The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010176	Escherichia coli strain H10 chromosome, complete genome	4805164	22123	65667	4805164	transposase,integrase,plate	Streptococcus_phage(28.57%)	38	63564:63623	74198:74275
WP_000246444.1|22123_23455_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|23457_23982_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113713.1|23978_25259_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348793.1|25283_26366_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393857.1|26329_28180_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611738.1|28183_28597_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_073470654.1|28603_30079_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|30129_30354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037391.1|30388_30889_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|31585_32104_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_073470655.1|32313_34455_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	8.2e-26
WP_106422330.1|34530_39024_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.5	1.0e-22
WP_000786991.1|39025_39283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073470656.1|39620_40757_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001118029.1|40798_41569_-	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000532698.1|41722_42196_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000973081.1|42238_44683_-	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000284050.1|44922_45501_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000333380.1|45706_46474_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|46444_47185_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000615976.1|47340_47619_-	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_000729704.1|47621_47882_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000543899.1|48067_48841_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_001030484.1|48897_49254_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_000598760.1|49246_49525_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_001438980.1|49629_51369_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_000207574.1|51313_52099_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226164.1|52169_53225_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_001059855.1|53221_53674_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000602134.1|55056_55671_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001293016.1|55727_57185_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|57445_57904_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189539.1|57995_59240_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174677.1|59297_59699_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749863.1|59737_60793_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|61080_62184_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893255.1|62195_63449_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
63564:63623	attL	GCCGATATAGCTCAGTTGGTAGAGCAGCGCATTCGTAATGCGAAGGTCGTAGGTTCGACT	NA	NA	NA	NA
WP_073470657.1|63726_65667_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_073470657.1|63726_65667_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
74198:74275	attR	GCCGATATAGCTCAGTTGGTAGAGCAGCGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATT	NA	NA	NA	NA
>prophage 2
NZ_CP010176	Escherichia coli strain H10 chromosome, complete genome	4805164	344647	411175	4805164	lysis,terminase,protease,transposase,capsid,integrase,tRNA,head,tail,portal	Enterobacteria_phage(55.56%)	75	354809:354855	402649:402695
WP_000912345.1|344647_346033_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143552.1|346068_346590_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|346697_346910_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|346911_347778_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|348258_348801_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988379.1|349020_349713_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001347862.1|349743_352353_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000691054.1|352365_353373_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001250422.1|353383_353899_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|353901_354534_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
354809:354855	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_000051902.1|354868_356032_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_000488407.1|356230_356509_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000763385.1|356556_356775_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_001443983.1|356873_357155_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_000548537.1|357165_357357_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_000149544.1|357329_357512_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000611716.1|357508_358189_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	3.0e-131
WP_000100847.1|358185_358971_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995455.1|358976_359273_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	8.1e-49
WP_023148105.1|359348_359639_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.1	5.0e-27
WP_001362421.1|360142_361750_-	SIR2 family protein	NA	A0A1S5SA14	Streptococcus_phage	49.0	6.9e-94
WP_000712399.1|361856_362549_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	2.5e-109
WP_000184665.1|362659_362887_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_001182873.1|362917_363457_+	toxin YdaT domain-containing protein	NA	M9NZI6	Enterobacteria_phage	66.7	8.9e-62
WP_000147954.1|363453_364473_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	1.5e-110
WP_032252942.1|364469_365171_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	97.0	3.9e-126
WP_001070451.1|365536_365869_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_032252941.1|365960_366068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709083.1|366125_367652_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_032351880.1|367763_368087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000379698.1|368548_368905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303586.1|368994_369096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033805666.1|369092_369548_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	1.8e-60
WP_000224916.1|369547_369718_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
WP_000774488.1|369710_370001_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
WP_021534986.1|369997_370360_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	94.0	8.1e-59
WP_033805665.1|370356_370497_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	65.1	3.6e-07
WP_001204780.1|370582_370966_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_000737283.1|371155_372253_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	76.3	4.8e-155
WP_000839596.1|372841_373057_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135277.1|373056_373554_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_001228695.1|373770_373953_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|374043_374337_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001415975.1|374696_374891_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.9	4.3e-27
WP_000453576.1|375279_375825_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	99.4	4.7e-95
WP_024225567.1|375799_377725_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000198149.1|377721_377928_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_024225566.1|377924_379526_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	3.8e-310
WP_000123225.1|379506_380826_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.9	6.2e-234
WP_001299443.1|380835_381168_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_000063288.1|381223_382249_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	5.2e-188
WP_000158854.1|382288_382687_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	89.4	1.8e-56
WP_000752996.1|382698_383052_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	1.5e-62
WP_061892780.1|383063_383642_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	96.9	1.9e-78
WP_000683128.1|383638_384034_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	6.5e-70
WP_001360166.1|384041_384782_+|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	99.2	5.0e-132
WP_000479206.1|384797_385220_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	81.4	6.1e-58
WP_000459458.1|385201_385636_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
WP_000840260.1|385628_388190_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	89.3	0.0e+00
WP_000847362.1|388186_388516_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	1.4e-57
WP_001152652.1|388515_389214_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	1.1e-131
WP_000194779.1|389219_389963_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090915.1|389899_390532_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	7.6e-97
WP_033882805.1|390592_393991_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.3	0.0e+00
WP_001230379.1|394057_394657_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	2.6e-110
WP_045133724.1|394721_397748_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	81.4	3.6e-67
WP_000885570.1|397747_398332_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	6.6e-103
WP_000239881.1|398386_399055_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001226375.1|399599_401084_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201825.1|401270_402224_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177453.1|402738_403500_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
402649:402695	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001224569.1|403682_404573_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_073470663.1|404573_407546_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000383951.1|407532_409770_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_073470664.1|410038_411175_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP010176	Escherichia coli strain H10 chromosome, complete genome	4805164	1212386	1266476	4805164	lysis,integrase,tRNA,tail,terminase	Escherichia_phage(50.0%)	58	1206770:1206786	1245579:1245595
1206770:1206786	attL	GATCGCAGCAATAAAAA	NA	NA	NA	NA
WP_001307164.1|1212386_1213619_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|1213873_1214857_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123745.1|1215334_1216708_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157407.1|1216836_1217772_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040858.1|1217823_1219059_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.5	1.6e-239
WP_000079604.1|1219060_1219276_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_021565074.1|1219354_1219564_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	96.8	8.8e-26
WP_001317028.1|1219556_1219751_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|1219807_1220617_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_021565075.1|1220609_1223210_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	1.1e-247
WP_073470675.1|1223311_1223587_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	94.5	4.4e-41
WP_001352098.1|1223661_1223832_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560223.1|1223831_1224053_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_032155212.1|1224494_1224983_+	superinfection exclusion B family protein	NA	NA	NA	NA	NA
WP_001169151.1|1224979_1225135_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001326317.1|1225145_1225325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233319.1|1225567_1225987_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001072342.1|1226066_1226321_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000693803.1|1226317_1226740_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
WP_001396581.1|1226817_1227606_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
WP_000788970.1|1227612_1228359_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_021565077.1|1228381_1229131_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	85.6	1.1e-110
WP_032182078.1|1229384_1231454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042054239.1|1231580_1231679_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000940319.1|1232142_1232742_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_000247763.1|1232741_1233032_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.7e-46
WP_032182076.1|1233028_1233571_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	75.7	2.9e-76
WP_000506936.1|1234616_1235045_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_001348108.1|1235216_1235591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839565.1|1235842_1236058_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
WP_032182072.1|1236057_1236555_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	95.8	3.9e-88
WP_001228691.1|1236771_1236957_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	75.4	8.9e-14
WP_024235095.1|1237153_1238611_+	Trk system potassium transporter TrkG	NA	NA	NA	NA	NA
WP_001204033.1|1239534_1240467_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.5	4.2e-83
WP_000613571.1|1240402_1240654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000089446.1|1240657_1241752_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.2	4.5e-113
WP_000625347.1|1241732_1243034_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.8	8.0e-149
WP_000763708.1|1243036_1244443_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	68.8	6.7e-186
WP_001317036.1|1244426_1245539_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.8	6.0e-113
WP_000770038.1|1245643_1246408_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	66.5	3.9e-87
1245579:1245595	attR	TTTTTATTGCTGCGATC	NA	NA	NA	NA
WP_000918487.1|1246506_1247646_+	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.0	7.4e-159
WP_000908084.1|1247688_1247865_+	hypothetical protein	NA	G8C7P8	Escherichia_phage	62.3	4.7e-12
WP_000634214.1|1247868_1248264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000524260.1|1248263_1248647_+	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
WP_001029815.1|1248647_1249028_+	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	1.1e-18
WP_000673077.1|1249024_1249417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000094292.1|1249443_1250406_+	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	39.2	4.5e-56
WP_012565075.1|1250556_1250916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032182067.1|1251387_1254621_+|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	34.5	1.1e-111
WP_000024051.1|1254613_1254952_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_001152432.1|1254951_1255650_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	93.5	1.1e-125
WP_032155200.1|1255655_1256399_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.3	1.4e-145
WP_019843089.1|1256335_1256944_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.5	1.8e-103
WP_073470678.1|1257004_1260403_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.3	0.0e+00
WP_001619152.1|1260469_1261069_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	2.8e-109
WP_072040289.1|1261133_1264487_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_073470679.1|1264486_1265071_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	92.8	7.3e-102
WP_032252927.1|1265144_1266476_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	1.1e-20
>prophage 4
NZ_CP010176	Escherichia coli strain H10 chromosome, complete genome	4805164	1484008	1538023	4805164	lysis,protease,tail,portal,terminase	Enterobacteria_phage(50.0%)	61	NA	NA
WP_000527751.1|1484008_1485469_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.8	1.1e-42
WP_120795384.1|1487444_1487558_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|1487626_1487860_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086514.1|1488176_1488767_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	7.3e-25
WP_000885595.1|1488864_1489440_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.8	2.9e-103
WP_073470686.1|1489439_1492532_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	92.3	2.7e-54
WP_001233073.1|1492596_1493196_-	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	98.5	2.6e-110
WP_073470688.1|1496058_1496757_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	98.3	7.3e-133
WP_000447248.1|1496766_1497096_-|tail	phage tail protein	tail	A0A291AWW9	Escherichia_phage	100.0	1.7e-60
WP_073470689.1|1497095_1500161_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_001161009.1|1500132_1500462_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_073470756.1|1500470_1500857_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	98.4	4.0e-64
WP_073470690.1|1500917_1501661_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.8	1.5e-131
WP_073470691.1|1501671_1502073_-|tail	phage tail protein	tail	A5LH34	Enterobacteria_phage	98.5	5.4e-72
WP_000677102.1|1502069_1502648_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	1.2e-101
WP_001283153.1|1502659_1502935_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097039.1|1502927_1503251_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	99.1	1.5e-51
WP_001774880.1|1503337_1505365_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.5	0.0e+00
WP_000985930.1|1505309_1506818_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.4	1.7e-288
WP_001072975.1|1506817_1507030_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000507036.1|1507026_1509126_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	96.6	0.0e+00
WP_000421823.1|1509134_1509674_-	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	99.4	1.8e-94
WP_000548593.1|1510223_1510430_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
WP_001019207.1|1510725_1510899_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001443523.1|1511071_1511227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526745.1|1511374_1511563_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|1511573_1511786_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071776.1|1512149_1512647_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_001092971.1|1512643_1513177_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189918.1|1513173_1513485_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	62.6	5.0e-25
WP_000839587.1|1513489_1513705_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	2.9e-32
WP_001146314.1|1513895_1514609_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000592549.1|1515015_1515975_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_000780584.1|1516167_1516692_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	52.9	1.0e-46
WP_001204787.1|1516847_1517225_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	82.5	1.8e-53
WP_001265274.1|1517242_1518292_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	58.2	3.0e-114
WP_032236628.1|1518293_1518572_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.3e-11
WP_000980999.1|1518638_1518890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000884073.1|1519106_1519319_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	6.6e-29
WP_001774471.1|1520063_1521398_+	FRG domain-containing protein	NA	Q9AZ51	Lactococcus_phage	34.1	2.0e-06
WP_001774502.1|1521635_1522058_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	84.9	3.4e-61
WP_000054501.1|1522098_1523064_-	hypothetical protein	NA	U5P0A0	Shigella_phage	63.9	9.7e-59
WP_000705346.1|1523044_1523566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|1523549_1523780_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448563.1|1523863_1524271_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|1524437_1524593_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000344950.1|1524594_1525170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|1525656_1525845_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001296931.1|1525841_1526033_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_001774503.1|1526125_1528597_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.5	8.5e-59
WP_000005552.1|1528669_1528921_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000876976.1|1528955_1530236_+	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.6	1.0e-156
WP_001389342.1|1530237_1530366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836057.1|1530423_1531443_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	7.4e-17
WP_001295394.1|1531454_1532669_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|1532874_1533201_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705197.1|1533335_1533677_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138584.1|1533711_1534272_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|1534274_1534985_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001307224.1|1535092_1535398_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_057697222.1|1535596_1538023_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.8	7.7e-214
>prophage 5
NZ_CP010176	Escherichia coli strain H10 chromosome, complete genome	4805164	2043261	2051669	4805164		Enterobacteria_phage(33.33%)	8	NA	NA
WP_072020849.1|2043261_2044080_-	DUF616 domain-containing protein	NA	A0A2P0VMU2	Tetraselmis_virus	33.9	6.8e-29
WP_077780088.1|2044034_2044832_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_045172218.1|2044855_2045914_-	O54 family O-antigen polymerase	NA	NA	NA	NA	NA
WP_045172220.1|2045917_2046793_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	3.9e-107
WP_001023643.1|2046850_2047750_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.5	1.1e-27
WP_000699439.1|2047749_2048835_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	2.1e-102
WP_000183060.1|2049206_2050100_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_073470701.1|2050274_2051669_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	1.4e-18
>prophage 6
NZ_CP010176	Escherichia coli strain H10 chromosome, complete genome	4805164	2098226	2137153	4805164	lysis,holin,capsid,tRNA,integrase,head,tail,portal,terminase,plate	Escherichia_phage(36.36%)	52	2103284:2103311	2135346:2135373
WP_000675150.1|2098226_2099630_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
WP_000137877.1|2099626_2100349_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_001298852.1|2100539_2100872_+	YegP family protein	NA	NA	NA	NA	NA
WP_001307279.1|2101080_2101377_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_001220181.1|2101378_2101675_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000476011.1|2101777_2103139_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
2103284:2103311	attL	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000468308.1|2103412_2103631_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001747944.1|2103712_2104876_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.7	2.4e-205
WP_073470703.1|2104875_2105355_-|tail	phage tail protein	tail	O64315	Escherichia_phage	97.5	1.3e-83
WP_073470704.1|2105369_2107817_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	98.9	0.0e+00
WP_000785970.1|2107809_2107929_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|2107961_2108237_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_073470705.1|2108293_2108812_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	98.8	1.6e-92
WP_001286709.1|2108824_2110015_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	3.7e-225
WP_073470706.1|2110465_2110798_-	FlxA-like family protein	NA	NA	NA	NA	NA
WP_073470707.1|2111000_2111282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073470708.1|2111283_2111811_-|tail	tail fiber assembly protein	tail	U5N0T1	Enterobacteria_phage	95.4	1.4e-91
WP_040100848.1|2111814_2114133_-|tail	tail fiber protein	tail	U5N099	Enterobacteria_phage	66.7	9.7e-214
WP_001285325.1|2114143_2114674_-|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	100.0	2.3e-102
WP_001121470.1|2114666_2115575_-|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.7	3.4e-162
WP_000127164.1|2115579_2115927_-	GPW/gp25 family protein	NA	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_021525814.1|2115923_2116559_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	97.6	8.5e-112
WP_073470709.1|2116642_2117428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021578878.1|2117499_2117952_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	98.0	4.5e-75
WP_032239003.1|2117944_2118412_-|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	96.8	4.8e-80
WP_000040681.1|2118519_2118945_-|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	100.0	1.0e-68
WP_001605748.1|2118932_2119358_-	hypothetical protein	NA	U5N096	Enterobacteria_phage	98.6	1.7e-60
WP_001144093.1|2119372_2119870_-	glycoside hydrolase family 104 protein	NA	Q7Y4E4	Escherichia_virus	100.0	6.2e-94
WP_000123124.1|2119869_2120151_-|holin	phage holin family protein	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_000846399.1|2120154_2120358_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000988628.1|2120357_2120867_-|head	head completion/stabilization protein	head	Q858W4	Yersinia_virus	100.0	3.0e-91
WP_073470711.1|2120966_2121710_-|terminase	terminase endonuclease subunit	terminase	Q858W5	Yersinia_virus	97.6	1.9e-123
WP_001719219.1|2121713_2122787_-|capsid	phage major capsid protein, P2 family	capsid	Q94MK7	Enterobacteria_phage	99.4	2.5e-201
WP_073470712.1|2122845_2123700_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MI4	Enterobacteria_phage	97.2	2.8e-134
WP_073470713.1|2123873_2125646_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	99.7	0.0e+00
WP_000038193.1|2125645_2126680_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.4	2.1e-200
WP_187655781.1|2126991_2127573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001364221.1|2127788_2128520_-	hypothetical protein	NA	A0A218M4H5	Erwinia_phage	78.4	1.6e-106
WP_000554772.1|2128743_2128950_-	hypothetical protein	NA	Q2P9X3	Enterobacteria_phage	95.5	5.3e-31
WP_073470757.1|2128949_2129402_-	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	96.0	6.7e-79
WP_073470715.1|2129401_2131687_-	replication endonuclease	NA	Q858T4	Yersinia_virus	97.4	0.0e+00
WP_000027664.1|2131676_2131952_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_001113264.1|2131948_2132173_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_001277957.1|2132172_2132475_-	DUF5405 family protein	NA	A0A0F7LDT6	Escherichia_phage	99.0	2.2e-46
WP_000557703.1|2132474_2132699_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217662.1|2132762_2133263_-	hypothetical protein	NA	M1SV55	Escherichia_phage	99.4	1.3e-91
WP_001005162.1|2133259_2133430_-	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_001081582.1|2133440_2133716_-	regulatory phage cox family protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_000020919.1|2133837_2134137_+	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_000985260.1|2134252_2135266_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.4	8.3e-194
WP_001613389.1|2135530_2135848_-	hypothetical protein	NA	NA	NA	NA	NA
2135346:2135373	attR	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000807362.1|2136253_2137153_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
>prophage 7
NZ_CP010176	Escherichia coli strain H10 chromosome, complete genome	4805164	2175178	2184619	4805164		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000040703.1|2175178_2176315_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	3.6e-161
WP_001296829.1|2176311_2178312_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
WP_001295429.1|2178436_2178898_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_000950409.1|2178937_2179408_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_073470716.1|2179454_2180174_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2180170_2181856_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|2182077_2182809_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|2182868_2182976_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2182956_2183688_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569313.1|2183692_2184619_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.3	3.1e-22
>prophage 8
NZ_CP010176	Escherichia coli strain H10 chromosome, complete genome	4805164	2689137	2696901	4805164	transposase,integrase	Escherichia_phage(66.67%)	6	2686925:2686938	2694038:2694051
2686925:2686938	attL	CGACTATTTGAACT	NA	NA	NA	NA
WP_000162574.1|2689137_2689620_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001341819.1|2690362_2691592_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	100.0	1.5e-234
WP_000448925.1|2691630_2692047_+	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_033802718.1|2692118_2693867_-	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.7	0.0e+00
WP_000577254.1|2693868_2695587_-	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	99.8	3.2e-307
2694038:2694051	attR	AGTTCAAATAGTCG	NA	NA	NA	NA
WP_085948467.1|2695738_2696901_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.4e-51
>prophage 9
NZ_CP010176	Escherichia coli strain H10 chromosome, complete genome	4805164	2767795	2774935	4805164		Escherichia_phage(83.33%)	6	NA	NA
WP_001272898.1|2767795_2770357_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
WP_001141334.1|2770462_2771119_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	47.2	4.3e-50
WP_001297141.1|2771169_2771937_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|2772132_2773041_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590388.1|2773037_2774300_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.7	5.7e-136
WP_001278994.1|2774296_2774935_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 10
NZ_CP010176	Escherichia coli strain H10 chromosome, complete genome	4805164	3771318	3782153	4805164	integrase	Enterobacteria_phage(88.89%)	12	3766534:3766547	3782083:3782096
3766534:3766547	attL	CCAACCTGACGCTG	NA	NA	NA	NA
WP_001547907.1|3771318_3772497_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	93.3	1.3e-211
WP_001547908.1|3772493_3773981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077782923.1|3774035_3775133_+	protein kinase	NA	A0A2I2L4W4	Orpheovirus	29.0	9.4e-10
WP_073470739.1|3775346_3775910_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.7	1.0e-92
WP_073470740.1|3775983_3776484_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_001283029.1|3776480_3777215_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.8	1.0e-129
WP_001149160.1|3777767_3778034_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_042972606.1|3778030_3778621_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	96.3	1.0e-66
WP_001244665.1|3778613_3778901_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_073470741.1|3778893_3779349_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_000856729.1|3779484_3779805_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_073470742.1|3779819_3782153_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	98.6	0.0e+00
3782083:3782096	attR	CCAACCTGACGCTG	NA	NA	NA	NA
