The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010170	Escherichia coli strain H6 chromosome, complete genome	4832567	1217503	1230686	4832567		Escherichia_phage(50.0%)	12	NA	NA
WP_001295182.1|1217503_1218265_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|1218258_1218885_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272592.1|1219024_1220164_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|1220226_1221219_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104441.1|1221312_1222677_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136934.1|1222765_1223542_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|1223546_1224185_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590403.1|1224181_1225444_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_000847985.1|1225440_1226349_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001300386.1|1226544_1227312_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_001141322.1|1227362_1228019_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_001272898.1|1228124_1230686_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
>prophage 2
NZ_CP010170	Escherichia coli strain H6 chromosome, complete genome	4832567	1595592	1640990	4832567	holin,transposase,coat,portal,protease,terminase,integrase,lysis	Enterobacteria_phage(46.77%)	67	1600801:1600816	1639907:1639922
WP_032216024.1|1595592_1596573_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	3.0e-185
WP_149025522.1|1596582_1596762_+	multidrug transporter	NA	NA	NA	NA	NA
WP_000426427.1|1596869_1598198_-	D-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000556048.1|1598215_1599553_-	D-serine transporter DsdX	NA	NA	NA	NA	NA
WP_001300996.1|1599770_1600706_+	DNA-binding transcriptional regulator DsdC	NA	NA	NA	NA	NA
1600801:1600816	attL	ATGGTGTCCCCTGCAG	NA	NA	NA	NA
WP_001163428.1|1600889_1601090_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_073464407.1|1601214_1601559_-	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	99.1	4.5e-59
WP_073464408.1|1601631_1601916_-	RNA-binding protein	NA	A0A2D1GLL3	Escherichia_phage	94.7	4.2e-47
WP_073464410.1|1601908_1602664_-	hypothetical protein	NA	G8C7V0	Escherichia_phage	31.5	5.5e-09
WP_072018156.1|1603522_1603756_-	Lar family restriction alleviation protein	NA	NA	NA	NA	NA
WP_000812188.1|1603752_1604313_-	hypothetical protein	NA	Q76H44	Enterobacteria_phage	69.9	8.6e-60
WP_001214456.1|1604309_1604474_-	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	100.0	1.1e-23
WP_001111303.1|1604484_1604778_-	DUF2856 family protein	NA	K7P7E6	Enterobacteria_phage	100.0	5.0e-51
WP_000951334.1|1604801_1605185_-	hypothetical protein	NA	K7P6P8	Enterobacteria_phage	98.4	2.5e-66
WP_025866375.1|1605184_1605790_-	ERF family protein	NA	Q9MCQ9	Enterobacteria_phage	99.5	2.1e-107
WP_000050554.1|1605800_1605971_-	hypothetical protein	NA	K7PJW0	Enterobacteria_phage	100.0	3.0e-24
WP_073464412.1|1606046_1606199_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	98.0	1.4e-20
WP_000638547.1|1606183_1606315_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_063121024.1|1606339_1607308_-	hypothetical protein	NA	G5DA88	Enterobacteria_phage	100.0	7.7e-56
WP_001037043.1|1607440_1607599_-	hypothetical protein	NA	K7PMD4	Enterobacterial_phage	100.0	9.9e-22
WP_053878831.1|1607598_1607895_-	hypothetical protein	NA	K7PH98	Enterobacteria_phage	98.0	2.1e-49
WP_032353701.1|1607941_1608412_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	98.7	4.1e-87
WP_000915090.1|1608466_1608604_-	hypothetical protein	NA	Q716D9	Shigella_phage	100.0	1.3e-22
WP_073464414.1|1608612_1608999_-	antitermination protein	NA	Q716D8	Shigella_phage	99.1	3.4e-55
WP_016242500.1|1609279_1609975_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	96.1	8.3e-129
WP_059334175.1|1610050_1610266_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	97.2	2.4e-34
WP_001177653.1|1610385_1610664_+	lambda phage CII family protein	NA	Q8VNP9	Enterobacteria_phage	100.0	3.6e-43
WP_000166961.1|1610698_1610860_+	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_001608293.1|1610846_1611668_+	replication protein	NA	K7PJZ3	Enterobacterial_phage	99.6	2.0e-153
WP_073464416.1|1611664_1613041_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	99.6	2.2e-253
WP_000807325.1|1613113_1613320_+	hypothetical protein	NA	K7P7Y0	Enterobacteria_phage	97.1	6.9e-31
WP_000344553.1|1613337_1613622_+	hypothetical protein	NA	A0A2I6PIG0	Escherichia_phage	71.4	2.0e-33
WP_045172983.1|1613821_1614232_+	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	97.8	1.4e-70
WP_001254220.1|1614228_1614405_+	NinE family protein	NA	K7PHE6	Enterobacteria_phage	100.0	2.7e-28
WP_073464418.1|1614407_1614749_+	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	96.5	7.3e-62
WP_073464420.1|1614741_1614918_+	protein ninF	NA	A0A220NRM2	Escherichia_phage	98.3	5.7e-26
WP_001279421.1|1614910_1615180_+	hypothetical protein	NA	K7PHK7	Enterobacteria_phage	100.0	7.1e-44
WP_062893758.1|1615179_1615470_+	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	97.9	2.9e-51
WP_025748958.1|1615466_1615829_+	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	99.2	3.5e-62
WP_000994516.1|1615825_1616014_+	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_001235461.1|1616010_1616634_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	100.0	3.0e-114
WP_000783734.1|1617067_1617391_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_000229389.1|1617374_1617851_+	glycoside hydrolase family protein	NA	A5VW81	Enterobacteria_phage	100.0	7.5e-89
WP_073464422.1|1617847_1618285_+|lysis	lysis protein	lysis	Q716B4	Shigella_phage	98.6	1.9e-70
WP_001139680.1|1618272_1618425_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	100.0	1.2e-21
WP_000807787.1|1618732_1618975_+	DUF2560 family protein	NA	A0A1R3Y5V5	Salmonella_virus	98.7	8.3e-36
WP_001029634.1|1618976_1619366_+	hypothetical protein	NA	Q76H27	Enterobacteria_phage	58.9	2.1e-36
WP_000729920.1|1619638_1620127_+	DNA-packaging protein	NA	G8EYI7	Enterobacteria_phage	100.0	1.4e-90
WP_000417851.1|1620104_1621604_+|terminase	terminase large subunit	terminase	A0A2D1GLW6	Escherichia_phage	100.0	4.8e-307
WP_062810285.1|1621604_1623770_+|portal	portal protein	portal	A0A2D1GLJ6	Escherichia_phage	98.8	0.0e+00
WP_000373006.1|1623783_1624695_+	scaffold protein	NA	A0A2D1GLN7	Escherichia_phage	100.0	1.3e-161
WP_001196946.1|1624694_1625990_+|coat	coat protein	coat	A0A2D1GLV2	Escherichia_phage	99.3	9.4e-243
WP_024180326.1|1626034_1626295_+	hypothetical protein	NA	A0A2D1GLK1	Escherichia_phage	96.6	2.4e-25
WP_001054834.1|1626272_1626773_+	DNA recombination protein RmuC	NA	G8EYJ2	Enterobacteria_phage	99.4	6.5e-91
WP_073464423.1|1626772_1628191_+	packaged DNA stabilization protein gp10	NA	A0A2D1GM00	Escherichia_phage	99.4	1.2e-275
WP_073464425.1|1628190_1629039_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	3.3e-103
WP_073464427.1|1629038_1629494_+	DUF2824 family protein	NA	Q716G5	Shigella_phage	98.7	1.1e-86
WP_000964882.1|1629496_1630189_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	100.0	9.2e-112
WP_073464429.1|1630198_1631494_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	90.7	1.2e-184
WP_032178650.1|1633980_1634304_-	hypothetical protein	NA	B9UDL2	Salmonella_phage	97.4	5.4e-14
WP_000821222.1|1634422_1634842_+	hypothetical protein	NA	B9UDL3	Salmonella_phage	97.8	1.5e-72
WP_000090241.1|1634858_1635110_-	Arc family DNA-binding protein	NA	B9UDL4	Salmonella_phage	98.8	1.3e-39
WP_000677939.1|1635200_1635362_+	Arc family DNA-binding protein	NA	A8CG91	Salmonella_phage	98.1	2.7e-22
WP_073465018.1|1635430_1636354_+	phage antirepressor Ant	NA	A5VW58	Enterobacteria_phage	98.0	2.3e-174
WP_073464430.1|1636454_1638302_+	hypothetical protein	NA	Q716G1	Shigella_phage	46.7	2.8e-147
WP_073464432.1|1638588_1639746_-|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.2	3.1e-221
WP_000368117.1|1640057_1640990_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.4	2.3e-166
1639907:1639922	attR	ATGGTGTCCCCTGCAG	NA	NA	NA	NA
>prophage 3
NZ_CP010170	Escherichia coli strain H6 chromosome, complete genome	4832567	1887405	1896846	4832567		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569357.1|1887405_1888332_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783120.1|1888336_1889068_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1889048_1889156_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1889215_1889947_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1890168_1891854_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_073464475.1|1891850_1892570_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_073464477.1|1892616_1893087_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	1.1e-81
WP_001295429.1|1893126_1893588_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001370558.1|1893712_1895713_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001300968.1|1895709_1896846_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
>prophage 4
NZ_CP010170	Escherichia coli strain H6 chromosome, complete genome	4832567	1939990	1947763	4832567	integrase	Salmonella_phage(36.36%)	12	1941773:1941799	1953518:1953544
WP_000807356.1|1939990_1940890_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.7e-12
WP_001318299.1|1941295_1941613_+	hypothetical protein	NA	NA	NA	NA	NA
1941773:1941799	attL	AAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_000985256.1|1941878_1942892_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	1.4e-193
WP_001306384.1|1943007_1943307_-	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
WP_000043869.1|1943421_1943697_+	regulatory phage cox family protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
WP_001005161.1|1943707_1943878_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	98.2	3.0e-24
WP_000217684.1|1943874_1944375_+	hypothetical protein	NA	S4TTB7	Salmonella_phage	99.4	3.8e-91
WP_000557701.1|1944438_1944663_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	3.0e-32
WP_001277895.1|1944662_1944965_+	DUF5405 family protein	NA	Q7Y4C1	Escherichia_virus	96.0	5.0e-46
WP_001113264.1|1944964_1945189_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_000027664.1|1945185_1945461_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_073464487.1|1945450_1947763_+	replication endonuclease	NA	Q7Y4B8	Escherichia_virus	96.4	0.0e+00
1953518:1953544	attR	AAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
>prophage 5
NZ_CP010170	Escherichia coli strain H6 chromosome, complete genome	4832567	1951214	1957842	4832567	terminase,tRNA,portal	Escherichia_phage(50.0%)	7	NA	NA
WP_033560205.1|1951214_1952249_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.7	2.4e-201
WP_001333118.1|1952248_1952518_-|terminase	terminase	terminase	A0A0F7LCM8	Escherichia_phage	100.0	9.6e-41
WP_073465019.1|1953197_1953416_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	98.6	4.0e-37
WP_000476014.1|1953688_1955050_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
WP_000929408.1|1955196_1955529_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137877.1|1955719_1956442_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000675150.1|1956438_1957842_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
>prophage 6
NZ_CP010170	Escherichia coli strain H6 chromosome, complete genome	4832567	2004401	2010708	4832567		Enterobacteria_phage(50.0%)	6	NA	NA
WP_045174079.1|2004401_2005796_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.8	6.3e-19
WP_044067113.1|2005970_2006864_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	2.3e-46
WP_000699403.1|2007236_2008322_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	5.7e-100
WP_004016730.1|2008321_2009221_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.2	1.3e-28
WP_004016728.1|2009279_2010158_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	6.6e-107
WP_001100804.1|2010162_2010708_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.3	3.5e-50
>prophage 7
NZ_CP010170	Escherichia coli strain H6 chromosome, complete genome	4832567	2471844	2484742	4832567		Escherichia_phage(14.29%)	13	NA	NA
WP_000041681.1|2471844_2474271_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	4.5e-214
WP_001300836.1|2474469_2474775_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|2474882_2475593_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2475595_2476156_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|2476190_2476532_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2476666_2476993_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|2477198_2478413_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836066.1|2478424_2479444_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001389342.1|2479501_2479630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876986.1|2479631_2480912_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.6	1.7e-156
WP_000005552.1|2480946_2481198_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_122999053.1|2483574_2483796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073464582.1|2483776_2484742_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.2	7.7e-56
>prophage 8
NZ_CP010170	Escherichia coli strain H6 chromosome, complete genome	4832567	2487977	2505681	4832567	terminase,lysis,tail	Enterobacteria_phage(52.94%)	23	NA	NA
WP_073464583.1|2487977_2488190_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	5.1e-29
WP_000980999.1|2488406_2488658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309521.1|2488724_2489003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001265197.1|2489004_2490054_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	57.3	1.3e-112
WP_073464585.1|2490067_2490820_+	antitermination protein	NA	Q8SBE4	Shigella_phage	94.8	5.6e-131
WP_000066484.1|2491495_2491711_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000839590.1|2492464_2492680_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000189918.1|2492684_2492996_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	62.6	5.0e-25
WP_001092966.1|2492992_2493526_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	8.4e-97
WP_001071776.1|2493522_2494020_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_000066495.1|2494383_2494596_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071526745.1|2494606_2494795_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001443523.1|2494942_2495098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019207.1|2495270_2495444_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000548593.1|2495739_2495946_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
WP_000421825.1|2496496_2497036_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_073464586.1|2497110_2498448_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	99.3	8.5e-263
WP_001233090.1|2498834_2499434_+	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
WP_000885614.1|2500251_2500827_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	5.5e-102
WP_000086522.1|2500924_2501515_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	39.3	1.5e-25
WP_000836768.1|2501831_2502065_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|2502133_2502247_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_073464588.1|2504220_2505681_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.4	7.3e-42
>prophage 9
NZ_CP010170	Escherichia coli strain H6 chromosome, complete genome	4832567	2785994	2855711	4832567	holin,protease,terminase,tail,integrase	Enterobacteria_phage(44.78%)	89	2805787:2805803	2855898:2855914
WP_000422045.1|2785994_2787044_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559280.1|2787263_2788022_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.0	1.5e-06
WP_001278883.1|2788018_2788609_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|2788648_2789521_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001295575.1|2791655_2792276_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285663.1|2792272_2793154_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2793291_2793336_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_057696002.1|2793427_2794990_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763511.1|2794989_2796585_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_000983912.1|2796585_2797947_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	1.1e-36
WP_000209520.1|2797958_2799152_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443067.1|2799151_2799958_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2800338_2800518_+	general stress protein	NA	NA	NA	NA	NA
WP_001056490.1|2800603_2801104_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_073464641.1|2801149_2801656_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000737226.1|2801715_2802354_-	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_000028545.1|2802710_2803454_+	UPF0259 family protein	NA	NA	NA	NA	NA
WP_000808667.1|2803483_2804023_+	septation protein A	NA	NA	NA	NA	NA
WP_000108160.1|2804127_2804526_+	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_001360141.1|2804565_2805285_-	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_000967595.1|2805508_2805805_+	YciI family protein	NA	NA	NA	NA	NA
2805787:2805803	attL	ATTTAAGAAAGTGTTCT	NA	NA	NA	NA
WP_073465029.1|2805923_2806472_-	recombinase family protein	NA	K7PGS7	Enterobacteria_phage	95.1	7.6e-93
WP_073464643.1|2806506_2807370_+|tail	tail fiber domain-containing protein	tail	I6PDG4	Cronobacter_phage	40.2	8.5e-22
WP_073464645.1|2807366_2807921_-|tail	tail fiber domain-containing protein	tail	A0A2I6PD03	Escherichia_phage	50.5	4.7e-42
WP_073464646.1|2807977_2809321_-|tail	phage tail protein	tail	K7P6T0	Enterobacteria_phage	62.4	7.2e-145
WP_001228569.1|2809381_2809615_-	hypothetical protein	NA	E4WL42	Enterobacteria_phage	100.0	2.3e-38
WP_000807260.1|2809726_2810401_-	hypothetical protein	NA	K7PGX6	Enterobacteria_phage	100.0	5.1e-123
WP_016247135.1|2810704_2814184_-	host specificity protein J	NA	G8C7R4	Escherichia_phage	87.7	0.0e+00
WP_073464648.1|2814238_2814832_-|tail	tail assembly protein	tail	G8C7R3	Escherichia_phage	79.4	2.0e-78
WP_023277158.1|2814819_2815551_-	C40 family peptidase	NA	G8C7R2	Escherichia_phage	94.2	1.6e-146
WP_023277159.1|2815563_2816334_-|tail	phage minor tail protein L	tail	G8C7R1	Escherichia_phage	94.5	1.1e-142
WP_023277160.1|2816333_2816684_-|tail	phage tail protein	tail	G8C7R0	Escherichia_phage	95.7	1.2e-56
WP_131619226.1|2816847_2817078_+	hypothetical protein	NA	Q9MCR8	Enterobacteria_phage	94.7	3.1e-32
WP_045357007.1|2817091_2817349_-	hypothetical protein	NA	Q9MCR9	Enterobacteria_phage	92.9	1.8e-36
WP_073464650.1|2817452_2817839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073464652.1|2817912_2820960_-|tail	phage tail tape measure protein	tail	G8C7Q6	Escherichia_phage	75.2	0.0e+00
WP_016247126.1|2820959_2821247_-	DUF1799 domain-containing protein	NA	I6PD79	Cronobacter_phage	61.5	1.2e-17
WP_073464653.1|2821264_2821603_-	hypothetical protein	NA	G8C7Q5	Escherichia_phage	93.8	8.6e-55
WP_073465031.1|2821668_2822286_-	DUF1983 domain-containing protein	NA	G8C7Q4	Escherichia_phage	77.0	5.1e-61
WP_048986151.1|2822656_2822992_-	hypothetical protein	NA	S4TTH3	Salmonella_phage	72.1	2.0e-40
WP_073464655.1|2823034_2823967_-|tail	phage tail protein	tail	G8C7Q3	Escherichia_phage	94.5	1.2e-159
WP_073464657.1|2824013_2824430_-	DUF4128 domain-containing protein	NA	G8C7Q2	Escherichia_phage	79.2	1.4e-59
WP_073464658.1|2824419_2825019_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	88.4	1.7e-98
WP_073464660.1|2825021_2825375_-	hypothetical protein	NA	G8C7Q0	Escherichia_phage	94.0	2.4e-55
WP_073464661.1|2825376_2825859_-	hypothetical protein	NA	G8C7P9	Escherichia_phage	84.4	3.7e-75
WP_073464663.1|2825861_2826095_-	hypothetical protein	NA	G8C7P8	Escherichia_phage	62.3	3.7e-17
WP_016156686.1|2826133_2827273_-	hypothetical protein	NA	G8C7P7	Escherichia_phage	84.0	4.8e-174
WP_073464665.1|2827290_2828043_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	90.4	3.1e-121
WP_016247115.1|2828382_2828847_-	DUF2829 domain-containing protein	NA	A0A1B0VMG3	Pseudomonas_phage	59.6	4.5e-46
WP_073464667.1|2828867_2829971_-	hypothetical protein	NA	G8C7P5	Escherichia_phage	91.6	1.9e-188
WP_073464668.1|2829972_2831376_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	89.5	4.4e-238
WP_073464670.1|2831380_2832952_-|terminase	terminase	terminase	G8C7P3	Escherichia_phage	93.1	6.0e-308
WP_016247111.1|2832948_2833437_-	DUF2280 domain-containing protein	NA	H9C190	Pectobacterium_phage	84.3	2.1e-54
WP_073464672.1|2833468_2834107_-	hypothetical protein	NA	I6S676	Salmonella_phage	87.7	1.0e-109
WP_023277179.1|2834110_2834482_-	hypothetical protein	NA	Q76H27	Enterobacteria_phage	56.6	1.1e-34
WP_000958715.1|2834581_2834782_-	hypothetical protein	NA	A0A1L6Z528	Klebsiella_phage	75.0	1.3e-18
WP_016247107.1|2834861_2835026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071839683.1|2835004_2835220_+	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_016247106.1|2835223_2835772_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.6	1.8e-09
WP_073465033.1|2835768_2836311_-	lysozyme	NA	K7PM52	Enterobacteria_phage	99.4	4.7e-103
WP_016066213.1|2836288_2836567_-|holin	holin	holin	K7PGZ9	Enterobacteria_phage	100.0	6.0e-46
WP_073464673.1|2837071_2837887_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	97.0	1.0e-141
WP_001567566.1|2837883_2838024_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	100.0	1.7e-20
WP_001472176.1|2838020_2838383_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	99.2	1.4e-63
WP_001472175.1|2838379_2838670_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	100.0	1.1e-50
WP_039022272.1|2838672_2838879_-	hypothetical protein	NA	K7PJT9	Enterobacteria_phage	100.0	8.7e-34
WP_073464675.1|2838878_2839478_-	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	97.5	7.7e-107
WP_016247099.1|2839833_2840091_-	DNA polymerase III subunit theta	NA	A0A077SLL5	Escherichia_phage	81.3	7.0e-25
WP_016247098.1|2840183_2840420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073464677.1|2840519_2842508_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	53.0	1.6e-201
WP_021571821.1|2842504_2842762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077897258.1|2842761_2843031_-	hypothetical protein	NA	A0A0H4ISY5	Shigella_phage	55.9	1.6e-11
WP_000161222.1|2843091_2843310_-	DUF4014 family protein	NA	K7P7J6	Enterobacteria_phage	97.2	4.6e-33
WP_001229289.1|2843306_2843684_-	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	100.0	1.1e-69
WP_073464680.1|2843685_2844231_-	ead/Ea22-like family protein	NA	K7P6V8	Enterobacteria_phage	92.1	7.7e-37
WP_016066205.1|2844227_2844425_-	hypothetical protein	NA	K7PKS4	Enterobacteria_phage	100.0	2.6e-27
WP_016066204.1|2844421_2844766_-	winged helix-turn-helix transcriptional regulator	NA	K7PHG5	Enterobacteria_phage	100.0	1.3e-58
WP_000838082.1|2844767_2845457_-	Replication protein 14	NA	K7P7B6	Enterobacteria_phage	100.0	6.8e-131
WP_000072106.1|2845453_2846362_-	replication protein	NA	K7PGZ0	Enterobacteria_phage	100.0	1.2e-159
WP_060643426.1|2846446_2846986_-	toxin YdaT domain-containing protein	NA	K7PJT7	Enterobacteria_phage	84.4	1.0e-78
WP_019076923.1|2847017_2847245_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	56.3	2.4e-16
WP_149025511.1|2847313_2848036_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	54.3	1.4e-70
WP_019076927.1|2848896_2849121_-	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	64.7	1.2e-15
WP_001568763.1|2849448_2849655_+	hypothetical protein	NA	K7PM31	Enterobacteria_phage	100.0	1.5e-33
WP_000884659.1|2849666_2849828_+	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	100.0	1.7e-24
WP_073464684.1|2849967_2852877_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	K7PJT5	Enterobacteria_phage	93.8	0.0e+00
WP_000432226.1|2852888_2854001_+	recombinase RecT	NA	K7PKR8	Enterobacteria_phage	100.0	3.9e-205
WP_001237029.1|2854039_2854282_+	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	100.0	4.0e-38
WP_000627155.1|2854517_2855711_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	100.0	1.3e-235
2855898:2855914	attR	ATTTAAGAAAGTGTTCT	NA	NA	NA	NA
>prophage 10
NZ_CP010170	Escherichia coli strain H6 chromosome, complete genome	4832567	3226157	3302357	4832567	protease,terminase,tail,integrase,tRNA	Escherichia_phage(16.67%)	65	3220047:3220065	3276620:3276638
3220047:3220065	attL	GCGCCCATTTTTTCCAGCA	NA	NA	NA	NA
WP_001292822.1|3226157_3228440_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_000468308.1|3228759_3228978_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_023148821.1|3229060_3230224_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.2	4.1e-205
WP_073464764.1|3230223_3230412_-	hypothetical protein	NA	A0A0F7LDH4	Escherichia_phage	100.0	6.1e-18
WP_000072552.1|3230516_3230828_+	helix-turn-helix transcriptional regulator	NA	Q1JS25	Enterobacteria_phage	100.0	4.3e-53
WP_000023391.1|3230921_3231917_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	99.7	7.1e-190
WP_000067977.1|3231948_3232746_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
WP_001190363.1|3232827_3233418_-	NAD(P)H oxidoreductase	NA	NA	NA	NA	NA
WP_000918506.1|3234426_3235857_-	amino acid permease	NA	NA	NA	NA	NA
WP_000109295.1|3236066_3237215_-	MFS transporter	NA	NA	NA	NA	NA
WP_000165879.1|3237528_3238155_+	hydrolase	NA	NA	NA	NA	NA
WP_000534637.1|3238189_3239053_-	dimethyl sulfoxide reductase anchor subunit DmsC	NA	NA	NA	NA	NA
WP_073464769.1|3239054_3239672_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.1	1.1e-76
WP_000850303.1|3239682_3242127_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000886683.1|3242365_3243658_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067755.1|3243748_3245092_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|3245102_3245714_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_073464770.1|3245868_3249858_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|3249992_3250487_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|3251031_3251997_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043575.1|3252119_3253886_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
WP_073464772.1|3253886_3255608_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	7.6e-22
WP_001241678.1|3255649_3256354_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3256638_3256857_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934040.1|3257718_3259995_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	2.5e-166
WP_000520781.1|3260025_3260346_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|3260668_3260893_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188180.1|3260965_3262912_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000746460.1|3262908_3264024_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_149025508.1|3264174_3265131_+	DUF535 family protein	NA	NA	NA	NA	NA
WP_000599802.1|3265127_3266786_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001298299.1|3267210_3267906_+	aquaporin Z	NA	NA	NA	NA	NA
WP_001338421.1|3268400_3269300_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000458809.1|3269443_3271096_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000178677.1|3271107_3272076_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815362.1|3272208_3273927_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	5.2e-31
WP_000566376.1|3273963_3274965_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_001136554.1|3274975_3276406_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001338420.1|3276504_3277518_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
3276620:3276638	attR	TGCTGGAAAAAATGGGCGC	NA	NA	NA	NA
WP_001255167.1|3277514_3278345_-	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160737.1|3278341_3278665_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270734.1|3278790_3279306_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|3279523_3280252_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_000756569.1|3280269_3281001_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001691.1|3281007_3281724_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000464491.1|3281723_3282392_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001295339.1|3282682_3283414_+	ABC transporter substrate-binding protein ArtJ	NA	NA	NA	NA	NA
WP_001149756.1|3283612_3284740_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.0	6.0e-28
WP_000389260.1|3284780_3285269_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061665.1|3285328_3286174_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_001093854.1|3286170_3287124_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996005.1|3287133_3288267_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000126073.1|3288361_3289474_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|3289824_3290301_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|3290388_3291291_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_001543595.1|3291351_3292074_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201560.1|3292057_3292345_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195231.1|3292504_3292762_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
WP_000681108.1|3292791_3293169_-	inner membrane protein YbjM	NA	NA	NA	NA	NA
WP_001024876.1|3293438_3295124_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000972391.1|3295359_3295578_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001011793.1|3295668_3296769_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	7.6e-177
WP_000980400.1|3296765_3297251_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	4.8e-67
WP_073465039.1|3299961_3300024_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_073464775.1|3300590_3302357_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
>prophage 11
NZ_CP010170	Escherichia coli strain H6 chromosome, complete genome	4832567	3306874	3314957	4832567	integrase	Salmonella_phage(83.33%)	13	3304721:3304735	3321301:3321315
3304721:3304735	attL	TGAAAAACCTGAAAG	NA	NA	NA	NA
WP_001217562.1|3306874_3307108_-	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	2.3e-35
WP_001154434.1|3307118_3307307_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_073464781.1|3307460_3309875_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.8	0.0e+00
WP_073464783.1|3309871_3310729_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.5	6.0e-161
WP_000752613.1|3310725_3310953_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_001244209.1|3310952_3311186_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	2.4e-32
WP_000996717.1|3311253_3311595_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_000956192.1|3311712_3312009_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	88.5	1.9e-21
WP_000460893.1|3312016_3312526_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000188450.1|3312590_3312794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024220196.1|3312939_3313509_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	41.9	4.2e-38
WP_000900883.1|3313524_3313716_+	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	65.9	6.8e-09
WP_000290937.1|3313904_3314957_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
3321301:3321315	attR	CTTTCAGGTTTTTCA	NA	NA	NA	NA
>prophage 12
NZ_CP010170	Escherichia coli strain H6 chromosome, complete genome	4832567	3395145	3416543	4832567	protease,lysis,tail,integrase	Enterobacteria_phage(46.88%)	35	3390782:3390796	3425029:3425043
3390782:3390796	attL	CAGGCCATCTTCCAG	NA	NA	NA	NA
WP_001543588.1|3395145_3396435_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	3.4e-19
WP_073464800.1|3396493_3396970_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_000586341.1|3397715_3399047_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	1.4e-20
WP_073464802.1|3399120_3399705_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	1.6e-104
WP_001663509.1|3400387_3400621_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	2.5e-21
WP_000079508.1|3400677_3401088_+	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_001139678.1|3401439_3401592_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
WP_000092273.1|3401579_3402047_-|lysis	lysis protein	lysis	A0A2D1GLQ7	Escherichia_phage	96.8	1.6e-75
WP_001135261.1|3402043_3402541_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	97.6	4.2e-90
WP_000839596.1|3402540_3402756_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000592543.1|3404024_3404984_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_000780581.1|3405176_3405701_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
WP_001204777.1|3405856_3406234_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.2	7.3e-55
WP_000971055.1|3406319_3406460_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001540841.1|3406456_3406819_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	9.5e-60
WP_000251069.1|3406940_3407234_-	lambda phage CII family protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_001194218.1|3407353_3407569_-	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	100.0	1.4e-31
WP_000028392.1|3407674_3408307_+	LexA family transcriptional regulator	NA	K7P850	Enterobacteria_phage	99.5	1.6e-118
WP_000618037.1|3408303_3408708_+	hypothetical protein	NA	Q716D7	Shigella_phage	98.5	4.3e-69
WP_000340004.1|3409061_3409385_+	antitermination protein N	NA	A4KWR8	Enterobacteria_phage	94.3	1.4e-49
WP_001383906.1|3409393_3410263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000065374.1|3410451_3410820_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_001198861.1|3410892_3411057_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372937.1|3411025_3411169_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_000995467.1|3411243_3411540_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	3.6e-49
WP_000100847.1|3411545_3412331_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000682305.1|3413004_3413187_+	DUF1317 domain-containing protein	NA	A0A0P0ZD61	Stx2-converting_phage	98.3	2.8e-28
WP_000548514.1|3413159_3413351_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_000188870.1|3413427_3413643_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000763363.1|3413741_3413963_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_001289873.1|3413959_3414508_+	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	100.0	2.2e-100
WP_000026224.1|3414699_3414981_+	hypothetical protein	NA	A0A0K2FIU9	Enterobacteria_phage	100.0	2.8e-51
WP_000545728.1|3415069_3415237_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3415276_3415495_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533643.1|3415472_3416543_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
3425029:3425043	attR	CAGGCCATCTTCCAG	NA	NA	NA	NA
>prophage 13
NZ_CP010170	Escherichia coli strain H6 chromosome, complete genome	4832567	4359216	4371206	4832567	integrase	Enterobacteria_phage(80.0%)	14	4356913:4356927	4372716:4372730
4356913:4356927	attL	GGCATCTCGCAATCT	NA	NA	NA	NA
WP_001366032.1|4359216_4360197_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	56.2	9.4e-102
WP_001338066.1|4360204_4360327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087889224.1|4361070_4361265_-|integrase	integrase	integrase	Q38404	Enterobacteria_phage	96.1	2.2e-23
WP_000783659.1|4361619_4363953_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	99.0	0.0e+00
WP_000856729.1|4363967_4364288_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000459308.1|4364423_4364879_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	100.0	7.2e-65
WP_073464933.1|4364871_4365159_-	Derepression protein	NA	Q7M2A0	Enterobacteria_phage	95.8	1.2e-46
WP_071940787.1|4365151_4365742_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	89.6	1.2e-59
WP_001149160.1|4365738_4366005_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_073464934.1|4366558_4367293_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	98.8	3.9e-129
WP_073464936.1|4367289_4367790_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_073464937.1|4367863_4368436_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.2	7.2e-94
WP_073464939.1|4369116_4369845_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_073464941.1|4369946_4371206_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.5	1.2e-72
4372716:4372730	attR	GGCATCTCGCAATCT	NA	NA	NA	NA
