The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010151	Escherichia coli strain D8 chromosome, complete genome	5130646	269584	280073	5130646		Escherichia_phage(62.5%)	9	NA	NA
WP_001278992.1|269584_270223_-	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.8e-82
WP_000590416.1|270219_271482_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	6.3e-135
WP_000847998.1|271478_272387_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	5.1e-118
WP_001298167.1|272582_273350_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	2.2e-69
WP_001141304.1|273400_274057_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.6	8.6e-51
WP_001467843.1|274162_276730_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.2e-31
WP_000784515.1|276876_278334_+	hypothetical protein	NA	A0A0R6PGY7	Moraxella_phage	28.1	4.4e-23
WP_001272879.1|278345_278930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020904.1|279089_280073_+	hypothetical protein	NA	Q2P9W8	Enterobacteria_phage	22.0	5.7e-06
>prophage 2
NZ_CP010151	Escherichia coli strain D8 chromosome, complete genome	5130646	966190	972500	5130646		Enterobacteria_phage(50.0%)	6	NA	NA
WP_001116060.1|966190_967585_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	6.3e-19
WP_000183060.1|967759_968653_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_000699425.1|969025_970111_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.1e-100
WP_001023615.1|970110_971010_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.2	7.4e-29
WP_000857506.1|971068_971947_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	2.3e-107
WP_001100788.1|971951_972500_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.6	1.2e-50
>prophage 3
NZ_CP010151	Escherichia coli strain D8 chromosome, complete genome	5130646	1904427	1949686	5130646	tail,portal,integrase,lysis,terminase,capsid,protease,head	Enterobacteria_phage(52.38%)	68	1906621:1906634	1950023:1950036
WP_000654167.1|1904427_1904706_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	56.5	7.6e-25
WP_000290543.1|1904702_1906763_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M194	Enterobacteria_phage	53.4	2.0e-125
1906621:1906634	attL	CGTCCGGCTTCATC	NA	NA	NA	NA
WP_000515327.1|1906821_1910304_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.5	0.0e+00
WP_000090917.1|1910364_1910997_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_000140699.1|1910933_1911677_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.1e-147
WP_001152660.1|1911682_1912381_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	4.0e-131
WP_000847405.1|1912380_1912710_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	94.5	5.4e-54
WP_000840269.1|1912706_1915268_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	94.5	0.0e+00
WP_000459474.1|1915260_1915695_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	90.0	9.0e-57
WP_000479129.1|1915676_1916099_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	91.4	2.7e-66
WP_001351266.1|1916114_1916855_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	3.7e-127
WP_000683101.1|1916862_1917258_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	97.7	5.5e-69
WP_000975062.1|1917254_1917833_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	2.9e-79
WP_001204540.1|1917844_1918198_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	65.0	3.4e-38
WP_000201530.1|1918190_1918565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522648.1|1918616_1919645_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.6	5.9e-115
WP_000256840.1|1919702_1920050_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_001253913.1|1920086_1921592_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	3.6e-100
WP_000831761.1|1921581_1923174_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	4.2e-184
WP_000258997.1|1923170_1923377_-|head	phage head-stabilizing protein	head	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_001304453.1|1923360_1925289_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.7	3.3e-260
WP_000867568.1|1925260_1925809_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_000881610.1|1926371_1926554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000830178.1|1926760_1927087_-	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_001298464.1|1927567_1927861_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_001228695.1|1927951_1928134_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001135277.1|1928350_1928848_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_000839596.1|1928847_1929063_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737271.1|1929651_1930734_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_001204776.1|1930922_1931306_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	1.5e-55
WP_000971053.1|1931391_1931532_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	3.6e-07
WP_001099712.1|1931528_1931891_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000386643.1|1932097_1932439_-	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	96.5	1.6e-61
WP_001254243.1|1932441_1932618_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	96.6	3.3e-26
WP_000153286.1|1932614_1933142_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	4.7e-100
WP_000736913.1|1933138_1933579_-	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_000145927.1|1933652_1933943_-	protein ren	NA	O48423	Enterobacteria_phage	97.9	2.8e-46
WP_000788872.1|1933939_1934641_-	Replication protein 14	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	2.9e-129
WP_000185431.1|1934637_1935537_-	replication protein	NA	K7P7F0	Enterobacteria_phage	99.0	3.5e-172
WP_000442609.1|1935569_1935866_-	hypothetical protein	NA	G9L678	Escherichia_phage	94.9	2.2e-46
WP_000067727.1|1936007_1936223_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_001302016.1|1936298_1936994_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_001062368.1|1937033_1937591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000968518.1|1937587_1938340_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_000438342.1|1938616_1938799_+	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	98.3	1.1e-27
WP_000088199.1|1938776_1939049_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	2.8e-40
WP_001066176.1|1939065_1939647_-	superinfection exclusion B family protein	NA	K7P6T7	Enterobacteria_phage	92.2	5.2e-92
WP_000213979.1|1939860_1940061_+	antirestriction Ral family protein	NA	A0A0K2FJE6	Enterobacteria_phage	98.5	7.1e-33
WP_000065374.1|1940243_1940612_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_001198860.1|1940684_1940849_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_000372923.1|1940817_1940961_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	97.9	2.7e-18
WP_000995434.1|1941036_1941333_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	1.1e-48
WP_000100847.1|1941338_1942124_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186790.1|1942120_1942801_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.1	5.1e-131
WP_000149544.1|1942797_1942980_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000548537.1|1942952_1943144_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_000188870.1|1943220_1943436_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000763378.1|1943534_1943756_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	97.3	8.4e-35
WP_001289890.1|1943752_1944517_+	ead/Ea22-like family protein	NA	K7PKG8	Enterobacteria_phage	94.8	3.6e-56
WP_001518554.1|1944518_1944773_+	hypothetical protein	NA	A5LH60	Enterobacteria_phage	91.1	1.7e-34
WP_001327280.1|1944790_1945324_+	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	82.1	2.5e-64
WP_000951713.1|1945325_1945535_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	91.2	1.3e-32
WP_000208010.1|1945531_1946272_+	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	67.1	6.5e-47
WP_001304460.1|1946264_1946549_+	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	89.4	4.0e-45
WP_000490215.1|1946574_1946814_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	93.7	8.8e-38
WP_000088653.1|1946953_1947190_+	excisionase	NA	NA	NA	NA	NA
WP_000741334.1|1947179_1948322_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z02	Phage_21	99.7	1.1e-205
WP_000444487.1|1948435_1949686_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
1950023:1950036	attR	GATGAAGCCGGACG	NA	NA	NA	NA
>prophage 4
NZ_CP010151	Escherichia coli strain D8 chromosome, complete genome	5130646	2989431	3081260	5130646	transposase,bacteriocin,tail,portal,integrase,terminase,capsid,tRNA,protease,head	uncultured_Caudovirales_phage(40.0%)	89	3045079:3045097	3059609:3059627
WP_001298422.1|2989431_2990784_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_000922441.1|2990795_2991653_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_001295562.1|2991665_2992424_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
WP_000811911.1|2992612_2993809_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_000622418.1|2993900_2994458_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_000224573.1|2994607_2995333_-	UMP kinase	NA	NA	NA	NA	NA
WP_000818114.1|2995479_2996331_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_000246882.1|2996465_2997191_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_001018194.1|2997558_2998353_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_001094556.1|2998414_3001087_+	bifunctional uridylyltransferase/uridylyl-removing protein GlnD	NA	NA	NA	NA	NA
WP_001186656.1|3001117_3001942_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_000272188.1|3002259_3002646_+	DUF3461 family protein	NA	NA	NA	NA	NA
WP_000929436.1|3002698_3003856_-	DNA-binding transcriptional regulator CdaR	NA	NA	NA	NA	NA
WP_000753936.1|3004010_3005435_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	2.5e-26
WP_000057086.1|3005564_3007082_-	dGTPase	NA	NA	NA	NA	NA
WP_000689844.1|3007165_3007864_+	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_001129927.1|3007856_3008657_+	vitamin B12 ABC transporter substrate-binding protein BtuF	NA	NA	NA	NA	NA
WP_000964221.1|3008694_3009318_+	TRIC cation channel family protein	NA	NA	NA	NA	NA
WP_001295564.1|3009364_3009709_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
WP_120795373.1|3009701_3009767_-	protein YadW	NA	NA	NA	NA	NA
WP_000845407.1|3009790_3011212_-	H(+)/Cl(-) exchange transporter ClcA	NA	NA	NA	NA	NA
WP_000045295.1|3011436_3012717_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_000044117.1|3012751_3014734_-	Fe(3+)-hydroxamate ABC transporter permease FhuB	NA	NA	NA	NA	NA
WP_001468147.1|3014730_3015621_-	Fe(3+)-hydroxamate ABC transporter substrate-binding protein FhuD	NA	NA	NA	NA	NA
WP_001158929.1|3015620_3016418_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
WP_000035481.1|3016468_3018727_-	ferrichrome porin FhuA	NA	NA	NA	NA	NA
WP_000918139.1|3018946_3021481_-	bifunctional glycosyl transferase/transpeptidase	NA	NA	NA	NA	NA
WP_001356849.1|3021574_3024004_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	28.8	2.1e-41
WP_001294702.1|3024077_3024608_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_000396025.1|3024622_3025327_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001155227.1|3025504_3025960_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000937401.1|3025996_3026923_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_000174643.1|3026961_3028380_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
WP_000215151.1|3028376_3028856_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_001314434.1|3029218_3029809_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000465919.1|3029917_3030658_+	fimbrial chaperone	NA	NA	NA	NA	NA
WP_000153320.1|3030692_3033281_+	outer membrane usher protein	NA	NA	NA	NA	NA
WP_000591068.1|3033297_3033864_+	fimbrial protein	NA	NA	NA	NA	NA
WP_001534902.1|3033875_3034484_+	fimbrial-like protein YadL	NA	NA	NA	NA	NA
WP_001247914.1|3034510_3035107_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000688329.1|3035156_3036422_+	fimbrial-like adhesin	NA	NA	NA	NA	NA
WP_000805462.1|3036533_3037328_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_001468145.1|3037339_3038191_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_000404125.1|3038272_3038476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000339906.1|3038544_3039477_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	48.8	1.7e-60
WP_000621515.1|3039750_3040131_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_000277933.1|3040134_3041364_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000902003.1|3041427_3041868_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000972203.1|3041972_3042743_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000150638.1|3042739_3043666_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
WP_000651600.1|3043774_3044437_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000680691.1|3044477_3045014_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
3045079:3045097	attL	AGTGATACACCGAGTGATA	NA	NA	NA	NA
WP_032152087.1|3045585_3045870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074434940.1|3045875_3047537_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	82.5	9.8e-277
WP_001353110.1|3047520_3047877_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	83.8	6.1e-51
WP_001251187.1|3047996_3048182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145896.1|3048165_3048606_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	76.0	9.1e-65
WP_001287546.1|3048605_3048908_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	61.1	1.4e-27
WP_000270252.1|3048900_3050115_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	87.3	7.5e-210
WP_000798770.1|3050116_3050677_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	84.4	9.8e-88
WP_074434941.1|3050731_3051901_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	76.3	1.8e-163
WP_001145407.1|3052175_3052424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074434942.1|3052441_3052864_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000125509.1|3052860_3053106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074434943.1|3053393_3055211_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	50.7	1.5e-129
WP_001261489.1|3055207_3055507_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_074434944.1|3055513_3055834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_187661347.1|3055826_3056489_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_074434945.1|3056478_3057162_-	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	50.0	3.5e-23
WP_001165816.1|3057182_3057467_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_016236857.1|3057562_3058366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000929256.1|3058362_3059586_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	57.4	2.1e-135
WP_001314426.1|3059982_3062373_+	quinoprotein glucose dehydrogenase	NA	NA	NA	NA	NA
3059609:3059627	attR	AGTGATACACCGAGTGATA	NA	NA	NA	NA
WP_001189641.1|3062637_3064188_-	multicopper oxidase CueO	NA	NA	NA	NA	NA
WP_001295568.1|3064353_3064701_+	YacC family pilotin-like protein	NA	NA	NA	NA	NA
WP_000818414.1|3064806_3065673_+	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_000734290.1|3065688_3066483_+	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_000384306.1|3066520_3066883_-	YacL family protein	NA	NA	NA	NA	NA
WP_001295775.1|3067057_3069655_-	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
WP_001534899.1|3070008_3071766_+	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
WP_000102485.1|3072007_3073432_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
WP_000963543.1|3073639_3075532_-	pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_000003820.1|3075546_3078210_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_000331776.1|3078370_3079135_-	pyruvate dehydrogenase complex transcriptional repressor PdhR	NA	NA	NA	NA	NA
WP_000282228.1|3079590_3079881_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_020231867.1|3079881_3080121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000471926.1|3080278_3080572_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_001304492.1|3080574_3080811_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_001534896.1|3080969_3081260_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 5
NZ_CP010151	Escherichia coli strain D8 chromosome, complete genome	5130646	3522503	3582449	5130646	integrase,transposase,tRNA,protease	Vibrio_phage(16.67%)	58	3553590:3553606	3588625:3588641
WP_001468297.1|3522503_3522779_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001374875.1|3522895_3524521_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943955.1|3524604_3525768_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.2	1.8e-80
WP_000101637.1|3525770_3526409_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547753.1|3526418_3526817_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_001535770.1|3526834_3527494_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511955.1|3527543_3528242_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220142.1|3528260_3528662_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|3528788_3529520_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076323.1|3529610_3532052_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	4.9e-67
WP_001177639.1|3532090_3532516_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|3532720_3534019_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|3534122_3534320_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|3534401_3535406_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312481.1|3535408_3536668_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460357.1|3536753_3538034_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|3538109_3538418_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280356.1|3538503_3539454_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001468294.1|3539446_3541294_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	42.6	1.3e-59
WP_001535050.1|3541303_3542641_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_000981977.1|3542659_3543121_-|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_072190479.1|3543092_3544640_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_001294241.1|3544638_3545778_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_010723271.1|3545760_3545814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295188.1|3546556_3547102_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_000041976.1|3547196_3548249_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_000934911.1|3548345_3549314_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_074434958.1|3549335_3552659_+	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_001314359.1|3552809_3554312_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
3553590:3553606	attL	GGCAAAGTTCTTTTCTG	NA	NA	NA	NA
WP_000004771.1|3554530_3555508_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
WP_001192980.1|3555832_3557641_+	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000829498.1|3557633_3558368_+	fumarate reductase iron-sulfur protein	NA	NA	NA	NA	NA
WP_000208757.1|3558378_3558774_+	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_000609663.1|3558784_3559144_+	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_001298522.1|3559206_3560340_+	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_001238369.1|3560428_3560962_+	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
WP_000118482.1|3560958_3561276_-	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_000239596.1|3561451_3561598_-	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000977754.1|3561708_3561834_-	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000257278.1|3561885_3562452_-	elongation factor P	NA	NA	NA	NA	NA
WP_000940516.1|3562493_3563522_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_001008029.1|3563756_3564626_+	YjeJ family protein	NA	NA	NA	NA	NA
WP_000558209.1|3564675_3565029_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_000729117.1|3565166_3566813_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|3566856_3567150_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_001535766.1|3567425_3568682_+	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001267454.1|3568697_3569174_-	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000069437.1|3569510_3570947_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_000961959.1|3571064_3572366_+	anaerobic C4-dicarboxylate transporter DcuA	NA	NA	NA	NA	NA
WP_000883409.1|3572481_3572820_+	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000068943.1|3572795_3574493_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_001188520.1|3574529_3575105_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001608789.1|3575484_3576750_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.8	7.6e-80
WP_001608787.1|3577005_3578049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074434959.1|3578408_3579911_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_001608785.1|3580085_3580832_-	porin family protein	NA	NA	NA	NA	NA
WP_072141629.1|3581009_3581240_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_001608784.1|3581477_3582449_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
3588625:3588641	attR	CAGAAAAGAACTTTGCC	NA	NA	NA	NA
>prophage 6
NZ_CP010151	Escherichia coli strain D8 chromosome, complete genome	5130646	4305181	4318246	5130646	integrase	Morganella_phage(30.0%)	18	4294986:4294998	4318638:4318650
4294986:4294998	attL	GGCGGTCCAGTTC	NA	NA	NA	NA
WP_001536417.1|4305181_4306603_-	phage DNA ejection protein	NA	B6SCW4	Bacteriophage	53.0	1.3e-123
WP_000909175.1|4306602_4307280_-	hypothetical protein	NA	Q2A0B2	Sodalis_phage	71.6	9.2e-56
WP_001468271.1|4307273_4307735_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	71.5	2.9e-61
WP_001018524.1|4307751_4307913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001536416.1|4308497_4311254_-	TOPRIM and DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.0	1.5e-298
WP_001536415.1|4311240_4311612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001536413.1|4311604_4311946_-	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	60.6	4.6e-32
WP_001536412.1|4311956_4312559_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	36.3	5.7e-25
WP_000181940.1|4312551_4312773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024677.1|4312769_4313033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001065661.1|4313029_4313224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024188156.1|4313216_4314284_-	ash family protein	NA	A0A1C9IHV9	Salmonella_phage	44.1	5.7e-12
WP_000476150.1|4314277_4314460_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001019369.1|4314452_4315286_-	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	47.5	5.3e-21
WP_000412546.1|4315298_4315730_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	48.6	1.1e-27
WP_001090781.1|4315729_4315933_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000735991.1|4316045_4316891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001384863.1|4316986_4318246_-|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	78.1	5.1e-193
4318638:4318650	attR	GGCGGTCCAGTTC	NA	NA	NA	NA
>prophage 7
NZ_CP010151	Escherichia coli strain D8 chromosome, complete genome	5130646	4699511	4737152	5130646	tail,portal,integrase,terminase,capsid,tRNA,protease,head	uncultured_Caudovirales_phage(60.0%)	37	4722873:4722932	4738158:4738237
WP_000004425.1|4699511_4700459_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	39.5	2.5e-06
WP_000114984.1|4700473_4700983_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
WP_000228517.1|4701112_4702237_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_000460672.1|4702208_4702682_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_001312137.1|4702710_4703253_+	topoisomerase DNA-binding C4 zinc finger domain-containing protein	NA	NA	NA	NA	NA
WP_001468260.1|4703257_4703830_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_000451249.1|4703834_4704653_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_001070563.1|4704649_4704907_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_001286206.1|4704882_4705437_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_000078343.1|4711307_4712066_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.2e-19
WP_001350444.1|4712073_4713177_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_001298586.1|4713186_4714368_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000738577.1|4714435_4715461_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.5	6.9e-71
WP_000825647.1|4715891_4716113_-	membrane protein	NA	NA	NA	NA	NA
WP_001273183.1|4716365_4719470_-	multidrug efflux RND transporter permease subunit AcrF	NA	NA	NA	NA	NA
WP_000160352.1|4719481_4720639_-	multidrug efflux RND transporter periplasmic adaptor subunit AcrE	NA	NA	NA	NA	NA
WP_001129506.1|4721037_4721700_+	multidrug efflux transporter transcriptional repressor AcrS	NA	NA	NA	NA	NA
WP_001295275.1|4721702_4721882_-	DUF2556 family protein	NA	NA	NA	NA	NA
WP_001258937.1|4721965_4722850_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	2.1e-23
4722873:4722932	attL	ATAAAAAAGGCGCTTCCCCATGCCGAGTAGCGCCTTTTTAATCAAGCATTTAGCTAACCT	NA	NA	NA	NA
WP_021561896.1|4723127_4724351_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	87.2	3.8e-217
WP_001553506.1|4724347_4725085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001553505.1|4725174_4725396_+	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	61.8	3.2e-18
WP_074434979.1|4725404_4726451_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001113143.1|4726443_4726764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001261487.1|4726770_4727070_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_074434980.1|4727066_4728884_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	47.9	2.8e-128
WP_001122065.1|4729268_4729529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000365446.1|4729563_4730073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021561894.1|4730102_4730729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074434981.1|4731126_4732296_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	76.0	1.8e-163
WP_000798770.1|4732350_4732911_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	84.4	9.8e-88
WP_000270252.1|4732912_4734127_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	87.3	7.5e-210
WP_001287546.1|4734119_4734422_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	61.1	1.4e-27
WP_001145896.1|4734421_4734862_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	76.0	9.1e-65
WP_001251187.1|4734845_4735031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001353110.1|4735150_4735507_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	83.8	6.1e-51
WP_000127868.1|4735490_4737152_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	82.6	1.2e-277
4738158:4738237	attR	ATAAAAAAGGCGCTTCCCCATGCCGAGTAGCGCCTTTTTAATCAAGCATTTAGCTAACCTGAATTAGTTCATGCCGTATT	NA	NA	NA	NA
