The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010137	Escherichia coli strain D2 chromosome, complete genome	4765647	1025994	1088162	4765647	transposase,tRNA,integrase,protease	Acinetobacter_phage(33.33%)	54	1044985:1044999	1086162:1086176
WP_000608644.1|1025994_1027257_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_000778605.1|1028096_1028627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001075495.1|1029296_1030028_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000558152.1|1030548_1031001_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_000332862.1|1031536_1032472_+	pseudouridine kinase	NA	NA	NA	NA	NA
WP_001290195.1|1032464_1033400_+	pseudouridine-5'-phosphate glycosidase	NA	NA	NA	NA	NA
WP_001328687.1|1033483_1034734_+	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
WP_000370278.1|1034752_1035847_-	sugar kinase	NA	NA	NA	NA	NA
WP_073544099.1|1037174_1037741_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000991605.1|1038000_1038573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000958093.1|1038641_1038890_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000684813.1|1039140_1039779_-	RpiB/LacA/LacB family sugar-phosphate isomerase	NA	NA	NA	NA	NA
WP_001051736.1|1040020_1041190_+	oligogalacturonate lyase	NA	NA	NA	NA	NA
WP_000345753.1|1041222_1042023_+	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000497518.1|1042077_1042401_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000134159.1|1042766_1044281_+	major facilitator transporter	NA	NA	NA	NA	NA
WP_073544101.1|1044282_1046517_+	exopolygalacturonate lyase	NA	NA	NA	NA	NA
1044985:1044999	attL	CAGTCATGGCAATTT	NA	NA	NA	NA
WP_073544102.1|1046624_1047590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077900190.1|1047900_1048338_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_077634331.1|1048671_1048857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162780050.1|1049122_1049989_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.2	2.5e-50
WP_073544104.1|1049985_1050285_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_073544105.1|1050907_1054321_+	DEAD/DEAH box helicase family protein	NA	Q6NDX2	Leptospira_phage	26.0	1.9e-16
WP_000627731.1|1054384_1056019_+	N-6 DNA methylase	NA	J7I0U9	Acinetobacter_phage	30.6	1.0e-31
WP_001438891.1|1056027_1057098_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_073544106.1|1057222_1058812_-	hypothetical protein	NA	Q38324	Lactococcus_phage	24.2	7.5e-24
WP_001315830.1|1059202_1059373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077900207.1|1059610_1060357_+	porin family protein	NA	NA	NA	NA	NA
WP_073544108.1|1060531_1062031_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_073544109.1|1062139_1065655_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_001218820.1|1066106_1067369_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.8	4.5e-80
WP_073544110.1|1067747_1068455_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001400982.1|1068853_1070989_+	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_001298251.1|1071037_1072294_-	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_000760323.1|1072494_1073574_-	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_000091700.1|1073638_1073914_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001321419.1|1073941_1074994_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000786911.1|1075154_1075874_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001107564.1|1075873_1076200_+	YggL family protein	NA	NA	NA	NA	NA
WP_000984796.1|1076383_1077103_+	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_000394107.1|1077278_1078325_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000745230.1|1078441_1079449_+	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000239975.1|1079513_1080650_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_001174737.1|1080642_1081236_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_001277222.1|1081243_1081534_-	YggU family protein	NA	NA	NA	NA	NA
WP_001094831.1|1081530_1082097_-	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_000997795.1|1082114_1082819_-	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_012767756.1|1082836_1083817_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000017106.1|1084000_1084417_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_000126441.1|1084416_1085052_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000593273.1|1085088_1086039_-	glutathione synthase	NA	NA	NA	NA	NA
WP_001300912.1|1086051_1086783_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
1086162:1086176	attR	CAGTCATGGCAATTT	NA	NA	NA	NA
WP_000286500.1|1086862_1087570_-	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001300769.1|1087664_1088162_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP010137	Escherichia coli strain D2 chromosome, complete genome	4765647	1309734	1322917	4765647		Escherichia_phage(50.0%)	12	NA	NA
WP_001295182.1|1309734_1310496_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|1310489_1311116_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272590.1|1311255_1312395_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|1312457_1313450_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104441.1|1313543_1314908_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136918.1|1314996_1315773_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|1315777_1316416_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590405.1|1316412_1317675_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.0	8.3e-135
WP_000847985.1|1317671_1318580_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001272547.1|1318745_1319543_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.0	1.3e-69
WP_001141322.1|1319593_1320250_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_073544128.1|1320355_1322917_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	4.6e-31
>prophage 3
NZ_CP010137	Escherichia coli strain D2 chromosome, complete genome	4765647	1922153	1931595	4765647		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569357.1|1922153_1923080_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783120.1|1923084_1923816_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1923796_1923904_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1923963_1924695_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1924916_1926602_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1926598_1927318_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1927364_1927835_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001296231.1|1927875_1928337_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001400642.1|1928461_1930462_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.7	0.0e+00
WP_073544181.1|1930458_1931595_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	2.5e-162
>prophage 4
NZ_CP010137	Escherichia coli strain D2 chromosome, complete genome	4765647	2022655	2028966	4765647		Enterobacteria_phage(50.0%)	6	NA	NA
WP_001515525.1|2022655_2024050_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	3.7e-19
WP_000183060.1|2024224_2025118_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_001515524.1|2025489_2026575_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	2.3e-101
WP_001515523.1|2026574_2027474_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.5	8.2e-28
WP_001515522.1|2027531_2028410_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.4	1.3e-105
WP_001515521.1|2028414_2028966_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.3	6.8e-49
>prophage 5
NZ_CP010137	Escherichia coli strain D2 chromosome, complete genome	4765647	2459910	2512276	4765647	transposase,tail,lysis,holin,protease	Escherichia_phage(32.35%)	64	NA	NA
WP_001260835.1|2459910_2460732_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2460831_2460915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743942.1|2461007_2461343_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091840.1|2461739_2462993_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019525.1|2463099_2463993_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_073544230.1|2464127_2465348_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2465472_2466168_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001315626.1|2466120_2467413_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2467571_2468186_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526503.1|2468228_2469083_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2469084_2469702_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_073544438.1|2469712_2472136_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	2.8e-208
WP_073544231.1|2472196_2474623_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	1.0e-213
WP_001300836.1|2474821_2475127_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|2475234_2475945_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2475947_2476508_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|2476542_2476884_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2477018_2477345_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|2477550_2478765_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836067.1|2478776_2479796_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001360138.1|2479853_2479964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876991.1|2479983_2481264_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.1	1.9e-155
WP_001296941.1|2481298_2481535_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_073544233.1|2481622_2484094_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_073544234.1|2484187_2484379_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|2484375_2484564_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000159335.1|2485066_2485267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001320327.1|2485235_2485601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379591.1|2485612_2485765_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_001003381.1|2485957_2486365_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000476993.1|2486442_2486670_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705349.1|2486653_2487175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054487.1|2487155_2488121_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	2.6e-56
WP_001151189.1|2488161_2488563_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	95.5	2.4e-64
WP_073544235.1|2488781_2490569_-	DUF4209 domain-containing protein	NA	Q2P9X5	Enterobacteria_phage	23.1	1.2e-14
WP_000887491.1|2491186_2491399_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
WP_000980999.1|2491615_2491867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073544236.1|2491933_2492212_+	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	1.0e-05
WP_001723526.1|2492213_2493263_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.6	2.8e-112
WP_000780584.1|2493812_2494337_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	52.9	1.0e-46
WP_000592549.1|2494529_2495489_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_000169527.1|2496856_2497156_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000878218.1|2497152_2498019_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_000839588.1|2498059_2498275_+|holin	holin	holin	A5LH82	Enterobacteria_phage	91.5	1.2e-30
WP_000189900.1|2498279_2498831_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	51.1	1.0e-36
WP_001557934.1|2498778_2499039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101173.1|2499152_2499686_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.8	1.4e-96
WP_001071778.1|2499682_2500180_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_000066495.1|2500543_2500756_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071528545.1|2500766_2500955_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001443523.1|2501102_2501258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019207.1|2501430_2501604_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000548593.1|2501897_2502104_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
WP_000373425.1|2502656_2503151_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_162780053.1|2503150_2503582_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.1	3.4e-56
WP_077900195.1|2503646_2505995_+|tail	phage tail protein	tail	A0A0E3M0V5	Enterobacteria_phage	45.4	9.5e-92
WP_000654156.1|2505991_2506273_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	4.1e-18
WP_059332724.1|2506282_2506987_+	hypothetical protein	NA	A0A1X7QGH6	Escherichia_phage	61.7	1.2e-58
WP_000355603.1|2506997_2507291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000086527.1|2507518_2508109_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|2508424_2508658_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|2508726_2508840_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_073544238.1|2509443_2510727_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_073544239.1|2510815_2512276_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.4	9.5e-42
>prophage 6
NZ_CP010137	Escherichia coli strain D2 chromosome, complete genome	4765647	3224152	3232725	4765647	integrase	Salmonella_phage(84.62%)	14	3213974:3213988	3232800:3232814
3213974:3213988	attL	ATGGGTTTTTTGTTG	NA	NA	NA	NA
WP_001217575.1|3224152_3224386_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|3224396_3224585_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_073544318.1|3224737_3227110_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	96.8	0.0e+00
WP_001420002.1|3227109_3227931_-	hypothetical protein	NA	A0A0M4RCP6	Salmonella_phage	75.7	1.1e-122
WP_049066405.1|3227936_3228791_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	89.8	1.4e-146
WP_000752619.1|3228787_3229015_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	3.5e-36
WP_001244230.1|3229014_3229248_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.1e-32
WP_000963472.1|3229315_3229657_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.3e-55
WP_000956182.1|3229620_3229821_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_000460893.1|3229828_3230338_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_001247707.1|3230370_3230592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047324.1|3230717_3231287_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	42.9	4.2e-38
WP_001321204.1|3231302_3231494_+	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	68.2	4.0e-09
WP_000290933.1|3231672_3232725_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
3232800:3232814	attR	ATGGGTTTTTTGTTG	NA	NA	NA	NA
>prophage 7
NZ_CP010137	Escherichia coli strain D2 chromosome, complete genome	4765647	3529928	3539065	4765647	lysis	Enterobacteria_phage(66.67%)	17	NA	NA
WP_001135280.1|3529928_3530426_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.6	1.1e-90
WP_000839596.1|3530425_3530641_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737271.1|3531229_3532312_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_001204780.1|3532501_3532885_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_001316941.1|3532970_3533111_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	2.9e-09
WP_001099714.1|3533107_3533470_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	94.9	2.8e-59
WP_000774484.1|3533466_3533757_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	4.3e-47
WP_000224914.1|3533749_3533920_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_073544339.1|3533919_3534369_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	68.9	1.8e-60
WP_072097297.1|3534372_3534474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301145.1|3534568_3535351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000338665.1|3535525_3535849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000709067.1|3535960_3537487_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.7	7.9e-31
WP_001301135.1|3537544_3537694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070442.1|3537742_3538075_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|3538142_3538445_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_073544340.1|3538441_3539065_-	Replication protein P	NA	M1FJ72	Enterobacteria_phage	97.1	2.4e-111
>prophage 8
NZ_CP010137	Escherichia coli strain D2 chromosome, complete genome	4765647	3773386	3866787	4765647	portal,tail,integrase,holin,head,terminase,protease,plate,capsid	Shigella_phage(44.29%)	114	3822441:3822488	3862884:3862931
WP_000131044.1|3773386_3775420_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001301261.1|3775548_3776136_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089084.1|3776149_3777622_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159087.1|3777635_3779306_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.4	3.6e-61
WP_001209100.1|3779518_3780187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370307.1|3780429_3781125_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023927.1|3781117_3782545_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102108.1|3782555_3783275_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_073544352.1|3783801_3784656_-	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001046307.1|3784881_3786207_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
WP_073544353.1|3786315_3786552_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|3786563_3787157_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000621009.1|3787747_3788599_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000662258.1|3791403_3791505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073544354.1|3791868_3792132_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|3792131_3792272_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147279.1|3792306_3792534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301257.1|3793356_3793899_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000150118.1|3793924_3794560_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716394.1|3794617_3795286_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131058.1|3795311_3797837_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001301239.1|3797826_3799470_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001301243.1|3799438_3800149_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001303809.1|3800461_3800791_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000998331.1|3800820_3801033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001019920.1|3801037_3801652_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070679.1|3802068_3802758_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643325.1|3802754_3803711_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000667062.1|3803707_3805906_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.8	1.5e-38
WP_000122394.1|3805915_3806872_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111356.1|3806850_3807261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001350215.1|3807604_3807964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025693443.1|3807956_3808499_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_000188903.1|3808619_3808805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000617443.1|3809102_3809384_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001236873.1|3810058_3810244_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001444474.1|3810877_3811249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016231257.1|3811238_3811676_+	hypothetical protein	NA	I6S5X4	Salmonella_phage	33.1	3.1e-12
WP_073544355.1|3811737_3813843_-	injection protein	NA	A0A2I7QQN9	Vibrio_phage	37.1	2.1e-90
WP_001208878.1|3815942_3816314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000628967.1|3816306_3816648_-	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	61.5	2.5e-33
WP_001058748.1|3816658_3817261_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	36.3	2.6e-25
WP_073544356.1|3817253_3817475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024675.1|3817471_3817735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001065738.1|3817731_3817926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062871628.1|3817918_3818986_-	ash family protein	NA	A0A1C9IHV9	Salmonella_phage	38.4	8.6e-16
WP_000476150.1|3818979_3819162_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_032312024.1|3819154_3819988_-	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	47.5	5.3e-21
WP_000412531.1|3820000_3820432_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.7	2.3e-28
WP_000035054.1|3820431_3820635_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	50.9	4.7e-08
WP_000772643.1|3821062_3822277_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	9.7e-133
3822441:3822488	attL	AATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_000723924.1|3822881_3824348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001333214.1|3824663_3825083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000355484.1|3825587_3826361_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	2.4e-36
WP_000905043.1|3826421_3826976_-	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	86.7	1.4e-86
WP_071792122.1|3827002_3827575_+|tail	phage tail protein	tail	K7PH60	Enterobacterial_phage	58.7	2.1e-45
WP_000613358.1|3827574_3828168_+|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	64.4	2.7e-59
WP_000978831.1|3828139_3828583_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	62.4	3.3e-46
WP_000554682.1|3828582_3829206_-	hypothetical protein	NA	U5P0I1	Shigella_phage	70.1	1.3e-64
WP_016243480.1|3829209_3829794_-	YmfQ family protein	NA	O22003	Shigella_phage	99.0	7.0e-113
WP_016243479.1|3829784_3830843_-|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.3	5.2e-199
WP_139507341.1|3830829_3831255_-|tail	phage tail protein	tail	U5P0R9	Shigella_phage	98.6	1.1e-80
WP_001542670.1|3831254_3831803_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	96.2	5.2e-94
WP_073544358.1|3831802_3832882_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.2	1.7e-205
WP_073544359.1|3832878_3834207_-	DNA circularization protein	NA	Q8SBG8	Shigella_phage	97.5	1.9e-243
WP_000679479.1|3834268_3834799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024244102.1|3834890_3836723_-|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	97.4	9.1e-300
WP_000661054.1|3836864_3837134_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_000090998.1|3837133_3837490_-	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_033871492.1|3837489_3838986_-|tail	tail sheath protein	tail	M1FN90	Enterobacteria_phage	98.6	3.8e-272
WP_000497751.1|3838969_3839140_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_073519330.1|3839148_3839709_-	hypothetical protein	NA	Q8SBH4	Shigella_phage	98.9	6.8e-105
WP_000213502.1|3839705_3840212_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	100.0	1.7e-91
WP_000702398.1|3840186_3840597_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	100.0	3.1e-75
WP_000927710.1|3840593_3840917_-|head,tail	phage gp6-like head-tail connector protein	head,tail	S5FKK6	Shigella_phage	100.0	5.1e-57
WP_000601365.1|3840919_3841120_-	hypothetical protein	NA	S5FNU1	Shigella_phage	100.0	3.4e-27
WP_000257507.1|3841169_3842375_-|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	100.0	1.8e-224
WP_001193631.1|3842389_3843040_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_073544360.1|3843017_3844259_-|portal	phage portal protein	portal	U5P411	Shigella_phage	98.5	1.4e-240
WP_000605606.1|3844258_3844441_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_072011717.1|3844452_3845949_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.8	7.4e-300
WP_053877183.1|3846182_3846677_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	98.8	6.6e-88
WP_032201150.1|3846803_3847154_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	80.0	6.6e-50
WP_050437385.1|3847256_3847820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032201148.1|3847894_3848125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032201145.1|3848265_3848535_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	71.3	5.8e-22
WP_073544361.1|3848542_3849157_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	80.9	8.5e-93
WP_072020277.1|3849156_3849438_-|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	43.0	3.2e-15
WP_001283169.1|3849424_3849811_-	membrane protein	NA	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_044069184.1|3849890_3850148_-	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	94.1	6.1e-37
WP_044069185.1|3850298_3851051_-	antitermination protein	NA	Q8SBE4	Shigella_phage	99.6	6.2e-138
WP_073544362.1|3851064_3852054_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.5	3.4e-192
WP_073544363.1|3852061_3852859_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	1.5e-150
WP_044068991.1|3852878_3853268_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	4.6e-68
WP_000210181.1|3853264_3853591_-	LexA family transcriptional regulator	NA	U5P451	Shigella_phage	100.0	9.2e-54
WP_073544364.1|3853587_3854241_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	3.6e-126
WP_073544365.1|3854240_3854735_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	96.9	8.9e-85
WP_000104967.1|3854731_3855673_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	100.0	1.3e-153
WP_071595713.1|3855662_3855842_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	70.4	1.6e-15
WP_000515829.1|3856017_3856575_-	protein YmfL	NA	S5FXP0	Shigella_phage	96.2	1.1e-96
WP_000649477.1|3856618_3856819_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848748.1|3856909_3857584_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000549623.1|3857818_3858025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044068969.1|3857996_3858431_-	hypothetical protein	NA	U5P096	Shigella_phage	99.3	2.4e-78
WP_073544367.1|3858906_3859269_+	hypothetical protein	NA	U5P4J6	Shigella_phage	99.2	5.6e-60
WP_000081287.1|3859334_3860159_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_073544368.1|3860286_3860823_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	99.4	3.7e-100
WP_044068846.1|3860813_3861176_+	hypothetical protein	NA	U5P092	Shigella_phage	99.2	6.2e-67
WP_044068845.1|3861175_3861481_+	hypothetical protein	NA	U5P0J0	Shigella_phage	99.0	4.4e-50
WP_000433939.1|3861480_3861831_+	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	100.0	4.9e-61
WP_000051887.1|3861707_3862871_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000893272.1|3863075_3864329_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	7.5e-96
3862884:3862931	attR	AATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_073544369.1|3864340_3865444_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	3.1e-61
WP_000749881.1|3865731_3866787_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
>prophage 1
NZ_CP010138	Escherichia coli strain D2 plasmid A, complete sequence	83922	54804	78697	83922	transposase,integrase,protease	Escherichia_phage(44.44%)	29	59110:59169	78701:79520
WP_000616807.1|54804_55458_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|55550_55808_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|55740_56142_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001262765.1|56426_57737_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_000027057.1|58013_58874_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
59110:59169	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067858.1|59172_59877_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_065897011.1|60393_61305_+	EamA family transporter	NA	NA	NA	NA	NA
WP_000804064.1|61336_62536_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_031606906.1|62641_63268_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_042005022.1|63299_63536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000480972.1|63589_64426_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|64425_65229_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_001043260.1|65289_66105_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_024192851.1|66412_66625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|66649_67354_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000219391.1|67475_68381_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|68377_69616_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|69615_70200_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|70692_71457_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000130000.1|71683_71989_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000184001.1|71999_73205_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000376616.1|73360_73564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|73691_74531_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|74524_74872_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000503573.1|75077_75866_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_001389366.1|75996_76470_-	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_000845048.1|76627_77641_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_162780058.1|77609_78047_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_001067858.1|77992_78697_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
78701:79520	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCCCCCGTCGAGTATCTCAGTCAGATAGTCCGGGTGCACGAGCGTCATTGGGATGATGATGTCCTGCGAGTAATTCCTTCGAATCTCCCTGACCGCCGCGATCGTAAGTCCCCTCCACAAGGGGAGATCCTGATAGTCTCCGCTCGCTGGCATGGGGACCGTTTCTTTCACCACGAACCCGATTTCCTCGGGGTCAAAGATCAGCGATTTGGAACGCCGATCGCGCAGCCGCTTAGCGAGCGTCGTCTTTCCGGCGCCGAAAGGTCCGTTGATCCAGATTATCATTGTCGACGGCCTCTAACCTGAAGGCTCGCAAGAGCGCTCGACGGCCTCGTGCGGAGGCACGATCGGAGTGGTTCCGAAATGCTTCTCAAGATAGGTGACGCCGAACGTCACGATGTCCTGCGCGTCGAACAGGTAGCACTGAGCAAAGCCCACGACACCTTCTCGATGGCGACCGAGCTTCACGTAAGCATTTGCTATAGTTTCAACCGCATCCGGCTTTCCTTCGATAGCAAAGCAATCGAGAATGCCGTTTGAATCGTAATCCGATGCCGTTTTCCAGGCGACTTCACCGTCTCTTCCAAGCATCGGCATCTCATACGTCACCCACCGTTTGTTGGGGATATCGGCAACCGCCTCGGCGTAGTGCAATGCGGTAACGGAGTTTAGCGGCGCACCCAACAGCAGGGCCTTCCCGCCAAGGCGAACGAACCGCTCGACGGGCGATCCTTCCCCCAAGGCGTGACCGAGTTCGTGAGG	NA	NA	NA	NA
