915_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000617723.1|532907_533576_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
>prophage 37
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	536579	540711	5021692		Dickeya_phage(50.0%)	4	NA	NA
WP_000964718.1|536579_537206_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
WP_040089818.1|537279_539478_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.1	8.5e-119
WP_000130621.1|539579_539825_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_001100467.1|540045_540711_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	5.6e-58
>prophage 38
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	548604	554487	5021692		Bacillus_virus(50.0%)	5	NA	NA
WP_073487884.1|548604_549411_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	3.4e-17
WP_001190062.1|549416_549818_+	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_000593555.1|549937_550297_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_001314210.1|550627_551752_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000149132.1|551751_554487_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.1e-22
>prophage 39
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	567909	569952	5021692		Indivirus(100.0%)	1	NA	NA
WP_001295214.1|567909_569952_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.9	3.4e-45
>prophage 40
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	573297	575432	5021692		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_000008957.1|573297_573651_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	9.7e-25
WP_000922639.1|573704_574994_+	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	4.6e-173
WP_000065769.1|575006_575432_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.5e-51
>prophage 41
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	580313	580961	5021692		Bacillus_virus(100.0%)	1	NA	NA
WP_001296814.1|580313_580961_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 42
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	627940	629925	5021692		Bacillus_virus(50.0%)	2	NA	NA
WP_040090500.1|627940_628945_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	8.6e-18
WP_001196496.1|628941_629925_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	8.7e-15
>prophage 43
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	645675	648009	5021692		Escherichia_phage(100.0%)	1	NA	NA
WP_000013957.1|645675_648009_-	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.4	1.1e-71
>prophage 44
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	651663	651876	5021692		Morganella_phage(100.0%)	1	NA	NA
WP_000014594.1|651663_651876_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 45
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	656100	657096	5021692		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182653.1|656100_657096_+	O-acetyltransferase WecH	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.7	9.1e-12
>prophage 46
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	662414	663956	5021692		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146479.1|662414_663956_+	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	2.5e-16
>prophage 47
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	688143	689988	5021692		Tupanvirus(100.0%)	1	NA	NA
WP_040089950.1|688143_689988_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.6	6.0e-17
>prophage 48
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	712206	721713	5021692		Rhizobium_phage(16.67%)	9	NA	NA
WP_000024392.1|712206_712458_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
WP_001156181.1|712599_713031_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000116566.1|713275_714820_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001214147.1|714829_716113_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000483856.1|716116_717076_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000982091.1|717062_718097_-	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
WP_000646014.1|718335_719361_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_001213834.1|719370_720567_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
WP_000587750.1|720780_721713_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	8.5e-36
>prophage 49
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	725112	727206	5021692		Catovirus(50.0%)	2	NA	NA
WP_040089957.1|725112_726096_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	38.5	2.4e-12
WP_000364782.1|726180_727206_-	UDP-galactose--(galactosyl) LPS alpha1,2-galactosyltransferase	NA	A0ZYL4	Archaeal_BJ1_virus	25.5	1.4e-10
>prophage 50
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	734644	739207	5021692		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_001171866.1|734644_735124_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	4.8e-27
WP_001114533.1|735162_735972_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001051798.1|736069_736237_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000091955.1|736257_736494_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001298959.1|736710_737379_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_000050117.1|737550_738771_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	5.0e-44
WP_000976070.1|738748_739207_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	9.6e-49
>prophage 51
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	742580	749330	5021692		Morganella_phage(25.0%)	6	NA	NA
WP_001411731.1|742580_743405_+	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	77.0	2.8e-91
WP_000924289.1|743695_744313_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_073487898.1|744309_745992_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.3	2.5e-22
WP_001295237.1|746249_746873_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000135058.1|746927_747203_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000280488.1|747221_749330_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 52
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	753763	755155	5021692		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|753763_755155_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 53
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	761430	762612	5021692	integrase	Enterobacteria_phage(100.0%)	1	752971:752986	768171:768186
752971:752986	attL	CCAGCACCAGACCGAA	NA	NA	NA	NA
WP_001218922.1|761430_762612_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	69.2	4.4e-162
WP_001218922.1|761430_762612_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	69.2	4.4e-162
768171:768186	attR	TTCGGTCTGGTGCTGG	NA	NA	NA	NA
>prophage 54
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	769633	773447	5021692	transposase	Stx2-converting_phage(75.0%)	4	NA	NA
WP_000078828.1|769633_770680_+	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.7	6.2e-35
WP_000998071.1|771125_772664_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.6	8.4e-299
WP_000612591.1|772713_773061_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001282151.1|773057_773447_-	IS66 family insertion sequence hypothetical protein	NA	B6DZU5	Stx2-converting_phage	99.2	7.8e-68
>prophage 55
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	776670	778272	5021692	transposase	uncultured_virus(100.0%)	1	NA	NA
WP_077782308.1|776670_778272_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	35.8	4.2e-75
>prophage 56
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	789702	791469	5021692		Moraxella_phage(100.0%)	1	NA	NA
WP_073487901.1|789702_791469_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	25.5	4.6e-22
>prophage 57
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	802386	804557	5021692		Yersinia_phage(33.33%)	4	NA	NA
WP_001175163.1|802386_803205_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.1	1.9e-47
WP_000206670.1|803296_803782_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.7	1.2e-12
WP_001186192.1|803796_804273_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692300.1|804335_804557_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.1e-10
>prophage 58
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	813110	814445	5021692		Moraxella_phage(100.0%)	1	NA	NA
WP_001349999.1|813110_814445_-	adenine permease AdeQ	NA	A0A0R6PHV4	Moraxella_phage	37.2	6.6e-66
>prophage 59
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	821868	831030	5021692		Micromonas_sp._RCC1109_virus(25.0%)	10	NA	NA
WP_000168480.1|821868_823557_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	4.2e-57
WP_001315912.1|823662_823761_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000060506.1|824325_824415_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_000828746.1|824833_826018_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	8.9e-14
WP_000148063.1|826025_826523_-	radical SAM protein	NA	NA	NA	NA	NA
WP_001113432.1|826519_826882_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000703959.1|826871_827219_-	YidH family protein	NA	NA	NA	NA	NA
WP_000511287.1|827328_827778_+	membrane protein	NA	NA	NA	NA	NA
WP_000828483.1|827824_829318_-	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	25.4	1.1e-29
WP_001087147.1|829314_831030_-	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.6	5.6e-41
>prophage 60
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	837381	838335	5021692		Synechococcus_phage(50.0%)	2	NA	NA
WP_001243431.1|837381_837810_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
WP_001243437.1|837921_838335_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 61
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	842762	843911	5021692		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705001.1|842762_843911_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 62
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	848617	855986	5021692		Bacillus_virus(33.33%)	8	NA	NA
WP_073487919.1|848617_851032_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
WP_000060112.1|851060_852134_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000673464.1|852133_853234_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000059111.1|853238_854642_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_120795392.1|854938_855019_+	protein YsdD	NA	NA	NA	NA	NA
WP_000831330.1|855248_855389_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_000239730.1|855405_855765_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_001307474.1|855728_855986_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 63
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	866184	867522	5021692		Moraxella_phage(100.0%)	1	NA	NA
WP_001299598.1|866184_867522_-	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 64
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	878574	882415	5021692		Bacillus_phage(50.0%)	4	NA	NA
WP_000063125.1|878574_879348_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
WP_001251991.1|879438_880329_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000741620.1|880328_881288_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_000867146.1|881374_882415_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
>prophage 65
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	887946	891308	5021692		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_000334106.1|887946_889776_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.4	2.5e-132
WP_000933736.1|889937_891308_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
>prophage 66
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	903260	904253	5021692		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_073487922.1|903260_904253_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.3	8.4e-50
>prophage 67
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	907421	913274	5021692		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_000102319.1|907421_909290_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
WP_032218741.1|909456_909876_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000387753.1|909883_911389_+	ribose ABC transporter ATP-binding protein RbsA	NA	G3M9Y6	Bacillus_virus	27.7	3.9e-14
WP_000211858.1|911393_912359_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_001056273.1|912383_913274_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
>prophage 68
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	926750	928397	5021692		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_021557359.1|926750_928397_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	7.4e-67
>prophage 69
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	936870	942282	5021692		Bacillus_phage(33.33%)	4	NA	NA
WP_001238890.1|936870_938892_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	3.8e-113
WP_073487925.1|938938_940423_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000047499.1|940556_941822_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001350026.1|941952_942282_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	7.2e-14
>prophage 70
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	946324	952468	5021692		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000866669.1|946324_947455_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.8	3.0e-27
WP_000006610.1|947451_948714_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
WP_021574853.1|948713_949781_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	3.9e-101
WP_033553490.1|949799_950681_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.0	2.5e-106
WP_001145183.1|950658_951333_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000612044.1|951337_952468_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
>prophage 71
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	970921	974780	5021692		Bacillus_phage(100.0%)	3	NA	NA
WP_000130686.1|970921_971818_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	1.1e-24
WP_001213584.1|971817_972534_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000383406.1|972617_974780_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
>prophage 72
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	982268	984098	5021692		Catovirus(100.0%)	1	NA	NA
WP_000035581.1|982268_984098_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	7.4e-84
>prophage 73
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	996510	999797	5021692		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_000187530.1|996510_998151_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	8.2e-42
WP_001295260.1|998229_998499_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000459594.1|998502_999018_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_000109943.1|999020_999797_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
>prophage 74
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1008587	1009202	5021692		Streptococcus_phage(100.0%)	1	NA	NA
WP_001296979.1|1008587_1009202_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 75
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1022882	1025669	5021692		uncultured_virus(100.0%)	1	NA	NA
WP_000250006.1|1022882_1025669_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	1.7e-71
>prophage 76
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1029747	1032218	5021692		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_001188776.1|1029747_1031157_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
WP_000190577.1|1031168_1032218_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
>prophage 77
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1048441	1133488	5021692	tail,tRNA,capsid,transposase,holin,integrase,lysis,portal,terminase,plate,head,protease	Escherichia_phage(52.0%)	97	1085132:1085178	1117545:1117591
WP_000718896.1|1048441_1049338_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	90.7	9.6e-61
WP_000621656.1|1049505_1050402_+	sulfofructose kinase	NA	NA	NA	NA	NA
WP_000059678.1|1050435_1051221_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
WP_001295269.1|1051319_1051919_+	glucose-1-phosphatase	NA	NA	NA	NA	NA
WP_000920762.1|1051912_1052785_+	virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_000560983.1|1052781_1053219_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001297068.1|1053263_1054205_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_001299484.1|1054268_1055177_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000897305.1|1055405_1055717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000356397.1|1055717_1056008_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001295676.1|1056593_1056812_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_001086388.1|1057030_1057273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089567729.1|1057909_1059122_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_000027708.1|1059310_1060240_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_000829013.1|1060236_1060872_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000331377.1|1060868_1061771_-	formate dehydrogenase O subunit beta	NA	NA	NA	NA	NA
WP_011310337.1|1061783_1064834_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
WP_040090399.1|1065027_1065861_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_001348539.1|1066013_1067054_+	YiiG family protein	NA	NA	NA	NA	NA
WP_000931335.1|1067103_1068852_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_001019508.1|1068851_1069922_-	aminopeptidase	NA	NA	NA	NA	NA
WP_000446010.1|1069911_1071363_-	PTS fructose-like transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000729595.1|1071373_1071820_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000619503.1|1072120_1072435_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_001179764.1|1072444_1073269_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_040090401.1|1073510_1074770_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_000144052.1|1074766_1076236_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_000217137.1|1076523_1077360_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_001297062.1|1077343_1078282_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000063504.1|1078278_1079313_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_001297064.1|1079597_1080218_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
WP_001166063.1|1080477_1081461_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270260.1|1081609_1082284_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|1082389_1083763_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033722.1|1083759_1084458_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001223800.1|1084607_1085108_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
1085132:1085178	attL	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000985249.1|1085293_1086274_-|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	98.2	1.7e-183
WP_001017511.1|1086343_1086637_-	helix-turn-helix transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	97.9	3.4e-47
WP_000453532.1|1086772_1087045_+	hypothetical protein	NA	Q1JS20	Enterobacteria_phage	100.0	5.3e-47
WP_000217682.1|1087214_1087715_+	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	99.4	1.7e-91
WP_000557703.1|1087778_1088003_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277897.1|1088002_1088305_+	DUF5405 family protein	NA	A0A0F7LCL4	Escherichia_phage	98.0	8.5e-46
WP_073487932.1|1088304_1088529_+	TraR/DksA C4-type zinc finger protein	NA	A0A0F7LDG9	Escherichia_phage	97.3	3.2e-34
WP_001541416.1|1088525_1088807_+	DUF5405 family protein	NA	S4TP00	Salmonella_phage	71.4	3.6e-30
WP_000634534.1|1088803_1089811_+	phosphoadenosine phosphosulfate reductase family protein	NA	B7SYG0	Stenotrophomonas_phage	44.1	6.3e-69
WP_073487935.1|1089807_1092087_+	replication endonuclease	NA	Q858T4	Yersinia_virus	97.1	0.0e+00
WP_000598783.1|1092198_1093248_+	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	56.2	7.4e-105
WP_001279022.1|1093289_1095248_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_073487938.1|1095679_1096714_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.7	7.1e-201
WP_000156847.1|1096713_1098486_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	100.0	0.0e+00
WP_001085972.1|1098659_1099514_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MI4	Enterobacteria_phage	100.0	1.3e-139
WP_073487942.1|1099572_1100646_+|capsid	phage major capsid protein, P2 family	capsid	Q94MK2	Enterobacteria_phage	99.4	7.4e-201
WP_001593490.1|1100649_1101393_+|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	99.2	3.5e-125
WP_000988633.1|1101492_1102002_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846407.1|1102001_1102205_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	98.5	1.2e-30
WP_000123123.1|1102208_1102490_+|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|1102489_1102987_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_073487945.1|1103001_1103427_+	protein lysA	NA	A0A0F7LDU9	Escherichia_phage	91.5	1.9e-59
WP_073487947.1|1103414_1103840_+|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	97.2	5.5e-67
WP_001119512.1|1103826_1103985_+	hypothetical protein	NA	M1RZ27	Escherichia_phage	100.0	2.6e-22
WP_000917182.1|1103947_1104415_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	99.4	1.9e-81
WP_001001782.1|1104407_1104860_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	99.3	4.1e-76
WP_073487950.1|1104926_1105562_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	97.6	5.0e-112
WP_000127164.1|1105558_1105906_+	GPW/gp25 family protein	NA	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_073487953.1|1105910_1106810_+|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.3	4.1e-160
WP_073487956.1|1106811_1107423_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.0	1.2e-115
WP_073487959.1|1107419_1108727_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	69.0	2.4e-177
WP_025670940.1|1108726_1109329_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.0	6.6e-98
WP_025670941.1|1109300_1109732_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	67.6	5.8e-48
WP_073487962.1|1109733_1110150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019841968.1|1110177_1110771_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	97.0	7.9e-104
WP_073487965.1|1110830_1112021_+|tail	phage tail sheath protein	tail	Q858V1	Yersinia_virus	97.0	2.9e-222
WP_001251408.1|1112033_1112552_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031312.1|1112608_1112884_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_000785970.1|1112916_1113036_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_073487968.1|1113028_1115476_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	99.3	0.0e+00
WP_000978916.1|1115490_1115970_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.7	2.5e-84
WP_073487971.1|1115969_1117133_+	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	97.7	5.4e-205
WP_000468308.1|1117214_1117433_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001076742.1|1117669_1118572_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
1117545:1117591	attR	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000591795.1|1118752_1119715_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_040090269.1|1120033_1121023_+	sulfate/thiosulfate ABC transporter substrate-binding protein Sbp	NA	NA	NA	NA	NA
WP_000708994.1|1121129_1121885_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001216325.1|1121939_1122707_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802226.1|1122814_1123414_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155254.1|1123514_1123955_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000655986.1|1124166_1124466_+	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000323556.1|1124492_1124921_+	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000796320.1|1124925_1125672_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250644.1|1125768_1126779_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000136788.1|1126914_1128423_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084268.1|1128445_1129291_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|1129715_1129961_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|1130045_1130531_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139496.1|1130623_1131550_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293343.1|1131616_1132948_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000208242.1|1132957_1133488_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 78
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1150247	1157494	5021692		Synechococcus_phage(33.33%)	5	NA	NA
WP_000424845.1|1150247_1150910_-	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
WP_001174083.1|1150921_1153423_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_001004446.1|1153731_1154811_+	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000161265.1|1154825_1155146_+	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_073487977.1|1155196_1157494_+	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
>prophage 79
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1169612	1170827	5021692		Oenococcus_phage(100.0%)	1	NA	NA
WP_000690934.1|1169612_1170827_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	28.6	5.9e-45
>prophage 80
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1177577	1179422	5021692		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000591355.1|1177577_1179422_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	7.1e-10
>prophage 81
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1188014	1191067	5021692		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000023081.1|1188014_1188965_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
WP_000031784.1|1189882_1191067_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 82
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1195183	1203512	5021692		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000263098.1|1195183_1199212_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
WP_000653944.1|1199288_1203512_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
>prophage 83
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1211808	1213572	5021692		Klosneuvirus(50.0%)	3	NA	NA
WP_000362392.1|1211808_1212480_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
WP_000940106.1|1212522_1213113_+	YjaG family protein	NA	NA	NA	NA	NA
WP_001044513.1|1213299_1213572_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
>prophage 84
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1218940	1220530	5021692		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187485.1|1218940_1220530_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.4	8.4e-68
>prophage 85
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1235989	1239673	5021692		Dickeya_phage(100.0%)	1	NA	NA
WP_000096053.1|1235989_1239673_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 86
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1245322	1246114	5021692		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001130548.1|1245322_1246114_+	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	45.5	2.4e-47
>prophage 87
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1262133	1263249	5021692		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|1262133_1263249_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 88
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1272464	1273073	5021692		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|1272464_1273073_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 89
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1279663	1283792	5021692		Escherichia_phage(25.0%)	4	NA	NA
WP_000918363.1|1279663_1281079_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
WP_001147336.1|1281131_1282211_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
WP_000122239.1|1282233_1282791_+	nicotinamide mononucleotide transporter	NA	I6W764	Vibriophage	28.3	2.9e-15
WP_024251353.1|1282787_1283792_+	AAA family ATPase	NA	A0A249Y0V2	Salmonella_phage	31.1	1.4e-28
>prophage 90
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1287828	1291442	5021692		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000357740.1|1287828_1290651_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
WP_000168305.1|1290905_1291442_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
>prophage 91
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1295259	1296609	5021692		Moraxella_phage(100.0%)	1	NA	NA
WP_000106882.1|1295259_1296609_+	guanine/hypoxanthine transporter GhxP	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 92
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1302194	1304153	5021692		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078239.1|1302194_1304153_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.9e-90
>prophage 93
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1313436	1315584	5021692		Escherichia_phage(100.0%)	1	NA	NA
WP_001300547.1|1313436_1315584_-	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	7.0e-33
>prophage 94
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1320829	1327198	5021692		Tetraselmis_virus(50.0%)	5	NA	NA
WP_040090428.1|1320829_1322815_-	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.5	5.5e-149
WP_001171692.1|1323087_1324017_-	allose kinase	NA	NA	NA	NA	NA
WP_001311314.1|1324000_1324696_-	D-allulose-6-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_000507106.1|1324706_1325687_-	D-allose ABC transporter permease	NA	NA	NA	NA	NA
WP_073487982.1|1325665_1327198_-	D-allose ABC transporter ATP-binding protein AlsA	NA	G3M9Y6	Bacillus_virus	27.0	2.2e-12
>prophage 95
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1333433	1334983	5021692		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_000611428.1|1333433_1334114_-	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	25.0	8.7e-06
WP_001039799.1|1334224_1334983_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.2	3.6e-16
>prophage 96
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1340606	1341395	5021692		Cedratvirus(100.0%)	1	NA	NA
WP_001193397.1|1340606_1341395_-	phosphonate ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.1	4.2e-12
>prophage 97
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1346235	1347738	5021692		Burkholderia_virus(100.0%)	1	NA	NA
WP_001296882.1|1346235_1347738_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.0	7.0e-56
>prophage 98
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1368934	1372146	5021692	tRNA	Catovirus(50.0%)	2	NA	NA
WP_001295074.1|1368934_1370452_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
WP_040090433.1|1370688_1372146_-	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.4	1.2e-47
>prophage 99
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1386423	1388407	5021692		Cronobacter_phage(50.0%)	2	NA	NA
WP_001026276.1|1386423_1386717_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|1386760_1388407_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
>prophage 100
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1392925	1393459	5021692		Morganella_phage(100.0%)	1	NA	NA
WP_001238378.1|1392925_1393459_-	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 101
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1398379	1399357	5021692		Tupanvirus(100.0%)	1	NA	NA
WP_000004771.1|1398379_1399357_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 102
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1406785	1407331	5021692		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_073488000.1|1406785_1407331_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	1.3e-28
>prophage 103
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1411246	1478373	5021692	transposase,tRNA,protease	Vibrio_phage(15.38%)	68	NA	NA
WP_000990321.1|1411246_1412584_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_001122507.1|1412593_1414441_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_001280345.1|1414433_1415384_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|1415469_1415778_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460360.1|1415853_1417134_+	GTPase HflX	NA	NA	NA	NA	NA
WP_001365141.1|1417219_1418479_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|1418481_1419486_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|1419567_1419765_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|1419868_1421167_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|1421371_1421797_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076316.1|1421835_1424277_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
WP_001293282.1|1424456_1425188_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000220137.1|1425313_1425715_+	DUF2170 family protein	NA	NA	NA	NA	NA
WP_000511955.1|1425733_1426432_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000012553.1|1426482_1427142_+	YjfK family protein	NA	NA	NA	NA	NA
WP_000547760.1|1427159_1427558_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000101649.1|1427567_1428206_+	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000943987.1|1428208_1429372_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.5	1.7e-81
WP_001339483.1|1429455_1431081_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000811566.1|1431197_1431473_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_000254636.1|1431621_1431951_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_040089787.1|1432132_1432882_+	esterase	NA	NA	NA	NA	NA
WP_000133631.1|1432878_1433634_-	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_001295191.1|1433741_1434806_-	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_001296880.1|1435160_1436558_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000218362.1|1436573_1436879_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_000776521.1|1436888_1437353_+	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000056760.1|1437366_1438017_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000949511.1|1438026_1438881_+	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_001170812.1|1438880_1439567_+	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000492911.1|1439695_1439971_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001216676.1|1440297_1440693_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001296681.1|1440699_1441014_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_000135199.1|1441018_1441246_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001196062.1|1441287_1441737_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_040089790.1|1441807_1442596_-	DUF2686 family protein	NA	NA	NA	NA	NA
WP_000604912.1|1443218_1443650_-|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.6	1.9e-43
WP_001367946.1|1443657_1444866_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	9.2e-208
WP_001119478.1|1445000_1445639_-	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000211225.1|1445857_1446478_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_000228343.1|1446786_1448199_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000331458.1|1448243_1448906_-	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_001296686.1|1449013_1449979_-	DMT family transporter	NA	NA	NA	NA	NA
WP_001461958.1|1450086_1450947_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000084622.1|1451035_1451416_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000589439.1|1451544_1453488_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000886909.1|1453677_1454418_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000175286.1|1454407_1454965_-	YtfJ family protein	NA	NA	NA	NA	NA
WP_000689228.1|1455289_1455496_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000935042.1|1455557_1456901_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001295196.1|1457223_1457862_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_001269327.1|1458067_1459801_+	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_073488004.1|1459797_1463577_+	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001219160.1|1463579_1463921_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_001223208.1|1464133_1464385_+	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_000239579.1|1464378_1464729_+	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_000055072.1|1464808_1465339_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
WP_000265933.1|1465648_1466605_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000205810.1|1466744_1468247_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.4e-11
WP_024251350.1|1468260_1469283_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596016.1|1469269_1470265_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|1470297_1471296_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_001219792.1|1471471_1472845_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000166270.1|1473000_1473552_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001162171.1|1473645_1474998_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_001232246.1|1475181_1475568_+	cytochrome b562	NA	NA	NA	NA	NA
WP_001106228.1|1475612_1476077_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	56.4	2.5e-52
WP_000187778.1|1476234_1478373_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
>prophage 104
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1482020	1488117	5021692		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_001181324.1|1482020_1482968_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001387276.1|1483152_1483206_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471866.1|1483346_1486043_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_000047539.1|1486248_1486635_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|1486707_1487169_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|1487181_1488117_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
>prophage 105
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1496394	1508776	5021692	integrase,tRNA	Klosneuvirus(20.0%)	8	1493849:1493862	1511905:1511918
1493849:1493862	attL	AATGAATTAAAATT	NA	NA	NA	NA
WP_040089792.1|1496394_1499250_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
WP_000786399.1|1499249_1499693_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|1499826_1501338_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584114.1|1501604_1502705_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|1502704_1503787_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_040089793.1|1503947_1505450_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.3	1.1e-82
WP_001300770.1|1505579_1506599_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	1.4e-44
WP_064734881.1|1507099_1508776_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	36.7	4.4e-75
1511905:1511918	attR	AATTTTAATTCATT	NA	NA	NA	NA
>prophage 106
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1515765	1516671	5021692		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_032214501.1|1515765_1516671_-	DUF1738 domain-containing protein	NA	A0A1B1IRD0	uncultured_Mediterranean_phage	37.5	2.8e-44
>prophage 107
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1522574	1523165	5021692	integrase	Escherichia_phage(100.0%)	1	1514279:1514293	1527765:1527779
1514279:1514293	attL	GATAAGCCACAGCGC	NA	NA	NA	NA
WP_032214505.1|1522574_1523165_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	49.2	2.0e-46
WP_032214505.1|1522574_1523165_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	49.2	2.0e-46
1527765:1527779	attR	GATAAGCCACAGCGC	NA	NA	NA	NA
>prophage 108
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1529357	1530893	5021692		Staphylococcus_phage(100.0%)	1	NA	NA
WP_032214509.1|1529357_1530893_+	recombinase family protein	NA	A0A0N9RZT8	Staphylococcus_phage	25.9	8.8e-14
>prophage 109
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1536236	1536512	5021692		Vibrio_phage(100.0%)	1	NA	NA
WP_023155766.1|1536236_1536512_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	71.6	5.6e-20
>prophage 110
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1544318	1545902	5021692		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_157905320.1|1544318_1545902_-	cytidine deaminase	NA	M1HP54	Acanthocystis_turfacea_Chlorella_virus	46.7	2.7e-05
>prophage 111
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1552218	1554563	5021692		Cyanophage(50.0%)	2	NA	NA
WP_023182588.1|1552218_1552689_+	Hsp20 family protein	NA	A0A1D7SNF0	Cyanophage	31.8	5.8e-09
WP_032214543.1|1552736_1554563_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.8	1.1e-34
>prophage 112
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1558643	1558838	5021692		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001561320.1|1558643_1558838_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	44.8	5.0e-07
>prophage 113
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1564051	1570452	5021692		Mycobacterium_phage(50.0%)	2	NA	NA
WP_073488030.1|1564051_1569436_+	DNA translocase FtsK	NA	Q853W3	Mycobacterium_phage	31.4	4.9e-35
WP_032214555.1|1569615_1570452_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A0F7L647	uncultured_marine_virus	33.7	1.1e-21
>prophage 114
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1575332	1576160	5021692	integrase	Enterobacteria_phage(100.0%)	1	1559934:1559947	1581823:1581836
1559934:1559947	attL	GTTTTTGCTAAAAC	NA	NA	NA	NA
WP_032214558.1|1575332_1576160_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	42.4	1.0e-56
WP_032214558.1|1575332_1576160_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	42.4	1.0e-56
1581823:1581836	attR	GTTTTAGCAAAAAC	NA	NA	NA	NA
>prophage 115
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1587891	1588872	5021692		Escherichia_phage(100.0%)	1	NA	NA
WP_040089811.1|1587891_1588872_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	H6WZJ9	Escherichia_phage	55.0	1.2e-101
>prophage 116
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1592234	1593910	5021692		Escherichia_phage(100.0%)	2	NA	NA
WP_000790583.1|1592234_1592837_+	type 1 fimbria switch DNA invertase FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
WP_000044711.1|1593313_1593910_+	type 1 fimbria switch DNA invertase FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
>prophage 117
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1604177	1605638	5021692		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208194.1|1604177_1605638_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	9.5e-50
>prophage 118
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1612206	1612761	5021692		Clostridioides_phage(100.0%)	1	NA	NA
WP_001151854.1|1612206_1612761_+	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
>prophage 119
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1620262	1621207	5021692	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000181170.1|1620262_1621207_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.7	5.9e-61
>prophage 120
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1641273	1646638	5021692		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_000919569.1|1641273_1642938_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
WP_000410129.1|1642986_1644348_-	MFS transporter	NA	NA	NA	NA	NA
WP_073488033.1|1644562_1645477_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000106033.1|1645615_1646638_+	L-galactonate oxidoreductase	NA	A0A2K9L7I1	Tupanvirus	26.3	2.7e-11
>prophage 121
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1649864	1651144	5021692		Shigella_phage(50.0%)	2	NA	NA
WP_000799911.1|1649864_1650602_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
WP_000098824.1|1650604_1651144_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
>prophage 122
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1659041	1661917	5021692		Streptococcus_phage(50.0%)	3	NA	NA
WP_000175943.1|1659041_1660631_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001295748.1|1661023_1661629_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|1661755_1661917_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
>prophage 123
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1667552	1668875	5021692		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477811.1|1667552_1668875_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
>prophage 124
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1675618	1680973	5021692		Enterococcus_phage(33.33%)	3	NA	NA
WP_000093810.1|1675618_1676851_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
WP_000046749.1|1677157_1678825_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000409451.1|1679035_1680973_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
>prophage 125
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1684309	1686423	5021692		Bacillus_phage(50.0%)	2	NA	NA
WP_001188659.1|1684309_1684999_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
WP_040089804.1|1684998_1686423_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.4	1.2e-09
>prophage 126
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1698191	1707260	5021692		Cyanophage(20.0%)	9	NA	NA
WP_000130189.1|1698191_1699145_+	transaldolase	NA	A0A127KNC6	Cyanophage	30.9	4.8e-10
WP_001094682.1|1699259_1699847_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000528538.1|1699881_1700448_-	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001102383.1|1700596_1701310_-	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000843559.1|1701335_1701740_-	DUF2541 family protein	NA	NA	NA	NA	NA
WP_000516135.1|1702116_1704033_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_001118464.1|1704121_1705252_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_000935262.1|1705355_1705565_-	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	73.9	8.0e-19
WP_000681368.1|1706093_1707260_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	53.8	9.2e-88
>prophage 127
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1714293	1717110	5021692	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_040089993.1|1714293_1717110_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	2.7e-77
>prophage 128
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1721516	1722665	5021692		Halovirus(100.0%)	1	NA	NA
WP_000597260.1|1721516_1722665_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 129
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1728135	1733795	5021692		Hepacivirus(50.0%)	4	NA	NA
WP_001395601.1|1728135_1729689_-	crotonobetaine/carnitine-CoA ligase	NA	Q75ZG1	Hepacivirus	25.4	6.2e-31
WP_000349938.1|1729762_1730980_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_000347117.1|1731107_1732250_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000787103.1|1732280_1733795_-	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
>prophage 130
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1741689	1743089	5021692		Bacillus_phage(50.0%)	2	NA	NA
WP_000624375.1|1741689_1742169_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
WP_000257186.1|1742246_1743089_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH	NA	A0A075BTY6	Microcystis_phage	42.0	1.0e-08
>prophage 131
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1750833	1756256	5021692		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001117011.1|1750833_1753740_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
WP_040089996.1|1753904_1756256_-	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.2	3.9e-37
>prophage 132
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1762606	1763305	5021692		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916280.1|1762606_1763305_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	37.2	9.5e-24
>prophage 133
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1776008	1777733	5021692		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_000425658.1|1776008_1777733_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	8.3e-37
>prophage 134
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1803706	1804750	5021692		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_040089999.1|1803706_1804750_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 135
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1808995	1809547	5021692		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923721.1|1808995_1809547_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	32.3	3.0e-12
>prophage 136
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1818057	1819482	5021692		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|1818057_1819482_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 137
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1827131	1833754	5021692		Mamastrovirus(33.33%)	5	NA	NA
WP_001189647.1|1827131_1828682_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
WP_001306211.1|1828883_1831274_-	quinoprotein glucose dehydrogenase	NA	NA	NA	NA	NA
WP_000683335.1|1831479_1832016_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_000651599.1|1832056_1832719_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000150637.1|1832827_1833754_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
>prophage 138
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1837016	1837919	5021692		Sodalis_phage(100.0%)	1	NA	NA
WP_000339948.1|1837016_1837919_+	recombination-promoting nuclease RpnC	NA	Q2A0A7	Sodalis_phage	49.2	5.7e-61
>prophage 139
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1847825	1854631	5021692	tRNA	unidentified_phage(50.0%)	6	NA	NA
WP_000174639.1|1847825_1849244_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
WP_021565407.1|1849282_1850209_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_001155227.1|1850245_1850701_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000396044.1|1850878_1851583_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001294700.1|1851597_1852128_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_047668145.1|1852201_1854631_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.3	3.9e-40
>prophage 140
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1859874	1860672	5021692		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158929.1|1859874_1860672_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
>prophage 141
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1866583	1866928	5021692		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|1866583_1866928_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 142
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1870857	1933632	5021692	integrase,plate,tRNA,protease	Vibrio_phage(25.0%)	50	1875233:1875248	1926448:1926463
WP_000753946.1|1870857_1872282_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
WP_000929443.1|1872436_1873594_+	DNA-binding transcriptional regulator CdaR	NA	NA	NA	NA	NA
WP_000272188.1|1873682_1874069_-	DUF3461 family protein	NA	NA	NA	NA	NA
WP_000625631.1|1874230_1875043_-	phosphodiesterase YaeI	NA	NA	NA	NA	NA
WP_001186650.1|1875096_1875921_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
1875233:1875248	attL	CCCGCCGGAACGCGAC	NA	NA	NA	NA
WP_001094571.1|1875951_1878624_-	bifunctional uridylyltransferase/uridylyl-removing protein GlnD	NA	NA	NA	NA	NA
WP_001018194.1|1878685_1879480_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_000246884.1|1879847_1880573_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_000818114.1|1880830_1881682_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_000224573.1|1881828_1882554_+	UMP kinase	NA	NA	NA	NA	NA
WP_000622418.1|1882845_1883403_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_073488042.1|1883494_1884691_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_001295562.1|1884879_1885638_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
WP_000922446.1|1885650_1886508_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_021534273.1|1886519_1887872_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|1887901_1890334_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|1890455_1890941_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139282.1|1890944_1891970_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|1892074_1892530_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|1892533_1893322_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139667.1|1893321_1894470_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569419.1|1894466_1895063_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	3.9e-26
WP_001294774.1|1895099_1898582_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055741.1|1898594_1899554_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020973.1|1899652_1901794_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|1901850_1902240_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176578.1|1902304_1903603_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|1903651_1903912_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|1903898_1904099_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185293.1|1904264_1904810_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635545.1|1904806_1905229_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239192.1|1905242_1905953_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001297208.1|1906107_1906932_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260712.1|1906985_1908704_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094011.1|1908815_1909523_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|1909519_1909924_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874224.1|1910041_1910857_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|1910896_1911550_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|1911542_1912574_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140186.1|1912761_1913334_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000279885.1|1919196_1919763_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B5FPC6	Escherichia_phage	45.2	2.2e-34
WP_000666530.1|1921056_1921737_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	41.4	2.6e-50
WP_001542642.1|1924220_1924493_-	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_000450225.1|1924495_1925542_-	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_000063810.1|1925552_1926548_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
1926448:1926463	attR	CCCGCCGGAACGCGAC	NA	NA	NA	NA
WP_000371477.1|1926544_1928428_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_001276642.1|1928443_1928938_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000183810.1|1928934_1929765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000804010.1|1929751_1930666_-	type VI secretion system-associated protein TagK	NA	NA	NA	NA	NA
WP_001542643.1|1930998_1933632_+	type VI secretion system ATPase TssH	NA	A0A2I7SAX5	Vibrio_phage	32.8	2.5e-80
>prophage 143
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1957863	1962065	5021692		uncultured_Caudovirales_phage(33.33%)	5	NA	NA
WP_000644686.1|1957863_1959222_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052720.1|1959293_1960049_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001307587.1|1960082_1960805_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|1960801_1961269_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001366128.1|1961333_1962065_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
>prophage 144
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1966496	1969809	5021692		Caulobacter_phage(50.0%)	4	NA	NA
WP_000284050.1|1966496_1967075_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000333380.1|1967280_1968048_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|1968018_1968759_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_040090544.1|1969059_1969809_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
>prophage 145
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1974887	1975997	5021692		Mycobacterium_phage(100.0%)	1	NA	NA
WP_024220423.1|1974887_1975997_+	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.0	8.3e-30
>prophage 146
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1980674	1985483	5021692		Streptococcus_phage(50.0%)	4	NA	NA
WP_040090682.1|1980674_1981730_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	3.1e-119
WP_001285288.1|1982017_1983121_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893255.1|1983132_1984386_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
WP_001449305.1|1984886_1985483_+	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	87.9	4.2e-97
>prophage 147
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	1991837	2000052	5021692	transposase	Escherichia_phage(40.0%)	6	NA	NA
WP_033885159.1|1991837_1994198_+	DEAD/DEAH box helicase family protein	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.5	1.5e-33
WP_032296360.1|1994215_1994530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000255956.1|1994759_1995782_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
WP_001297096.1|1995781_1996561_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_001367158.1|1996797_1997691_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	38.4	1.2e-31
WP_073488056.1|1998285_2000052_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	25.5	6.0e-22
>prophage 148
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2011065	2015689	5021692		Satellite_phage(33.33%)	3	NA	NA
WP_040074728.1|2011065_2011398_-	helix-turn-helix transcriptional regulator	NA	U5TNA1	Satellite_phage	39.1	2.7e-13
WP_052318230.1|2011533_2014629_+	toprim domain-containing protein	NA	S5M810	Pseudoalteromonas_phage	42.7	9.2e-10
WP_052318229.1|2014621_2015689_+	site-specific tyrosine recombinase XerC	NA	T2KT84	uncultured_phage	29.9	5.2e-05
>prophage 149
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2034094	2034867	5021692		Stx2-converting_phage(50.0%)	2	NA	NA
WP_000624720.1|2034094_2034445_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	6.2e-40
WP_000422746.1|2034441_2034867_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	97.9	1.3e-47
>prophage 150
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2044071	2046508	5021692		Yersinia_phage(33.33%)	5	NA	NA
WP_001234621.1|2044071_2044890_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	2.0e-44
WP_000680583.1|2044889_2045135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449312.1|2045228_2045708_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.6	1.2e-12
WP_001367144.1|2045723_2046200_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692350.1|2046286_2046508_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
>prophage 151
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2050534	2055745	5021692	integrase	uncultured_Caudovirales_phage(50.0%)	4	2046541:2046556	2053455:2053470
2046541:2046556	attL	ACCACCGGACCATTCT	NA	NA	NA	NA
WP_000144687.1|2050534_2051854_-|integrase	site-specific integrase	integrase	A0A2H4J5F8	uncultured_Caudovirales_phage	23.4	2.5e-17
WP_001111355.1|2052191_2052602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047655235.1|2052601_2053537_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
2053455:2053470	attR	AGAATGGTCCGGTGGT	NA	NA	NA	NA
WP_047655234.1|2053546_2055745_-	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	26.0	5.1e-39
>prophage 152
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2075953	2077279	5021692		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_001543522.1|2075953_2077279_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	1.1e-113
>prophage 153
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2082852	2088772	5021692	holin	Catovirus(50.0%)	4	NA	NA
WP_001159109.1|2082852_2084523_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	2.3e-60
WP_000089080.1|2084536_2086009_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001295527.1|2086022_2086610_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131044.1|2086738_2088772_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
>prophage 154
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2099972	2101022	5021692		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_000692754.1|2099972_2101022_+	NADPH-dependent aldehyde reductase YahK	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	42.6	2.8e-72
>prophage 155
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2109701	2111588	5021692		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000010270.1|2109701_2111588_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	3.1e-53
>prophage 156
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2114882	2115782	5021692		Lactobacillus_phage(100.0%)	1	NA	NA
WP_000952481.1|2114882_2115782_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	3.2e-16
>prophage 157
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2120323	2124603	5021692		Herpes_simplex_virus(50.0%)	2	NA	NA
WP_000177934.1|2120323_2123398_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	98.7	0.0e+00
WP_000805905.1|2123520_2124603_-	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	99.7	1.4e-191
>prophage 158
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2130013	2131974	5021692		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
WP_000044314.1|2130013_2130964_+	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
WP_001013499.1|2130960_2131974_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	1.2e-43
>prophage 159
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2135052	2136162	5021692		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000842102.1|2135052_2136162_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
>prophage 160
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2141460	2142228	5021692		Planktothrix_phage(100.0%)	1	NA	NA
WP_000939375.1|2141460_2142228_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.3	8.6e-26
>prophage 161
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2149192	2150350	5021692		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830741.1|2149192_2150350_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	5.1e-06
>prophage 162
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2157765	2158881	5021692		Bacillus_phage(100.0%)	1	NA	NA
WP_000484048.1|2157765_2158881_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
>prophage 163
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2163170	2173142	5021692		Bacillus_phage(60.0%)	7	NA	NA
WP_001298537.1|2163170_2164082_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
WP_001219312.1|2164206_2165115_+	fructokinase	NA	NA	NA	NA	NA
WP_001342761.1|2165257_2166442_-	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_040089979.1|2166567_2169711_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_040089978.1|2169707_2170910_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	1.8e-06
WP_000113933.1|2171099_2171789_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_000893603.1|2171846_2173142_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.3e-26
>prophage 164
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2180094	2189075	5021692	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_000667319.1|2180094_2181222_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
WP_000007629.1|2181244_2181577_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000934822.1|2181604_2183452_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000046637.1|2183462_2184434_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000974813.1|2184562_2184910_+	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_001295328.1|2185086_2185971_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_001295327.1|2186269_2186809_-	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_000543535.1|2186959_2187409_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_040089976.1|2187412_2188516_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.5	6.9e-53
WP_001021161.1|2188604_2189075_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
>prophage 165
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2210634	2215681	5021692	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_000122253.1|2210634_2211258_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_000130305.1|2211383_2212658_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_001295325.1|2212845_2215200_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_001043542.1|2215408_2215681_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
>prophage 166
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2218821	2219517	5021692		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817236.1|2218821_2219517_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	8.4e-89
>prophage 167
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2222840	2226387	5021692		Bacillus_phage(100.0%)	2	NA	NA
WP_001235606.1|2222840_2224613_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	3.4e-49
WP_001256182.1|2224605_2226387_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.2	5.2e-42
>prophage 168
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2235221	2238371	5021692		Leptospira_phage(100.0%)	1	NA	NA
WP_001132469.1|2235221_2238371_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 169
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2245380	2253942	5021692		Klosneuvirus(25.0%)	8	NA	NA
WP_040090080.1|2245380_2245932_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	4.9e-31
WP_040090082.1|2246060_2247992_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	3.9e-43
WP_000467098.1|2248044_2248374_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_001195025.1|2248373_2248979_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_000678208.1|2249088_2250963_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_001220233.1|2251143_2251788_+	adenylate kinase	NA	NA	NA	NA	NA
WP_001250088.1|2252023_2252986_+	ferrochelatase	NA	NA	NA	NA	NA
WP_000801832.1|2252982_2253942_-	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.3	1.1e-14
>prophage 170
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2262186	2265247	5021692		Escherichia_phage(50.0%)	2	NA	NA
WP_001344274.1|2262186_2262528_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	74.5	1.8e-39
WP_024243322.1|2262742_2265247_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.1	1.1e-114
>prophage 171
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2269786	2270464	5021692		Bacillus_virus(100.0%)	1	NA	NA
WP_001157535.1|2269786_2270464_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	2.4e-27
>prophage 172
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2273600	2274287	5021692		Planktothrix_phage(100.0%)	1	NA	NA
WP_001110573.1|2273600_2274287_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
>prophage 173
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2281194	2282976	5021692		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_040090084.1|2281194_2282976_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	2.7e-38
>prophage 174
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2289166	2290312	5021692		Streptococcus_phage(100.0%)	1	NA	NA
WP_000706355.1|2289166_2290312_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.8e-48
>prophage 175
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2301732	2304863	5021692	tRNA	Moumouvirus(50.0%)	4	NA	NA
WP_000912345.1|2301732_2303118_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143552.1|2303153_2303675_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|2303782_2303995_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729154.1|2303996_2304863_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
>prophage 176
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2320595	2321279	5021692		Bacillus_phage(100.0%)	1	NA	NA
WP_000770953.1|2320595_2321279_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
>prophage 177
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2324549	2327693	5021692		Leptospira_phage(100.0%)	1	NA	NA
WP_073488079.1|2324549_2327693_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.4	1.7e-59
>prophage 178
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2339122	2345166	5021692		Tupanvirus(50.0%)	3	NA	NA
WP_040089779.1|2339122_2343004_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.6	2.0e-62
WP_000096738.1|2343220_2344354_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000140647.1|2344350_2345166_-	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
>prophage 179
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2359712	2361535	5021692		uncultured_marine_virus(50.0%)	2	NA	NA
WP_000502945.1|2359712_2360342_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	2.9e-56
WP_000029825.1|2360314_2361535_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.8	2.1e-58
>prophage 180
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2364602	2366717	5021692		Bacillus_virus(50.0%)	2	NA	NA
WP_040089778.1|2364602_2366168_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.0	6.4e-44
WP_040089777.1|2366288_2366717_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	8.7e-20
>prophage 181
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2382142	2382789	5021692		Morganella_phage(50.0%)	2	NA	NA
WP_000034825.1|2382142_2382352_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
WP_000939738.1|2382405_2382789_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
>prophage 182
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2387604	2390044	5021692		Stx2-converting_phage(50.0%)	2	NA	NA
WP_001092082.1|2387604_2388816_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
WP_001231415.1|2388955_2390044_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
>prophage 183
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2397054	2399637	5021692	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001297565.1|2397054_2399637_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.3	5.2e-184
>prophage 184
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2406576	2410109	5021692		Bathycoccus_sp._RCC1105_virus(50.0%)	3	NA	NA
WP_073488083.1|2406576_2408247_-	molecular chaperone HscC	NA	E5EQT9	Bathycoccus_sp._RCC1105_virus	35.3	3.4e-75
WP_001207503.1|2408330_2409266_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000631384.1|2409383_2410109_-	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
>prophage 185
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2418005	2419046	5021692		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001018040.1|2418005_2419046_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.1e-47
>prophage 186
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2423072	2424737	5021692		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337088.1|2423072_2424737_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.1	1.4e-84
>prophage 187
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2429363	2433177	5021692	tRNA	Vibrio_phage(50.0%)	2	NA	NA
WP_001023104.1|2429363_2431310_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
WP_001287154.1|2431512_2433177_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.1	0.0e+00
>prophage 188
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2437326	2438091	5021692		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000773279.1|2437326_2438091_-	esterase	NA	A0A1J0GNR5	Mycobacterium_phage	31.5	2.9e-05
>prophage 189
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2444746	2450727	5021692		Bacillus_phage(33.33%)	4	NA	NA
WP_000186103.1|2444746_2445424_-	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	31.1	8.9e-27
WP_040089771.1|2445420_2448105_-	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.5	1.4e-11
WP_001297248.1|2448097_2448670_-	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_000087967.1|2448678_2450727_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	22.8	4.2e-27
>prophage 190
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2460284	2463226	5021692		Hokovirus(50.0%)	2	NA	NA
WP_000628039.1|2460284_2461703_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.4	6.8e-61
WP_001032700.1|2461744_2463226_-	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.0	5.5e-45
>prophage 191
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2466604	2467396	5021692		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114037.1|2466604_2467396_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	27.0	3.7e-08
>prophage 192
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2503434	2506954	5021692		Vibrio_phage(33.33%)	4	NA	NA
WP_040089768.1|2503434_2504154_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	2.4e-22
WP_000951292.1|2504150_2505092_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	2.2e-23
WP_000784351.1|2505205_2505586_-	YbgS-like family protein	NA	NA	NA	NA	NA
WP_001109196.1|2505901_2506954_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	3.4e-81
>prophage 193
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2511308	2517881	5021692		Tupanvirus(33.33%)	7	NA	NA
WP_001265438.1|2511308_2512325_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	6.1e-80
WP_000096869.1|2512585_2514058_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	7.2e-13
WP_001147439.1|2514125_2514914_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000891515.1|2515042_2515192_+	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_047655224.1|2515357_2516131_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000604034.1|2516130_2516820_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000891685.1|2516822_2517881_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.7	2.6e-20
>prophage 194
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2528236	2529526	5021692		Klosneuvirus(100.0%)	1	NA	NA
WP_072025125.1|2528236_2529526_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.6	6.5e-18
>prophage 195
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2547513	2562325	5021692		Anomala_cuprea_entomopoxvirus(14.29%)	13	NA	NA
WP_000996107.1|2547513_2549250_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
WP_001296990.1|2549242_2550238_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001296991.1|2550240_2550912_-	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000007101.1|2551140_2552505_+	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001145127.1|2552736_2553219_-	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.7	2.6e-36
WP_040089780.1|2553338_2555489_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	3.7e-42
WP_000386540.1|2555516_2556479_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_023155870.1|2556619_2557705_+	hydroxycarboxylate dehydrogenase HcXB	NA	NA	NA	NA	NA
WP_000849301.1|2557933_2558194_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000146343.1|2558458_2558725_-	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
WP_000990176.1|2558798_2559476_-	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
WP_040090141.1|2559517_2561800_-	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000710619.1|2562064_2562325_-	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
>prophage 196
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2565865	2571090	5021692		Planktothrix_phage(33.33%)	7	NA	NA
WP_000569080.1|2565865_2566588_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
WP_001159065.1|2566584_2567244_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_040090143.1|2567382_2568129_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_000100800.1|2568532_2569036_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_001119538.1|2569334_2570222_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_120795379.1|2570456_2570522_+	protein YliM	NA	NA	NA	NA	NA
WP_001295296.1|2570574_2571090_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
>prophage 197
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2576087	2584424	5021692		Tupanvirus(33.33%)	6	NA	NA
WP_000961458.1|2576087_2577680_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
WP_000168797.1|2577915_2579181_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_000114234.1|2579332_2580148_-	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_021564989.1|2580293_2582726_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_001307076.1|2582731_2583631_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_001351540.1|2583761_2584424_+	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	33.2	1.6e-25
>prophage 198
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2587651	2589523	5021692		Planktothrix_phage(100.0%)	1	NA	NA
WP_047655319.1|2587651_2589523_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	4.0e-16
>prophage 199
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2600858	2602061	5021692		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000195961.1|2600858_2602061_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
>prophage 200
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2610627	2619777	5021692		Vibrio_phage(25.0%)	11	NA	NA
WP_001195231.1|2610627_2610885_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
WP_001201576.1|2611044_2611332_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000189162.1|2611315_2612038_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684321.1|2612098_2613001_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|2613088_2613565_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126069.1|2613915_2615028_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996005.1|2615122_2616256_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000105444.1|2616265_2617219_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_033800540.1|2617215_2618061_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|2618120_2618609_+	YbjO family protein	NA	NA	NA	NA	NA
WP_033800541.1|2618649_2619777_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	6.0e-28
>prophage 201
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2623116	2625854	5021692		Planktothrix_phage(50.0%)	4	NA	NA
WP_000027205.1|2623116_2623845_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_040090185.1|2624062_2624578_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|2624703_2625027_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255167.1|2625023_2625854_+	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
>prophage 202
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2629441	2631160	5021692		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815349.1|2629441_2631160_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.2	3.1e-31
>prophage 203
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2640457	2664274	5021692	tRNA,protease	uncultured_Mediterranean_phage(16.67%)	16	NA	NA
WP_000188180.1|2640457_2642404_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|2642476_2642701_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|2643023_2643344_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|2643374_2645651_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|2646394_2646613_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_040090220.1|2646897_2647602_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202188.1|2647643_2649365_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	1.9e-20
WP_001542779.1|2649365_2651132_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	5.4e-23
WP_000537418.1|2651254_2652220_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_000228473.1|2652763_2653258_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_073488091.1|2653392_2657460_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|2657614_2658226_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067740.1|2658236_2659580_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.6	3.6e-80
WP_000886683.1|2659670_2660963_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000850306.1|2661201_2663646_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000213098.1|2663656_2664274_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
>prophage 204
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2670583	2673798	5021692		Tetraselmis_virus(100.0%)	2	NA	NA
WP_000111043.1|2670583_2671324_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001292822.1|2671515_2673798_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
>prophage 205
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2677896	2678985	5021692		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057149.1|2677896_2678985_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
>prophage 206
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2684071	2688612	5021692		Bacillus_phage(100.0%)	3	NA	NA
WP_000167336.1|2684071_2684356_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_040090217.1|2684562_2686827_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551270.1|2686863_2688612_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
>prophage 207
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2703317	2714449	5021692	tRNA	Rhodobacter_phage(20.0%)	8	NA	NA
WP_001295932.1|2703317_2703866_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_001109487.1|2703892_2704540_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_040090215.1|2704761_2705952_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977920.1|2706136_2707225_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000117881.1|2707825_2709226_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_001297200.1|2709394_2710597_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000193859.1|2710862_2713475_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	4.1e-19
WP_001090508.1|2713681_2714449_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
>prophage 208
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2730371	2732279	5021692		Tupanvirus(100.0%)	1	NA	NA
WP_000053122.1|2730371_2732279_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.5	3.2e-53
>prophage 209
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2744890	2746945	5021692		Bacillus_phage(100.0%)	1	NA	NA
WP_001297106.1|2744890_2746945_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	7.7e-21
>prophage 210
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2751178	2751838	5021692	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000375136.1|2751178_2751838_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 211
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2771108	2783363	5021692		Morganella_phage(20.0%)	13	NA	NA
WP_000066490.1|2771108_2771321_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|2771331_2771520_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001316982.1|2771494_2771725_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|2771714_2771888_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000829668.1|2771935_2773009_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_071828255.1|2773080_2775825_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	1.0e-36
WP_001264955.1|2775907_2776936_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120112.1|2776908_2777601_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_040090208.1|2777730_2778903_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_040090207.1|2778902_2781449_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.1	3.8e-70
WP_000209854.1|2781445_2782045_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000024561.1|2782137_2782443_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420629.1|2782442_2783363_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	3.2e-11
>prophage 212
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2787666	2789766	5021692		Enterobacteria_phage(100.0%)	3	NA	NA
WP_001273658.1|2787666_2787840_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001297178.1|2787922_2789251_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.6	6.9e-233
WP_001028096.1|2789271_2789766_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	96.9	1.1e-50
>prophage 213
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2804677	2873246	5021692	integrase,transposase,tRNA	Shigella_phage(14.29%)	38	2805583:2805597	2839911:2839925
WP_000533522.1|2804677_2805466_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	7.8e-91
2805583:2805597	attL	TCTGGTTTAGATACT	NA	NA	NA	NA
WP_000009225.1|2806049_2806736_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_000279878.1|2807002_2808205_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	1.7e-44
WP_047659600.1|2808392_2810210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014639577.1|2811322_2811619_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000579535.1|2811845_2812043_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_073488099.1|2812261_2813695_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_073488101.1|2814661_2815225_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_024193920.1|2817168_2818179_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_073488103.1|2818226_2818655_-	heme-binding protein	NA	NA	NA	NA	NA
WP_001610774.1|2818647_2819553_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_001610773.1|2819546_2820374_-	SDR family oxidoreductase	NA	A0A167REC2	Powai_lake_megavirus	29.2	5.3e-05
WP_073488105.1|2820397_2821501_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	NA	NA	NA	NA
WP_001610771.1|2821558_2823013_-	MFS transporter	NA	NA	NA	NA	NA
WP_073488109.1|2823155_2824805_-	signal transduction protein	NA	NA	NA	NA	NA
WP_073488111.1|2824828_2826436_-	FGGY-family carbohydrate kinase	NA	NA	NA	NA	NA
WP_077897286.1|2827272_2827455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073488113.1|2829061_2831236_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_073488115.1|2831558_2832383_+	carbon-phosphorus lyase	NA	NA	NA	NA	NA
WP_073488117.1|2832395_2833631_+	MFS transporter	NA	NA	NA	NA	NA
WP_073488119.1|2833662_2834376_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	35.6	7.0e-14
WP_137530672.1|2838042_2838258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073488123.1|2838457_2839243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000071967.1|2840084_2841317_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	33.7	1.1e-59
2839911:2839925	attR	AGTATCTAAACCAGA	NA	NA	NA	NA
WP_000502746.1|2841301_2841940_+	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	53.7	4.3e-55
WP_073488125.1|2842191_2842500_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_077897287.1|2843671_2843962_+|transposase	transposase	transposase	Q76S41	Shigella_phage	72.0	1.1e-29
WP_073488127.1|2844372_2852298_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	40.9	2.6e-141
WP_001534674.1|2852734_2853409_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	3.6e-12
WP_040074325.1|2853718_2854738_+|transposase	IS110-like element ISEc11 family transposase	transposase	NA	NA	NA	NA
WP_073488131.1|2855214_2856771_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.7	2.0e-162
WP_000124188.1|2857365_2857581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073488133.1|2859502_2869360_+|tRNA	contact-dependent inhibition effector tRNA nuclease	tRNA	A0A0R6PJK4	Moraxella_phage	33.5	5.7e-29
WP_000355946.1|2869373_2869694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_187655768.1|2870339_2870435_-|transposase	transposase	transposase	Q9ZXG3	Shigella_phage	88.5	1.7e-05
WP_001520155.1|2870420_2870705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073488138.1|2870943_2872485_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.3	8.3e-129
WP_001016257.1|2872499_2873246_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
>prophage 214
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2893598	2895155	5021692		Staphylococcus_phage(100.0%)	1	NA	NA
WP_073488158.1|2893598_2895155_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.7	1.1e-104
>prophage 215
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2903361	2905496	5021692		Yersinia_phage(33.33%)	4	NA	NA
WP_001234620.1|2903361_2904180_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	2.0e-44
WP_000849582.1|2904234_2904720_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	2.6e-12
WP_001186726.1|2904735_2905212_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692323.1|2905274_2905496_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
>prophage 216
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2911486	2912320	5021692		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|2911486_2912320_-	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 217
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2916455	2916989	5021692		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857399.1|2916455_2916989_+	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	7.8e-26
>prophage 218
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2926297	2927218	5021692		Morganella_phage(100.0%)	1	NA	NA
WP_000183364.1|2926297_2927218_-	kdo(2)-lipid IV(A) lauroyltransferase	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 219
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2931880	2932126	5021692		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|2931880_2932126_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 220
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2948006	2948948	5021692		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001295441.1|2948006_2948948_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 221
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2961306	2962488	5021692		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_001008535.1|2961306_2962041_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
WP_000103754.1|2962251_2962488_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 222
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2965760	2967403	5021692		Pseudomonas_phage(50.0%)	2	NA	NA
WP_001257000.1|2965760_2966402_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
WP_001267920.1|2966398_2967403_+	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
>prophage 223
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2979734	2979992	5021692		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|2979734_2979992_+	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 224
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2987281	2991004	5021692		Planktothrix_phage(50.0%)	4	NA	NA
WP_001033695.1|2987281_2987983_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.9e-35
WP_001251348.1|2987982_2989227_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_000291270.1|2989255_2990167_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_000952736.1|2990182_2991004_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
>prophage 225
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	2994280	2996258	5021692		Mycoplasma_phage(100.0%)	2	NA	NA
WP_000799401.1|2994280_2995138_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|2995121_2996258_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
>prophage 226
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3001378	3002749	5021692		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_000423729.1|3001378_3002749_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
>prophage 227
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3005885	3009614	5021692		Enterobacteria_phage(66.67%)	6	NA	NA
WP_040089904.1|3005885_3007136_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	98.1	8.5e-23
WP_001307134.1|3007238_3007562_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	8.0e-42
WP_120795380.1|3007814_3007859_-	protein YmgK	NA	NA	NA	NA	NA
WP_032141808.1|3008094_3008205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373101.1|3008257_3008662_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332303.1|3008882_3009614_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
>prophage 228
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3015481	3017803	5021692		Escherichia_phage(100.0%)	1	NA	NA
WP_040089900.1|3015481_3017803_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	43.0	5.1e-90
>prophage 229
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3026339	3028027	5021692		Morganella_phage(50.0%)	2	NA	NA
WP_000897378.1|3026339_3026759_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_000457616.1|3026758_3028027_+	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.4	7.9e-210
>prophage 230
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3054698	3057450	5021692		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_001033352.1|3054698_3056378_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_001298109.1|3056502_3057450_-	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
>prophage 231
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3060586	3067391	5021692		Pseudomonas_phage(33.33%)	9	NA	NA
WP_000804726.1|3060586_3061669_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
WP_000456571.1|3061668_3062502_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000200392.1|3062498_3062891_+	SirB family protein	NA	NA	NA	NA	NA
WP_001257044.1|3062894_3063704_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000811065.1|3063739_3064594_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
WP_000170954.1|3064742_3064850_-	type I toxin-antitoxin system toxin Ldr family protein	NA	NA	NA	NA	NA
WP_000170965.1|3065277_3065385_-	type I toxin-antitoxin system toxin Ldr family protein	NA	NA	NA	NA	NA
WP_001295620.1|3065790_3066891_-	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_001146442.1|3067160_3067391_+	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	6.5e-06
>prophage 232
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3078522	3088710	5021692		Escherichia_phage(25.0%)	10	NA	NA
WP_000702660.1|3078522_3080061_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
WP_000571699.1|3080057_3080768_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_001160110.1|3080767_3081445_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000555849.1|3082348_3083191_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001307143.1|3083240_3083699_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001226476.1|3083811_3084717_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_000193437.1|3084808_3085822_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000718995.1|3086023_3086932_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_001287378.1|3087075_3087489_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068076.1|3088092_3088710_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	7.8e-54
>prophage 233
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3097120	3099135	5021692		Planktothrix_phage(50.0%)	2	NA	NA
WP_000110945.1|3097120_3098134_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
WP_000994905.1|3098130_3099135_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
>prophage 234
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3110792	3113750	5021692		Acinetobacter_phage(100.0%)	2	NA	NA
WP_073488170.1|3110792_3112154_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	1.5e-36
WP_040089886.1|3112154_3113750_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	2.9e-52
>prophage 235
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3118683	3123975	5021692	protease	Chrysochromulina_ericina_virus(33.33%)	4	NA	NA
WP_000559283.1|3118683_3119442_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	8.8e-07
WP_000422045.1|3119661_3120711_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_001031530.1|3120746_3120998_-	YciN family protein	NA	NA	NA	NA	NA
WP_001297122.1|3121377_3123975_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.7e-86
>prophage 236
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3128899	3129490	5021692		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|3128899_3129490_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 237
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3137305	3142965	5021692		Lactococcus_phage(50.0%)	5	NA	NA
WP_000484984.1|3137305_3139240_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.9	3.1e-32
WP_000437858.1|3139307_3140435_-	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_000506490.1|3140579_3141368_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_000968857.1|3141737_3142091_-	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_000573407.1|3142158_3142965_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
>prophage 238
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3155880	3157146	5021692		Klosneuvirus(100.0%)	1	NA	NA
WP_000069234.1|3155880_3157146_+	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.0	5.9e-24
>prophage 239
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3171149	3172232	5021692		Indivirus(100.0%)	1	NA	NA
WP_000057977.1|3171149_3172232_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.4	4.0e-13
>prophage 240
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3188850	3189366	5021692		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945005.1|3188850_3189366_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	2.4e-24
>prophage 241
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3195692	3202962	5021692	tRNA	Bacillus_phage(20.0%)	6	NA	NA
WP_000628065.1|3195692_3196925_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387395.1|3197179_3198163_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123739.1|3198640_3200014_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000081418.1|3200142_3201078_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.7	1.1e-144
WP_001082294.1|3201253_3201688_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
WP_000837924.1|3201828_3202962_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
>prophage 242
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3207922	3208912	5021692		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762229.1|3207922_3208912_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 243
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3240197	3244100	5021692		Klosneuvirus(100.0%)	1	NA	NA
WP_000139567.1|3240197_3244100_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 244
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3248039	3248988	5021692		Escherichia_phage(50.0%)	2	NA	NA
WP_001307188.1|3248039_3248570_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000731856.1|3248814_3248988_+	hypothetical protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	5.8e-07
>prophage 245
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3260794	3270968	5021692	transposase	Escherichia_phage(20.0%)	10	NA	NA
WP_072025130.1|3260794_3262003_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.8	8.6e-206
WP_071609973.1|3262042_3263257_-	BenE family transporter YdcO	NA	NA	NA	NA	NA
WP_000429155.1|3263309_3263846_+	DNA-binding transcriptional regulator SutR	NA	NA	NA	NA	NA
WP_001442195.1|3263918_3265880_+	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	27.9	1.2e-23
WP_000494244.1|3265971_3266202_-	YncJ family protein	NA	NA	NA	NA	NA
WP_000813794.1|3266423_3266600_+	type II toxin-antitoxin system mRNA interferase toxin HicA	NA	A0A0M3LQ86	Mannheimia_phage	57.9	3.6e-12
WP_001270286.1|3266645_3267062_+	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_040089859.1|3267140_3268547_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000047424.1|3268791_3269937_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001542893.1|3269954_3270968_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	36.5	3.0e-26
>prophage 246
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3278100	3280203	5021692		Salmonella_phage(100.0%)	1	NA	NA
WP_040089857.1|3278100_3280203_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.3	5.3e-134
>prophage 247
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3290836	3292381	5021692		Escherichia_phage(100.0%)	1	NA	NA
WP_000702547.1|3290836_3292381_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	4.9e-20
>prophage 248
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3299266	3299557	5021692		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001326205.1|3299266_3299557_-	porin	NA	Q1MVN1	Enterobacteria_phage	64.0	7.9e-25
>prophage 249
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3305569	3307011	5021692		Escherichia_phage(50.0%)	2	NA	NA
WP_000781370.1|3305569_3305854_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
WP_000642407.1|3306000_3307011_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	9.6e-25
>prophage 250
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3310285	3312191	5021692		Planktothrix_phage(100.0%)	2	NA	NA
WP_001285539.1|3310285_3311212_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.5	2.4e-14
WP_040090531.1|3311204_3312191_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	2.9e-18
>prophage 251
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3316507	3320314	5021692		Klosneuvirus(50.0%)	2	NA	NA
WP_001307211.1|3316507_3318907_-	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
WP_000426272.1|3318931_3320314_-	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
>prophage 252
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3325593	3332529	5021692		Powai_lake_megavirus(50.0%)	3	NA	NA
WP_170989069.1|3325593_3328377_-	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	23.8	5.7e-19
WP_040090367.1|3328433_3330806_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_040090366.1|3330843_3332529_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.3	3.8e-10
>prophage 253
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3349127	3350528	5021692		Escherichia_phage(100.0%)	1	NA	NA
WP_089567656.1|3349127_3350528_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	49.0	1.5e-105
>prophage 254
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3357951	3359487	5021692		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_001194882.1|3357951_3359487_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	F2Y302	Organic_Lake_phycodnavirus	29.8	7.5e-13
>prophage 255
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3367367	3368786	5021692		Bacillus_phage(100.0%)	1	NA	NA
WP_000558050.1|3367367_3368786_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
>prophage 256
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3376531	3378661	5021692		Streptococcus_phage(50.0%)	3	NA	NA
WP_000091199.1|3376531_3376915_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000803659.1|3376946_3377165_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_001774876.1|3377221_3378661_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.9	2.4e-29
>prophage 257
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3382604	3459282	5021692	tail,capsid,transposase,integrase,lysis,portal,terminase,head	Enterobacteria_phage(31.03%)	88	3426930:3426945	3459353:3459368
WP_001282151.1|3382604_3382994_+	IS66 family insertion sequence hypothetical protein	NA	B6DZU5	Stx2-converting_phage	99.2	7.8e-68
WP_000612591.1|3382990_3383338_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998071.1|3383387_3384926_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.6	8.4e-299
WP_000577184.1|3385150_3385849_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000087216.1|3385893_3386793_-	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_001054189.1|3386987_3388175_+	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_000901367.1|3388301_3388397_+	protein MgtS	NA	NA	NA	NA	NA
WP_000592826.1|3388615_3389506_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	1.1e-19
WP_000671731.1|3389760_3390153_-	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_001024561.1|3390428_3390947_+	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
WP_001299399.1|3390991_3393037_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_000636571.1|3393173_3393920_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_000215549.1|3394008_3394695_+	DNA-binding transcriptional regulator YdfH	NA	NA	NA	NA	NA
WP_000214712.1|3394872_3395076_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527753.1|3395111_3396572_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.8	4.3e-42
WP_120795384.1|3398547_3398661_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|3398729_3398963_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086527.1|3399279_3399870_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_072025145.1|3400141_3403447_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	K7PGT9	Enterobacteria_phage	69.6	1.6e-283
WP_001230359.1|3403511_3404111_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	2.6e-110
WP_089567729.1|3405036_3406249_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_000090891.1|3408982_3409615_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_000194780.1|3409551_3410295_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_001152624.1|3410300_3410999_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	5.6e-133
WP_000847331.1|3410998_3411328_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_000840337.1|3411324_3413904_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	95.1	0.0e+00
WP_000459457.1|3413896_3414331_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479135.1|3414312_3414735_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	97.1	2.4e-70
WP_001543784.1|3414750_3415491_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	5.2e-129
WP_073488200.1|3415498_3415894_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
WP_000975081.1|3415890_3416469_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000785282.1|3416480_3416834_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_073488203.1|3416845_3417241_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	94.7	3.3e-58
WP_000063254.1|3417282_3418308_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.2	2.8e-189
WP_001358225.1|3418363_3418696_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	2.5e-54
WP_073488207.1|3418705_3420025_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	98.9	3.7e-234
WP_001345555.1|3420005_3421607_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.4	1.3e-310
WP_000198149.1|3421603_3421810_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027295.1|3421806_3423732_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000453611.1|3423706_3424252_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_001368374.1|3424640_3424874_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|3424931_3425342_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|3425493_3425667_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|3425838_3425994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122134696.1|3426073_3426139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071524604.1|3426141_3426330_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|3426340_3426553_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
3426930:3426945	attL	TTTTTATCTCTTAAAG	NA	NA	NA	NA
WP_001092971.1|3427410_3427944_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189915.1|3427940_3428252_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|3428256_3428472_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|3429225_3429441_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|3429741_3429954_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|3430008_3430098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040090316.1|3430376_3431129_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265198.1|3431142_3432192_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_040090315.1|3432193_3432472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|3432538_3432790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|3433006_3433162_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|3433233_3433521_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|3433520_3433760_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|3433784_3434090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001317460.1|3434292_3434625_+	FlxA-like family protein	NA	NA	NA	NA	NA
WP_001374839.1|3438069_3438426_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	71.4	4.8e-40
WP_001151262.1|3438422_3438845_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.0	4.4e-64
WP_000054512.1|3438885_3439851_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.2	2.2e-55
WP_000705355.1|3439831_3440353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|3440336_3440567_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_040089727.1|3440650_3441058_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|3441224_3441380_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001171942.1|3441539_3441758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854562.1|3442325_3442514_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001070257.1|3442510_3442702_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102147.1|3442792_3445231_+	exonuclease	NA	V5UQJ3	Shigella_phage	47.0	1.4e-114
WP_000005552.1|3445303_3445555_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000876978.1|3445589_3446870_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	6.6e-156
WP_001360138.1|3446889_3447000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836057.1|3447057_3448077_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	7.4e-17
WP_001295394.1|3448088_3449303_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|3449508_3449835_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|3449969_3450311_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|3450345_3450906_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|3450908_3451619_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001307224.1|3451726_3452032_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041556.1|3452230_3454657_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	7.7e-214
WP_001342404.1|3454717_3457141_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	9.8e-209
WP_000213028.1|3457151_3457769_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526490.1|3457770_3458625_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|3458667_3459282_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
3459353:3459368	attR	TTTTTATCTCTTAAAG	NA	NA	NA	NA
>prophage 258
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3477043	3478345	5021692		Bacillus_phage(100.0%)	1	NA	NA
WP_021534294.1|3477043_3478345_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	2.5e-17
>prophage 259
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3488240	3490052	5021692		Vaccinia_virus(100.0%)	1	NA	NA
WP_021534295.1|3488240_3490052_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.5	0.0e+00
>prophage 260
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3509934	3511209	5021692	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|3509934_3511209_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 261
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3518120	3519619	5021692		Salmonella_phage(50.0%)	2	NA	NA
WP_001296937.1|3518120_3518642_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
WP_000250656.1|3518722_3519619_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	4.7e-07
>prophage 262
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3528422	3537214	5021692		Streptomyces_phage(20.0%)	9	NA	NA
WP_000101193.1|3528422_3529238_+	peptidoglycan DD-endopeptidase MepH	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
WP_000007283.1|3529365_3529947_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000701040.1|3530092_3531262_-	MFS transporter	NA	NA	NA	NA	NA
WP_000102278.1|3531427_3531517_-	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000190982.1|3531815_3532841_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000269501.1|3532837_3533770_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001182363.1|3533882_3535094_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000098911.1|3535384_3536533_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.7	4.2e-85
WP_000493947.1|3536572_3537214_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
>prophage 263
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3542718	3544985	5021692		Edwardsiella_phage(50.0%)	3	NA	NA
WP_000587560.1|3542718_3543531_-	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
WP_001069986.1|3543534_3544320_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_001349911.1|3544316_3544985_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	1.0e-22
>prophage 264
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3553275	3558359	5021692		environmental_halophage(33.33%)	5	NA	NA
WP_040089746.1|3553275_3554496_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	3.4e-93
WP_033557439.1|3554492_3555764_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000948855.1|3555738_3556485_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	24.0	5.1e-07
WP_000089364.1|3556494_3557982_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000367160.1|3557990_3558359_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	4.3e-15
>prophage 265
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3577004	3596543	5021692	tRNA	Tupanvirus(22.22%)	19	NA	NA
WP_001370575.1|3577004_3578651_+	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.5	2.0e-32
WP_000069375.1|3578707_3581086_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	9.4e-172
WP_000368046.1|3581418_3582252_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_001082226.1|3582408_3583455_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_001270810.1|3583586_3583778_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_000175624.1|3583781_3585218_-	YdiU family protein	NA	NA	NA	NA	NA
WP_001299130.1|3585280_3585994_-	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_001209780.1|3586240_3586705_-	lipoprotein	NA	S5MM68	Bacillus_phage	37.7	9.5e-12
WP_000029466.1|3586782_3587532_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001154187.1|3587531_3588083_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956519.1|3588145_3589126_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001229265.1|3589226_3589526_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000672359.1|3589530_3591918_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018596.1|3591932_3592916_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_001386830.1|3593198_3593243_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|3593365_3593722_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|3593774_3593972_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|3594068_3594611_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144192.1|3594614_3596543_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	3.2e-130
>prophage 266
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3607839	3610101	5021692		Tupanvirus(100.0%)	1	NA	NA
WP_000077873.1|3607839_3610101_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.3e-143
>prophage 267
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3616228	3617056	5021692		Bacillus_virus(100.0%)	1	NA	NA
WP_000175009.1|3616228_3617056_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.6	5.9e-73
>prophage 268
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3624532	3625753	5021692		Klosneuvirus(100.0%)	1	NA	NA
WP_040089755.1|3624532_3625753_-	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	5.5e-27
>prophage 269
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3632517	3633171	5021692		Bacillus_phage(100.0%)	1	NA	NA
WP_001299561.1|3632517_3633171_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.7	3.3e-10
>prophage 270
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3639471	3643360	5021692		Bathycoccus_sp._RCC1105_virus(50.0%)	2	NA	NA
WP_033553584.1|3639471_3641172_-	molecular chaperone HscC	NA	E5ESM6	Bathycoccus_sp._RCC1105_virus	38.6	2.1e-93
WP_040089757.1|3641413_3643360_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.0	4.5e-39
>prophage 271
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3648284	3652370	5021692		Tupanvirus(50.0%)	4	NA	NA
WP_001135075.1|3648284_3648926_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	2.9e-19
WP_040089763.1|3649018_3650377_-	MFS transporter	NA	NA	NA	NA	NA
WP_000719093.1|3650494_3651253_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_040089759.1|3651389_3652370_-	NADH-dependent methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	21.6	3.0e-07
>prophage 272
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3661183	3662038	5021692		Indivirus(100.0%)	1	NA	NA
WP_001186343.1|3661183_3662038_-	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	1.5e-10
>prophage 273
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3665356	3669933	5021692		Bacillus_phage(100.0%)	3	NA	NA
WP_000219686.1|3665356_3666640_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
WP_000616433.1|3666786_3668262_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_001295489.1|3668442_3669933_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	1.1e-08
>prophage 274
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3684687	3692793	5021692	tRNA	Staphylococcus_phage(33.33%)	8	NA	NA
WP_000758422.1|3684687_3686373_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
WP_000268230.1|3686577_3687159_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001220979.1|3687198_3687894_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128847.1|3687951_3689862_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001295493.1|3689993_3690338_+	RidA family protein	NA	NA	NA	NA	NA
WP_001300615.1|3690699_3691059_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457334.1|3691178_3691358_-	YoaH family protein	NA	NA	NA	NA	NA
WP_000854972.1|3691431_3692793_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	3.4e-41
>prophage 275
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3696655	3698212	5021692		Moraxella_phage(100.0%)	1	NA	NA
WP_000394983.1|3696655_3698212_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 276
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3703853	3704063	5021692		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|3703853_3704063_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 277
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3709394	3711443	5021692		Moraxella_phage(100.0%)	1	NA	NA
WP_001315679.1|3709394_3711443_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
>prophage 278
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3718939	3723409	5021692		Escherichia_phage(33.33%)	7	NA	NA
WP_000812724.1|3718939_3719596_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
WP_000976492.1|3719991_3720333_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879280.1|3720345_3721218_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000204699.1|3721221_3721596_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|3721734_3721965_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011658.1|3722066_3722723_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|3722746_3723409_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
>prophage 279
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3731465	3732941	5021692		Cyanophage(100.0%)	1	NA	NA
WP_000301727.1|3731465_3732941_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
>prophage 280
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3736939	3744003	5021692		Bacillus_virus(50.0%)	9	NA	NA
WP_001184045.1|3736939_3738262_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001342995.1|3738277_3739210_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|3739288_3740044_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571479.1|3740040_3740826_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|3740972_3741983_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|3741991_3742603_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_072094247.1|3742741_3742807_-	stress response small protein YobI	NA	NA	NA	NA	NA
WP_040090020.1|3742877_3743480_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|3743481_3744003_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
>prophage 281
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3748021	3750072	5021692		Escherichia_coli_phage(50.0%)	3	NA	NA
WP_000639274.1|3748021_3748840_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_000252979.1|3748892_3749288_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_000019588.1|3749328_3750072_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
>prophage 282
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3756688	3758422	5021692	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001025326.1|3756688_3758422_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
>prophage 283
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3763674	3769318	5021692		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_000763867.1|3763674_3764064_-	chemotaxis response regulator CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036378.1|3764078_3765128_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204335.1|3765130_3765991_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483202.1|3766009_3767611_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.7	4.9e-15
WP_001297437.1|3767656_3769318_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
>prophage 284
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3779405	3780920	5021692		Cedratvirus(100.0%)	1	NA	NA
WP_001187810.1|3779405_3780920_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
>prophage 285
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3792910	3793663	5021692		Bacillus_virus(100.0%)	1	NA	NA
WP_001272994.1|3792910_3793663_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
>prophage 286
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3805478	3807398	5021692	transposase	uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_023568750.1|3805478_3806150_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.9	4.8e-81
WP_062868572.1|3806189_3807398_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	94.0	5.8e-210
>prophage 287
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3824629	3837063	5021692		Bacillus_phage(28.57%)	12	NA	NA
WP_001597912.1|3824629_3826324_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000009306.1|3826561_3826744_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922682.1|3826822_3827740_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212226.1|3827912_3828833_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000786005.1|3828821_3829292_-	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	2.0e-33
WP_001157239.1|3829272_3830691_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	3.0e-101
WP_000365562.1|3830757_3831453_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.8e-07
WP_073488231.1|3831492_3831858_-	permease	NA	NA	NA	NA	NA
WP_000824370.1|3832424_3833483_+	porin	NA	Q1MVN1	Enterobacteria_phage	49.3	1.1e-92
WP_000218210.1|3834074_3834926_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_073488234.1|3835033_3836392_-	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.5	6.6e-05
WP_001339045.1|3836391_3837063_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
>prophage 288
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3840607	3841138	5021692		Escherichia_phage(100.0%)	1	NA	NA
WP_072662174.1|3840607_3841138_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
>prophage 289
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3867723	3868890	5021692		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000830171.1|3867723_3868890_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	98.5	2.7e-225
>prophage 290
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3876534	3877434	5021692		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131782.1|3876534_3877434_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 291
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3885937	3900771	5021692		uncultured_virus(16.67%)	9	NA	NA
WP_073488257.1|3885937_3889579_-	glycosyltransferase	NA	A0A218MKE2	uncultured_virus	29.3	9.4e-22
WP_061344091.1|3889581_3890859_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_073488260.1|3890858_3892073_-	O8 family O-antigen ABC transporter ATP-binding protein Wzt	NA	A0A2H4PQG7	Staphylococcus_phage	26.5	7.0e-14
WP_001308747.1|3892072_3892867_-	O8 family O-antigen ABC transporter permease subunit Wzm	NA	NA	NA	NA	NA
WP_000192839.1|3892868_3894245_-	O9 family phosphomannomutase RfbK2	NA	A0A127AWJ1	Bacillus_phage	26.4	1.1e-31
WP_021552341.1|3894268_3895684_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.3	1.2e-52
WP_073488262.1|3896825_3897803_-	LPS O-antigen chain length determinant protein WzzB	NA	NA	NA	NA	NA
WP_047644718.1|3897949_3899116_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.5	1.5e-114
WP_073488265.1|3899364_3900771_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.4e-37
>prophage 292
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3906022	3911172	5021692		Streptococcus_phage(33.33%)	4	NA	NA
WP_073488284.1|3906022_3907117_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	65.1	1.4e-141
WP_077897293.1|3907127_3908375_-	O96 family O-antigen flippase	NA	NA	NA	NA	NA
WP_044067113.1|3908709_3909603_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	2.3e-46
WP_073488290.1|3909777_3911172_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	3.7e-19
>prophage 293
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3916980	3923774	5021692		Bacillus_phage(25.0%)	6	NA	NA
WP_001356294.1|3916980_3918351_-	colanic acid biosynthesis phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.5	1.7e-32
WP_000079285.1|3918543_3919980_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	1.3e-46
WP_047660110.1|3919982_3921206_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_001298845.1|3921202_3921682_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000043623.1|3921684_3922650_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	9.9e-88
WP_000048190.1|3922652_3923774_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
>prophage 294
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3928017	3938493	5021692		uncultured_marine_virus(20.0%)	9	NA	NA
WP_000654503.1|3928017_3928857_-	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	9.7e-07
WP_073488293.1|3929034_3931197_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_000482901.1|3931199_3931643_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000978094.1|3931648_3932788_-	polysaccharide export protein Wza	NA	NA	NA	NA	NA
WP_162829205.1|3933096_3933246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000454701.1|3933446_3935030_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_001252331.1|3935303_3937157_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001234767.1|3937178_3937760_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_001295424.1|3937851_3938493_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
>prophage 295
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3943156	3944509	5021692		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_032278529.1|3943156_3944509_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	21.3	8.3e-08
>prophage 296
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3954748	3965447	5021692	integrase,lysis,tail	Enterobacteria_phage(72.73%)	12	3943246:3943259	3968669:3968682
3943246:3943259	attL	CAGCACGCTGCTGC	NA	NA	NA	NA
WP_039264499.1|3954748_3955333_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.4	7.0e-105
WP_071885001.1|3955332_3958683_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_039264501.1|3959825_3960008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039264502.1|3960106_3960481_-	hypothetical protein	NA	M1FPD9	Enterobacteria_phage	81.5	4.6e-49
WP_039264503.1|3960519_3960963_-|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	96.6	2.4e-73
WP_000041317.1|3961628_3962111_+	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	98.8	1.4e-79
WP_024239663.1|3962122_3962437_+	hypothetical protein	NA	K7PLT4	Enterobacteria_phage	99.0	5.9e-50
WP_024215524.1|3962453_3962735_+	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	98.9	3.3e-44
WP_039264504.1|3962731_3962899_+	DUF2737 family protein	NA	Q716F2	Shigella_phage	92.7	1.8e-21
WP_039264505.1|3963029_3963728_+	DUF1311 domain-containing protein	NA	J9Q6K3	Salmonella_phage	83.2	3.9e-102
WP_039264506.1|3964177_3964396_+	excisionase	NA	Q77WA4	Escherichia_phage	98.6	2.4e-34
WP_073488306.1|3964373_3965447_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	96.9	1.0e-194
3968669:3968682	attR	CAGCACGCTGCTGC	NA	NA	NA	NA
>prophage 297
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3974650	3981524	5021692	tRNA	Bacillus_phage(50.0%)	8	NA	NA
WP_000675150.1|3974650_3976054_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
WP_000137873.1|3976050_3976773_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.9e-30
WP_000929408.1|3976963_3977296_+	YegP family protein	NA	NA	NA	NA	NA
WP_001307279.1|3977504_3977801_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_001220181.1|3977802_3978099_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000476011.1|3978201_3979563_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
WP_000716757.1|3979892_3980210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807362.1|3980624_3981524_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
>prophage 298
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	3990746	3991751	5021692		Serratia_phage(100.0%)	1	NA	NA
WP_000846218.1|3990746_3991751_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	1.3e-13
>prophage 299
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	4004949	4006983	5021692	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001295427.1|4004949_4006983_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 300
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	4019494	4028935	5021692		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001349937.1|4019494_4020631_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
WP_001349936.1|4020627_4022628_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.6	0.0e+00
WP_001295429.1|4022752_4023214_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_000950409.1|4023253_4023724_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_000598641.1|4023770_4024490_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|4024486_4026172_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|4026393_4027125_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|4027184_4027292_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|4027272_4028004_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569361.1|4028008_4028935_-	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	5.7e-08
>prophage 301
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	4049250	4050771	5021692		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255016.1|4049250_4050771_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	32.4	7.7e-10
>prophage 302
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	4054465	4058251	5021692		Cellulophaga_phage(50.0%)	3	NA	NA
WP_001139613.1|4054465_4055134_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
WP_000425438.1|4055391_4056228_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000489247.1|4056259_4058251_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.0e-13
>prophage 303
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	4062320	4063178	5021692		Catovirus(100.0%)	1	NA	NA
WP_000873890.1|4062320_4063178_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	34.0	1.4e-24
>prophage 304
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	4077709	4082010	5021692		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_000848211.1|4077709_4079176_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.3	2.3e-43
WP_000198822.1|4079293_4080280_+	zinc-binding GTPase YeiR	NA	NA	NA	NA	NA
WP_001298785.1|4080318_4081032_+	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000241011.1|4081443_4082010_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
>prophage 305
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	4087764	4095412	5021692		Vibrio_phage(50.0%)	7	NA	NA
WP_040090033.1|4087764_4089354_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	33.6	3.2e-19
WP_000202798.1|4089357_4089702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213375.1|4090034_4091225_-	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	3.8e-20
WP_001234850.1|4091252_4091948_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578076.1|4092096_4093857_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	3.2e-100
WP_000494183.1|4093981_4094266_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000050789.1|4094404_4095412_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
>prophage 306
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	4107111	4107729	5021692		Bacillus_virus(100.0%)	1	NA	NA
WP_000888560.1|4107111_4107729_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
>prophage 307
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	4116610	4122409	5021692		Bacillus_phage(25.0%)	5	NA	NA
WP_040090262.1|4116610_4118254_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	7.2e-14
WP_001402359.1|4118329_4118980_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000710378.1|4118979_4120044_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	49.5	7.0e-18
WP_000406105.1|4120117_4121173_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865607.1|4121284_4122409_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.8	2.4e-117
>prophage 308
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	4126685	4131528	5021692		Hokovirus(50.0%)	2	NA	NA
WP_000876014.1|4126685_4129535_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
WP_001402361.1|4129701_4131528_+	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	26.5	5.8e-20
>prophage 309
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	4146451	4160520	5021692		Pseudomonas_phage(33.33%)	8	NA	NA
WP_001281242.1|4146451_4149079_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
WP_000990765.1|4149225_4149948_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_073488325.1|4150088_4153823_-	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	23.3	2.9e-18
WP_001075170.1|4154518_4156804_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.9e-283
WP_000332036.1|4156892_4158023_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
WP_000135040.1|4158022_4158277_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000301050.1|4158330_4158981_-	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000779084.1|4159443_4160520_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
>prophage 310
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	4166413	4167316	5021692	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000140570.1|4166413_4167316_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	2.5e-69
>prophage 311
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	4170468	4175472	5021692		Tupanvirus(50.0%)	4	NA	NA
WP_001297077.1|4170468_4171071_-	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	3.4e-09
WP_001307305.1|4171378_4172518_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.8	1.1e-29
WP_000461657.1|4172521_4173490_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	8.8e-36
WP_000860245.1|4173489_4175472_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	1.8e-19
>prophage 312
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	4211804	4215032	5021692		Salmonella_phage(50.0%)	3	NA	NA
WP_000813848.1|4211804_4212404_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	37.3	5.9e-06
WP_001012899.1|4212462_4214295_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_040090252.1|4214381_4215032_-	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	34.3	5.2e-08
>prophage 313
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	4225592	4227453	5021692		Sodalis_phage(50.0%)	2	NA	NA
WP_000156111.1|4225592_4226483_-	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	44.5	1.4e-67
WP_001293612.1|4226679_4227453_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
>prophage 314
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	4231664	4233182	5021692		Mollivirus(100.0%)	1	NA	NA
WP_000334220.1|4231664_4233182_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
>prophage 315
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	4239658	4240795	5021692		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699122.1|4239658_4240795_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
>prophage 316
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	4249331	4250417	5021692		Pandoravirus(100.0%)	1	NA	NA
WP_000918470.1|4249331_4250417_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
>prophage 317
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	4268300	4270702	5021692	integrase	Enterobacteria_phage(100.0%)	2	4268412:4268425	4275777:4275790
WP_000368131.1|4268300_4269233_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
4268412:4268425	attL	ATGGCAATTCATGA	NA	NA	NA	NA
WP_000958693.1|4269544_4270702_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	98.7	6.5e-219
WP_000958693.1|4269544_4270702_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	98.7	6.5e-219
4275777:4275790	attR	ATGGCAATTCATGA	NA	NA	NA	NA
>prophage 318
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	4274933	4279748	5021692		Bacillus_phage(33.33%)	4	NA	NA
WP_000586224.1|4274933_4276265_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	35.4	9.3e-20
WP_000711110.1|4277100_4277631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001281184.1|4279067_4279412_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	93.9	9.4e-57
WP_001163428.1|4279547_4279748_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
>prophage 319
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	4287611	4295188	5021692		Hokovirus(50.0%)	4	NA	NA
WP_001325644.1|4287611_4291205_+	acid-sensing system histidine kinase EvgS	NA	A0A1V0SGX0	Hokovirus	32.1	1.7e-36
WP_001296867.1|4291260_4292406_-	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_000955028.1|4292479_4293424_-	transporter YfdV	NA	NA	NA	NA	NA
WP_001283499.1|4293493_4295188_-	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.0e-23
>prophage 320
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	4298879	4299800	5021692		Morganella_phage(100.0%)	1	NA	NA
WP_000484404.1|4298879_4299800_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
>prophage 321
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	4303618	4304353	5021692		Clostridioides_phage(100.0%)	1	NA	NA
WP_001295458.1|4303618_4304353_+	two-component system response regulator YpdB	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 322
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	4326054	4341436	5021692		Streptococcus_phage(33.33%)	15	NA	NA
WP_000443665.1|4326054_4328070_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	6.5e-150
WP_001299866.1|4328140_4329139_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000254839.1|4329368_4330130_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_000034402.1|4330314_4331286_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000487600.1|4331669_4331927_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000623136.1|4331971_4333699_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000522247.1|4333739_4334249_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000096660.1|4334290_4335142_-	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000719943.1|4335246_4335615_+	YfeK family protein	NA	NA	NA	NA	NA
WP_001297645.1|4335617_4336529_-	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	3.5e-58
WP_000021040.1|4336662_4337760_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	39.4	2.8e-30
WP_000852686.1|4337749_4338625_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000458406.1|4338624_4339458_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000290223.1|4339457_4340474_-	thiosulfate/sulfate ABC transporter substrate-binding protein CysP	NA	NA	NA	NA	NA
WP_000517439.1|4340644_4341436_-	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.6	8.9e-18
>prophage 323
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	4344914	4349849	5021692		Mycobacterium_phage(33.33%)	6	NA	NA
WP_001299057.1|4344914_4346216_+	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	26.2	1.6e-08
WP_000084590.1|4346273_4347173_-	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_000838945.1|4347268_4347844_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_040090270.1|4347904_4348354_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000406000.1|4348340_4348766_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_000102891.1|4348979_4349849_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
>prophage 324
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	4368403	4369354	5021692		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|4368403_4369354_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 325
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	4387372	4388086	5021692		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|4387372_4388086_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 326
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	4409169	4413171	5021692		Enterobacteria_phage(33.33%)	4	NA	NA
WP_000198328.1|4409169_4410459_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
WP_001295473.1|4410544_4411171_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001295474.1|4411495_4412533_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
WP_001028614.1|4412532_4413171_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
>prophage 327
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	4419417	4425902	5021692		Escherichia_phage(66.67%)	7	NA	NA
WP_000017552.1|4419417_4419570_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
WP_000076001.1|4419587_4419779_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_001317257.1|4420089_4420608_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	8.5e-62
WP_000755173.1|4420623_4421163_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	100.0	3.4e-45
WP_000138282.1|4421257_4422835_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_001299507.1|4422903_4424370_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000937933.1|4424531_4425902_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	4.0e-42
>prophage 328
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	4429599	4549690	5021692	tail,tRNA,capsid,holin,integrase,portal,terminase,plate,head,protease	Shigella_phage(38.6%)	123	4463566:4463597	4544887:4544918
WP_001107167.1|4429599_4430874_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000551807.1|4430984_4432103_-	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_001090850.1|4432129_4433143_-	cytoskeleton protein RodZ	NA	NA	NA	NA	NA
WP_000003317.1|4433427_4434582_-|tRNA	bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN	tRNA	NA	NA	NA	NA
WP_000963837.1|4434731_4435163_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
WP_040090061.1|4435311_4437624_-	peptidoglycan glycosyltransferase PbpC	NA	NA	NA	NA	NA
WP_040090063.1|4437624_4442586_-	alpha2-macroglobulin	NA	NA	NA	NA	NA
WP_000108626.1|4442792_4443638_+	3-mercaptopyruvate sulfurtransferase	NA	NA	NA	NA	NA
WP_001297328.1|4444130_4444907_-	enhanced serine sensitivity protein SseB	NA	NA	NA	NA	NA
WP_000133579.1|4445048_4446332_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	2.9e-34
WP_000523616.1|4446509_4446710_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001124469.1|4446721_4447057_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_001196613.1|4447058_4448909_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_000384413.1|4448925_4449441_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_000028953.1|4449536_4449860_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000331707.1|4449876_4450263_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_021534450.1|4450290_4451505_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	6.7e-33
WP_001241357.1|4451616_4452105_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_000940019.1|4452374_4453115_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_000553451.1|4453233_4454037_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_001299515.1|4454181_4455036_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000983012.1|4455226_4456507_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_000244191.1|4456498_4457638_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_000423257.1|4457797_4458688_-	DNA-binding transcriptional regulator HcaR	NA	NA	NA	NA	NA
WP_000211172.1|4458823_4460185_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_001276076.1|4460181_4460700_+	3-phenylpropionate/cinnamic acid dioxygenase subunit beta	NA	NA	NA	NA	NA
WP_001080102.1|4460699_4461020_+	bifunctional 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_040090065.1|4461016_4461829_+	3-phenylpropionate-dihydrodiol/cinnamic acid-dihydrodiol dehydrogenase	NA	NA	NA	NA	NA
WP_040090067.1|4461838_4463041_+	phenylpropionate dioxygenase ferredoxin reductase subunit	NA	NA	NA	NA	NA
WP_001094726.1|4463137_4463560_+	DoxX family protein	NA	NA	NA	NA	NA
4463566:4463597	attL	ATGCCGGATGCGGCGTGAACGCCTTATCCGGC	NA	NA	NA	NA
WP_000158547.1|4463607_4464480_-	aldose 1-epimerase	NA	NA	NA	NA	NA
WP_000700809.1|4464491_4465586_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_001276691.1|4465618_4466617_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_040090070.1|4466641_4468153_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	28.9	2.5e-08
WP_001124889.1|4468175_4469159_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001351417.1|4469255_4472537_-	DUF5107 domain-containing protein	NA	NA	NA	NA	NA
WP_001299519.1|4472654_4473848_+	ROK family protein	NA	NA	NA	NA	NA
WP_000919159.1|4474045_4475299_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
WP_000883122.1|4475626_4476817_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000717694.1|4476861_4477200_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_001295369.1|4477260_4478595_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_001215861.1|4478584_4479298_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001297612.1|4479462_4480890_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
WP_040090073.1|4481465_4485353_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.2	7.7e-131
WP_000734193.1|4485610_4487167_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_001295367.1|4487163_4487700_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000190655.1|4487724_4488360_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001013779.1|4488568_4489417_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_073488341.1|4490293_4491139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073488344.1|4491143_4491458_-	recombinase family protein	NA	M1T2R9	Escherichia_phage	92.1	3.3e-40
WP_073488348.1|4491487_4491898_+|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	77.4	3.7e-52
WP_073488353.1|4491918_4492362_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	95.2	1.3e-79
WP_073488356.1|4492333_4492750_-|tail	tail fiber assembly protein	tail	A0A0M4S6V4	Salmonella_phage	53.9	4.1e-14
WP_000383540.1|4493420_4494005_-	YmfQ family protein	NA	O22003	Shigella_phage	99.0	7.0e-113
WP_000785299.1|4493995_4495054_-|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.9	3.6e-200
WP_000424732.1|4495040_4495466_-	phage GP46 family protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_001259088.1|4495465_4496014_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	98.4	3.3e-96
WP_000999503.1|4496013_4497093_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	3.4e-206
WP_021542892.1|4497089_4498418_-	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	99.5	3.8e-247
WP_000679479.1|4498479_4499010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073488359.1|4499101_4500934_-|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	98.2	6.7e-303
WP_000661047.1|4501075_4501345_-|tail	phage tail assembly protein	tail	S5FNR3	Shigella_phage	100.0	3.5e-43
WP_000090998.1|4501344_4501701_-|tail	phage tail tube protein	tail	U5P076	Shigella_phage	100.0	5.3e-63
WP_073488362.1|4501700_4503197_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	S5FKL0	Shigella_phage	98.6	9.8e-276
WP_032225398.1|4503180_4503351_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	98.2	3.5e-25
WP_021549522.1|4503359_4503920_-	hypothetical protein	NA	S5FM61	Shigella_phage	99.5	1.4e-105
WP_073488365.1|4503916_4504423_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	99.4	2.5e-90
WP_000702388.1|4504397_4504808_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	97.8	5.9e-74
WP_000927711.1|4504804_4505128_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000601360.1|4505130_4505331_-	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
WP_073488368.1|4505379_4506585_-|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.5	9.1e-224
WP_001193633.1|4506599_4507250_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	99.5	7.3e-119
WP_000466255.1|4507227_4508469_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_000605606.1|4508468_4508651_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_072011717.1|4508662_4510159_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.8	7.4e-300
WP_000929175.1|4510392_4510887_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	99.4	3.9e-88
WP_073488371.1|4511012_4511363_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	2.0e-62
WP_001446386.1|4511546_4511939_-	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	87.7	1.7e-54
WP_073488375.1|4511922_4512399_-	glycoside hydrolase family protein	NA	S5FV07	Shigella_phage	96.8	1.2e-86
WP_000781776.1|4512402_4512744_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	91.9	2.8e-53
WP_001174014.1|4513189_4513531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001244506.1|4513562_4513985_-	antitermination protein	NA	Q8W638	Enterobacteria_phage	63.3	8.8e-41
WP_000034494.1|4514010_4514301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073488379.1|4514618_4516880_-	bifunctional DNA primase/polymerase	NA	NA	NA	NA	NA
WP_073488382.1|4516872_4517055_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000606440.1|4517168_4517861_+	helix-turn-helix transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	48.5	3.8e-57
WP_000801965.1|4518508_4518658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073488388.1|4518654_4519557_+	hypothetical protein	NA	Q3LZP9	Bacteriophage	54.4	6.1e-07
WP_073488391.1|4519559_4520861_+	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	55.7	1.0e-132
WP_000769005.1|4520876_4521425_+	DUF2815 family protein	NA	Q775A5	Bordetella_phage	65.9	2.1e-66
WP_042106501.1|4521477_4522116_+	hypothetical protein	NA	H6WRY3	Salmonella_phage	69.3	1.7e-72
WP_000490740.1|4522183_4522453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073488393.1|4522509_4524573_+	DNA polymerase	NA	Q775A3	Bordetella_phage	67.2	1.5e-274
WP_073488396.1|4524637_4525399_+	nucleotide-binding protein	NA	NA	NA	NA	NA
WP_000065111.1|4525633_4525828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000312942.1|4525827_4526115_+	VRR-NUC domain-containing protein	NA	B6SD64	Bacteriophage	66.3	4.5e-28
WP_001127518.1|4526127_4526925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077897296.1|4526998_4528393_+	DEAD/DEAH box helicase	NA	Q3LZN8	Bacteriophage	73.1	1.6e-208
WP_001291430.1|4528389_4528590_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_042043893.1|4528586_4529984_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000054752.1|4530198_4530459_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	4.9e-18
WP_000128776.1|4530652_4530733_-	type I toxin-antitoxin system toxin ShoB	NA	NA	NA	NA	NA
WP_000986029.1|4531152_4531533_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001297412.1|4531532_4532264_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000399393.1|4532275_4533004_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000020737.1|4533015_4533921_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068343.1|4533917_4534598_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000002542.1|4534870_4535845_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790168.1|4535860_4537660_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000589070.1|4537857_4538337_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000812053.1|4538333_4539290_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_001168459.1|4539289_4539940_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_001295364.1|4539972_4540548_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001303621.1|4540544_4540700_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_001094499.1|4540955_4542578_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_040090074.1|4542562_4543300_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|4543431_4544766_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_024251376.1|4544974_4545856_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
4544887:4544918	attR	GCCGGATAAGGCGTTCACGCCGCATCCGGCAT	NA	NA	NA	NA
WP_000189207.1|4545958_4546546_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627804.1|4546601_4546985_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_001262723.1|4547289_4547979_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.1e-55
WP_000997403.1|4548026_4549064_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|4549270_4549690_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
>prophage 329
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	4554983	4556282	5021692		Burkholderia_virus(100.0%)	1	NA	NA
WP_000841103.1|4554983_4556282_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
>prophage 330
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	4562141	4564715	5021692		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001235102.1|4562141_4564715_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 331
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	4570621	4571692	5021692		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001168054.1|4570621_4571692_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	5.3e-90
>prophage 332
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	4585326	4585809	5021692		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000162574.1|4585326_4585809_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 333
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	4591452	4591671	5021692		Salmonella_phage(100.0%)	1	NA	NA
WP_072017180.1|4591452_4591671_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	70.0	2.7e-09
>prophage 334
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	4601121	4605173	5021692		Klosneuvirus(50.0%)	4	NA	NA
WP_000097660.1|4601121_4602402_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	1.4e-33
WP_040089843.1|4602639_4604040_+	GABA permease	NA	NA	NA	NA	NA
WP_000156811.1|4604060_4604723_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000522415.1|4604723_4605173_-	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
>prophage 335
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	4609108	4614404	5021692		Oenococcus_phage(20.0%)	5	NA	NA
WP_001223227.1|4609108_4609354_+	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_000080947.1|4609350_4609761_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_040089844.1|4609733_4611878_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.4	6.4e-196
WP_032267313.1|4611887_4612847_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.5	1.7e-132
WP_000985494.1|4613201_4614404_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
>prophage 336
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	4629512	4634898	5021692	tRNA	Vibrio_phage(25.0%)	5	NA	NA
WP_000906486.1|4629512_4629698_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000047176.1|4629932_4632563_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000140508.1|4632690_4633191_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000963143.1|4633259_4634321_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000132234.1|4634400_4634898_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	50.3	1.5e-31
>prophage 337
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	4640364	4641330	5021692		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287410.1|4640364_4641330_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	2.3e-36
>prophage 338
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	4648805	4649816	5021692		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001363554.1|4648805_4649816_-	DNA-binding transcriptional regulator AscG	NA	C6ZCU4	Enterobacteria_phage	28.0	2.3e-26
>prophage 339
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	4668887	4676027	5021692		Escherichia_phage(83.33%)	6	NA	NA
WP_040089848.1|4668887_4671449_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.9e-30
WP_001141330.1|4671554_4672211_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_001297141.1|4672261_4673029_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|4673224_4674133_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|4674129_4675392_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|4675388_4676027_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 340
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	4681241	4684957	5021692		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000081550.1|4681241_4682234_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_073488423.1|4682296_4683436_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	2.3e-06
WP_000254708.1|4683575_4684202_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|4684195_4684957_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 341
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	4688069	4690102	5021692		Tupanvirus(50.0%)	2	NA	NA
WP_001173673.1|4688069_4688675_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
WP_001090348.1|4688674_4690102_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	2.2e-30
>prophage 342
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	4706431	4707217	5021692		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_040090613.1|4706431_4707217_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	2.9e-21
>prophage 343
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	4711628	4716548	5021692		Vibrio_phage(33.33%)	5	NA	NA
WP_001199973.1|4711628_4712300_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
WP_001288227.1|4712438_4712579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040090406.1|4712592_4713465_+	YgcG family protein	NA	NA	NA	NA	NA
WP_000036723.1|4713524_4714823_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_000210878.1|4714910_4716548_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
>prophage 344
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	4720580	4724695	5021692		Erysipelothrix_phage(50.0%)	2	NA	NA
WP_000046821.1|4720580_4721882_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.7	2.6e-38
WP_000186450.1|4721938_4724695_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
>prophage 345
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	4732229	4733078	5021692		Vibrio_phage(100.0%)	1	NA	NA
WP_000100394.1|4732229_4733078_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.1	1.0e-40
>prophage 346
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	4737936	4738692	5021692		Bacillus_phage(100.0%)	1	NA	NA
WP_000268232.1|4737936_4738692_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	5.0e-10
>prophage 347
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	4750218	4765604	5021692	tRNA	environmental_halophage(16.67%)	9	NA	NA
WP_001299897.1|4750218_4751424_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.8	1.7e-73
WP_000184265.1|4751423_4751867_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_000117728.1|4751917_4752724_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.2e-16
WP_000678646.1|4752800_4753898_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000016907.1|4754476_4755730_-	N-acetylmuramoyl-L-alanine amidase AmiC	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000237947.1|4755961_4757293_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_024245354.1|4757354_4759181_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.5	7.8e-25
WP_001367545.1|4759180_4762723_-	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	21.6	1.5e-08
WP_001138197.1|4762715_4765604_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.7	5.3e-68
>prophage 348
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	4771081	4777854	5021692		Geobacillus_virus(33.33%)	6	NA	NA
WP_000816232.1|4771081_4771876_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
WP_000204658.1|4771882_4772758_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000957914.1|4772908_4775155_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000564489.1|4775167_4775698_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000082188.1|4776382_4777072_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000895624.1|4777140_4777854_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
>prophage 349
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	4787484	4789979	5021692		Aichi_virus(50.0%)	2	NA	NA
WP_000256438.1|4787484_4788903_-	arabinose-proton symporter AraE	NA	O13311	Aichi_virus	26.9	1.8e-24
WP_000603518.1|4789217_4789979_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
>prophage 350
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	4812806	4813562	5021692		Clostridium_phage(100.0%)	1	NA	NA
WP_001272558.1|4812806_4813562_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 351
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	4837841	4853233	5021692	tRNA	environmental_Halophage(14.29%)	14	NA	NA
WP_001280192.1|4837841_4839242_+	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
WP_001295158.1|4839259_4840576_+	guanine deaminase	NA	NA	NA	NA	NA
WP_000012163.1|4840611_4841979_+	guanine/hypoxanthine transporter GhxQ	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
WP_000838428.1|4842014_4842503_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_001355763.1|4842502_4844422_-	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_001295374.1|4844857_4846306_+	urate/proton symporter UacT	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_001050745.1|4846307_4846433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795390.1|4846429_4846501_-	protein YqfH	NA	NA	NA	NA	NA
WP_001192803.1|4846555_4847104_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_000003068.1|4847146_4848664_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001701073.1|4848673_4849772_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000813212.1|4849862_4851596_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.5	3.2e-60
WP_000715214.1|4851601_4852312_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000806638.1|4852336_4853233_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
>prophage 352
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	4857157	4862525	5021692		Pandoravirus(50.0%)	3	NA	NA
WP_001307385.1|4857157_4858591_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.9	5.7e-31
WP_000951964.1|4858647_4859391_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000195061.1|4859651_4862525_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.0	3.7e-263
>prophage 353
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	4871052	4872285	5021692		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|4871052_4872285_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 354
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	4890291	4890969	5021692		Bacillus_virus(100.0%)	1	NA	NA
WP_000956883.1|4890291_4890969_+	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.6	4.9e-09
>prophage 355
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	4906138	4985730	5021692	integrase,transposase,tRNA,protease	Stx2-converting_phage(33.33%)	63	4905293:4905309	4990829:4990845
4905293:4905309	attL	CACCGTGTTCGCCCGCT	NA	NA	NA	NA
WP_001062128.1|4906138_4907293_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001112301.1|4907728_4909123_+	galactose/proton symporter	NA	NA	NA	NA	NA
WP_000858396.1|4909199_4909697_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286500.1|4909791_4910499_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001222508.1|4910578_4911310_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593273.1|4911322_4912273_+	glutathione synthase	NA	NA	NA	NA	NA
WP_001053178.1|4912381_4912945_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017111.1|4912944_4913361_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001055620.1|4913536_4914517_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|4914534_4915239_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|4915256_4915823_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277222.1|4915819_4916110_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174735.1|4916117_4916711_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239917.1|4916703_4917840_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000784004.1|4918155_4919142_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_073488433.1|4919186_4919690_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_000378945.1|4919689_4920991_+	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_000745217.1|4921046_4922054_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394125.1|4922170_4923217_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|4923392_4924112_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001107564.1|4924295_4924622_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|4924621_4925341_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001297399.1|4925501_4926554_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|4926581_4926857_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001298916.1|4926921_4928001_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001049791.1|4928202_4929459_+	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_000839749.1|4929508_4931644_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234529.1|4932041_4932749_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001218891.1|4933127_4934390_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	43.2	6.0e-85
WP_001147376.1|4934792_4935107_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000691357.1|4935237_4936893_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000646536.1|4937408_4938482_+	zinc-dependent alcohol dehydrogenase family protein	NA	E3SJ82	Synechococcus_phage	25.1	1.9e-15
WP_000071967.1|4938725_4939958_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	33.7	1.1e-59
WP_000502746.1|4939942_4940581_+	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	53.7	4.3e-55
WP_001172030.1|4940617_4940902_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_077897299.1|4941718_4944319_+	YadA-like family protein	NA	NA	NA	NA	NA
WP_100224580.1|4944459_4945197_+	OmpA family protein	NA	NA	NA	NA	NA
WP_071985325.1|4945298_4945607_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000188069.1|4946263_4947124_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000024634.1|4948639_4949548_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000194232.1|4949674_4951033_+	aromatic acid/H+ symport family MFS transporter	NA	NA	NA	NA	NA
WP_000131613.1|4951044_4952073_+	gentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_000196046.1|4952088_4952790_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_000781200.1|4952798_4953443_+	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_000170152.1|4953457_4954651_+	3-hydroxybenzoate 6-monooxygenase	NA	NA	NA	NA	NA
WP_001043704.1|4955281_4956523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001443000.1|4959071_4959620_+	hypothetical protein	NA	A0A2K5B255	Erysipelothrix_phage	60.2	4.5e-53
WP_000188069.1|4961017_4961878_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000399477.1|4963248_4964607_-	YhfT family protein	NA	NA	NA	NA	NA
WP_000673766.1|4964616_4964979_-	DUF2620 domain-containing protein	NA	NA	NA	NA	NA
WP_040075933.1|4965046_4965934_-	phosphotriesterase-related protein	NA	NA	NA	NA	NA
WP_040091413.1|4965930_4967157_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_073488441.1|4967157_4968321_-	YhfX family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_073488445.1|4968404_4968767_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_000624639.1|4973776_4974127_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	1.5e-38
WP_089567729.1|4974199_4975412_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_040074327.1|4976009_4977611_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	62.5	3.7e-148
WP_089519923.1|4977630_4977813_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_040074325.1|4978087_4979107_-|transposase	IS110-like element ISEc11 family transposase	transposase	NA	NA	NA	NA
WP_040076195.1|4979416_4980091_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	33.1	2.0e-10
WP_001491303.1|4980803_4982126_-	MFS transporter family glucose-6-phosphate receptor UhpC	NA	NA	NA	NA	NA
WP_089576493.1|4982434_4983596_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	1.2e-50
WP_000631641.1|4985382_4985730_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	1.7e-42
4990829:4990845	attR	AGCGGGCGAACACGGTG	NA	NA	NA	NA
>prophage 356
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	4995362	5001119	5021692		Paramecium_bursaria_Chlorella_virus(50.0%)	4	NA	NA
WP_000082086.1|4995362_4996910_-	sugar ABC transporter ATP-binding protein	NA	M1I2G3	Paramecium_bursaria_Chlorella_virus	22.0	1.8e-06
WP_000733503.1|4996961_4997891_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000481794.1|4997922_4998909_-	inositol 2-dehydrogenase	NA	NA	NA	NA	NA
WP_040074780.1|4999193_5001119_-	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing)	NA	E5EQ70	Micromonas_sp._RCC1109_virus	23.0	4.8e-25
>prophage 357
NZ_CP010132	Escherichia coli strain C10 chromosome, complete genome	5021692	5010475	5020255	5021692	tRNA	Moraxella_phage(100.0%)	1	NA	NA
WP_073488454.1|5010475_5020255_-|tRNA	contact-dependent inhibition effector tRNA nuclease	tRNA	A0A0R6PJK4	Moraxella_phage	36.5	1.6e-28
