The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010157	Escherichia coli strain D10 chromosome, complete genome	5112249	52431	61366	5112249	transposase	Stx2-converting_phage(66.67%)	6	NA	NA
WP_001282144.1|52431_52821_+	IS66 family insertion sequence hypothetical protein	NA	B6DZU5	Stx2-converting_phage	98.4	3.9e-67
WP_000612556.1|52817_53165_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	4.8e-61
WP_001593684.1|53260_54853_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.4	1.9e-181
WP_000624717.1|54883_55234_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	1.2e-40
WP_000422741.1|55230_55656_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_001360336.1|57868_61366_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	34.8	2.7e-98
>prophage 2
NZ_CP010157	Escherichia coli strain D10 chromosome, complete genome	5112249	842230	901914	5112249	transposase,protease	uncultured_marine_virus(22.22%)	55	NA	NA
WP_001034482.1|842230_846787_+|protease	lipoprotein metalloprotease SslE	protease	NA	NA	NA	NA
WP_001318036.1|846950_847760_+	prepilin peptidase PppA	NA	NA	NA	NA	NA
WP_001298257.1|847825_848236_+	type II secretion system pilot lipoprotein GspS-beta	NA	NA	NA	NA	NA
WP_001696202.1|848253_849213_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_001318034.1|849242_851303_+	type II secretion system secretin GspD	NA	NA	NA	NA	NA
WP_000249319.1|851302_852796_+	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_001173415.1|852795_854019_+	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_001087296.1|854035_854491_+	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_001115149.1|854494_855058_+	type II secretion system minor pseudopilin GspH	NA	NA	NA	NA	NA
WP_000820091.1|855054_855426_+	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_001318033.1|855422_856028_+	type II secretion system minor pseudopilin GspJ	NA	NA	NA	NA	NA
WP_073506912.1|856024_857002_+	type II secretion system minor pseudopilin GspK	NA	NA	NA	NA	NA
WP_000097200.1|856998_858177_+	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_000942807.1|858178_858715_+	GspM family type II secretion system protein YghD	NA	NA	NA	NA	NA
WP_039004748.1|858994_859837_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_023563519.1|859921_860119_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_057109034.1|860340_860718_-	toxin	NA	NA	NA	NA	NA
WP_001285610.1|860807_861176_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_057109035.1|861557_862034_-	RadC family protein	NA	NA	NA	NA	NA
WP_057109036.1|862049_862529_-	antirestriction protein	NA	NA	NA	NA	NA
WP_000997937.1|862628_862769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001175153.1|862794_863613_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.5	1.4e-47
WP_073506913.1|863702_863936_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_073506914.1|863941_864619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000010392.1|864737_865622_-	50S ribosome-binding GTPase	NA	NA	NA	NA	NA
WP_000147743.1|865806_866937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154675835.1|868127_868301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001075462.1|868480_869212_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001100705.1|869721_870174_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_164965929.1|870616_871845_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	1.1e-171
WP_000792543.1|872037_874086_+	TonB-dependent siderophore receptor IreA	NA	A0A0P0I887	Acinetobacter_phage	33.5	1.1e-11
WP_001126822.1|877816_878383_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000991576.1|878640_879213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000958152.1|879281_879518_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001167473.1|879784_880333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001349534.1|880351_880600_-	osmoprotectant transport activator ProQ	NA	Q2A0A1	Sodalis_phage	39.1	8.3e-07
WP_001323513.1|880668_880860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032346664.1|882452_882566_+|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	74.3	1.2e-08
WP_000919994.1|883389_883956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001043260.1|884196_885012_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_001445143.1|885294_885546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001349530.1|886166_886445_-	FaeA/PapI family transcriptional regulator	NA	NA	NA	NA	NA
WP_000930062.1|886867_887182_+	major pilus subunit operon regulatory protein PapB	NA	NA	NA	NA	NA
WP_021112574.1|887771_888980_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	99.8	5.2e-235
WP_035689358.1|888989_889361_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000428546.1|889493_890087_+	tetracyline resistance-associated transcriptional repressor TetC	NA	NA	NA	NA	NA
WP_001089068.1|890199_891405_-	tetracycline efflux MFS transporter Tet(B)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.4	3.0e-09
WP_000088605.1|891486_892110_+	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001284954.1|892087_892774_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000460651.1|892781_893168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000562370.1|893160_893481_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_000599533.1|893924_895130_+	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_021112574.1|895495_896704_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	99.8	5.2e-235
WP_000654934.1|897800_900311_+	P fimbrial usher protein PapC	NA	NA	NA	NA	NA
WP_073506915.1|900342_901914_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
>prophage 3
NZ_CP010157	Escherichia coli strain D10 chromosome, complete genome	5112249	1190971	1198111	5112249		Escherichia_phage(83.33%)	6	NA	NA
WP_001278992.1|1190971_1191610_-	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.8e-82
WP_000590398.1|1191606_1192869_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000848000.1|1192865_1193774_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.5e-117
WP_001318002.1|1193969_1194737_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	7.4e-70
WP_001141285.1|1194787_1195444_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.1	4.3e-50
WP_001272914.1|1195549_1198111_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.7	7.8e-31
>prophage 4
NZ_CP010157	Escherichia coli strain D10 chromosome, complete genome	5112249	1787161	1796606	5112249		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569336.1|1787161_1788088_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1788092_1788824_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1788804_1788912_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1788971_1789703_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1789924_1791610_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1791606_1792326_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1792372_1792843_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1792883_1793345_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_023154469.1|1793469_1795473_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.4	0.0e+00
WP_023154468.1|1795469_1796606_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	3.6e-161
>prophage 5
NZ_CP010157	Escherichia coli strain D10 chromosome, complete genome	5112249	2005031	2058579	5112249	portal,transposase,tail,head,holin,protease,capsid,integrase,terminase	Escherichia_phage(42.22%)	62	1986833:1986849	2016416:2016432
1986833:1986849	attL	ATCAGTCGTGAAGAGGC	NA	NA	NA	NA
WP_000480162.1|2005031_2006294_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	38.8	2.6e-72
WP_001300801.1|2006631_2007429_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533618.1|2007664_2008690_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	3.4e-102
WP_000096344.1|2008689_2008893_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_073506949.1|2008951_2011423_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.9	3.8e-59
WP_001090551.1|2011502_2011706_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449185.1|2011702_2011891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021522780.1|2012290_2012455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171942.1|2012458_2012677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042046576.1|2012748_2013048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000362153.1|2013374_2013794_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000391950.1|2013894_2014176_+	helix-turn-helix domain-containing protein	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
WP_000693888.1|2014159_2014585_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095673.1|2014607_2015570_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	51.2	1.6e-69
WP_000788950.1|2015576_2016323_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
WP_072692275.1|2016442_2017114_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	63.2	3.2e-69
2016416:2016432	attR	ATCAGTCGTGAAGAGGC	NA	NA	NA	NA
WP_001151165.1|2017129_2017555_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.3	4.8e-63
WP_000150294.1|2017729_2018395_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_000813254.1|2018631_2018787_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000737636.1|2018930_2019323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024175747.1|2019619_2019898_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.0	1.1e-12
WP_024195967.1|2019899_2020949_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.4e-108
WP_001217424.1|2020961_2021321_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	8.3e-40
WP_073506950.1|2021317_2022007_+	antiterminator	NA	I6PDF8	Cronobacter_phage	50.6	5.3e-59
WP_000839572.1|2022803_2023019_+|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_000193292.1|2023023_2023338_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	98.1	4.1e-51
WP_001274714.1|2023393_2023927_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	99.4	5.1e-102
WP_001228685.1|2024143_2024329_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	80.3	6.4e-20
WP_001114684.1|2024569_2025055_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000671993.1|2025299_2025500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001140099.1|2025507_2025858_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	98.3	1.2e-64
WP_001312917.1|2026005_2026488_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	97.5	4.3e-84
WP_001140903.1|2026487_2028245_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.7	0.0e+00
WP_000478564.1|2028256_2028439_+	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	95.0	2.5e-24
WP_000466255.1|2028438_2029680_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_001193631.1|2029657_2030308_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_000257522.1|2030322_2031528_+|capsid	phage major capsid protein	capsid	A0A1B5FPI9	Escherichia_phage	99.3	1.0e-222
WP_000601355.1|2031578_2031767_+	hypothetical protein	NA	A0A1B5FP98	Escherichia_phage	100.0	7.2e-27
WP_000983037.1|2031778_2032084_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B5FP86	Escherichia_phage	100.0	9.2e-40
WP_001147820.1|2032092_2032431_+|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	99.1	1.6e-56
WP_000347790.1|2032430_2032877_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	80.4	2.3e-63
WP_001209399.1|2032873_2033218_+	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	100.0	4.2e-57
WP_000097533.1|2033277_2033982_+	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	96.2	1.5e-117
WP_000164661.1|2033996_2034368_+|tail	phage tail assembly chaperone	tail	A0A1B5FP91	Escherichia_phage	100.0	6.5e-64
WP_000978930.1|2034391_2034670_+	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	97.8	3.6e-43
WP_073507074.1|2034716_2037944_+|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	94.7	0.0e+00
WP_001330090.1|2037921_2038278_+|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_001152456.1|2038277_2038976_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	96.6	4.4e-130
WP_032241748.1|2038980_2039724_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.7e-148
WP_000090949.1|2039660_2040263_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	84.7	2.6e-86
WP_048236358.1|2040323_2043719_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	90.5	0.0e+00
WP_001233121.1|2043786_2044386_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	93.0	7.2e-105
WP_073506951.1|2044450_2047864_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	37.3	1.8e-11
WP_048236353.1|2047863_2048445_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	92.7	3.0e-100
WP_001007767.1|2050035_2050686_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001240090.1|2050942_2051578_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_000740111.1|2051578_2052583_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_000920132.1|2052691_2053105_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_001340597.1|2053237_2053909_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.6	1.4e-32
WP_000826785.1|2053908_2055267_+	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	19.4	3.0e-05
WP_000218222.1|2055374_2056226_-	protein deglycase HchA	NA	NA	NA	NA	NA
WP_088895425.1|2057350_2058579_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
>prophage 6
NZ_CP010157	Escherichia coli strain D10 chromosome, complete genome	5112249	3155067	3249020	5112249	transposase,portal,tail,head,lysis,protease,capsid,integrase,terminase	Enterobacteria_phage(47.14%)	106	3212688:3212704	3256966:3256982
WP_000526135.1|3155067_3155526_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
WP_000056421.1|3155714_3156833_-	anion transporter	NA	NA	NA	NA	NA
WP_000091016.1|3156829_3157297_-	manganese-binding transcriptional regulator MntR	NA	NA	NA	NA	NA
WP_001001761.1|3157482_3157611_+	manganase accumulation protein MntS	NA	NA	NA	NA	NA
WP_001054648.1|3157882_3159466_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_001295296.1|3159514_3160030_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
WP_120795379.1|3160082_3160148_-	protein YliM	NA	NA	NA	NA	NA
WP_001295297.1|3160382_3161270_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_000100800.1|3161569_3162073_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_000843866.1|3162476_3163223_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_001159065.1|3163361_3164021_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000569080.1|3164017_3164740_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
WP_001267233.1|3164856_3167082_+	mechanosensitive channel protein	NA	NA	NA	NA	NA
WP_001275941.1|3167078_3168005_-	23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF	NA	NA	NA	NA	NA
WP_000710618.1|3168280_3168541_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000990165.1|3171300_3171978_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	4.0e-19
WP_000146357.1|3172051_3172318_+	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	3.1e-07
WP_000849301.1|3172582_3172843_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000253497.1|3173071_3174157_-	hydroxycarboxylate dehydrogenase HcXB	NA	NA	NA	NA	NA
WP_000386550.1|3174297_3175260_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_001218650.1|3175287_3177438_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	25.8	6.3e-42
WP_000007122.1|3177974_3179336_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001295890.1|3179564_3180236_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000743444.1|3180238_3181234_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001317737.1|3181226_3182963_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
WP_000070131.1|3182955_3184089_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000469031.1|3184099_3185206_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000871982.1|3185167_3185578_-	YbhQ family protein	NA	NA	NA	NA	NA
WP_001113346.1|3185710_3186472_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000650341.1|3186468_3187710_+	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
WP_000045467.1|3187709_3188666_+	UPF0104 family protein	NA	NA	NA	NA	NA
WP_000446942.1|3188701_3189091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373624.1|3189296_3190001_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000852287.1|3190137_3190590_-	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_000611260.1|3190591_3190837_-	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_000080885.1|3190829_3191315_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_000084639.1|3191317_3191830_-	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_039004040.1|3191851_3192841_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_001304790.1|3193237_3194146_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	8.3e-28
WP_000042533.1|3194337_3196359_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_000044831.1|3196937_3197615_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000246796.1|3197607_3198363_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_000638122.1|3198349_3199504_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_000951218.1|3199500_3200541_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_001696826.1|3200627_3201917_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.3	1.0e-18
WP_000767411.1|3201975_3202452_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_000246058.1|3203554_3204298_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001317842.1|3206020_3206602_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.2	4.7e-101
WP_001695589.1|3210068_3210668_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	4.1e-108
WP_073507010.1|3210738_3214236_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	98.0	0.0e+00
3212688:3212704	attL	CGGAAGATGGCAGCGTG	NA	NA	NA	NA
WP_050541368.1|3214296_3214899_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	4.7e-88
WP_001695586.1|3214835_3215579_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	8.6e-148
WP_001152632.1|3215584_3216283_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	9.5e-133
WP_000847345.1|3216282_3216612_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_001695584.1|3216608_3219170_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	89.4	0.0e+00
WP_000459480.1|3219162_3219597_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	2.0e-64
WP_001695582.1|3219578_3220001_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.0	2.6e-69
WP_021539112.1|3220016_3220757_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	96.7	8.9e-129
WP_001695579.1|3220764_3221160_-	MFS transporter	NA	A0A0K2FIF4	Enterobacteria_phage	98.5	5.0e-70
WP_001695577.1|3221156_3221735_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.4	1.7e-79
WP_000752994.1|3221746_3222100_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_001695575.1|3222111_3222507_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	8.2e-57
WP_001695574.1|3222548_3223574_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.2	7.3e-190
WP_001338090.1|3223629_3223962_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	6.5e-55
WP_033556695.1|3223971_3225291_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.9	1.4e-233
WP_039004547.1|3225271_3226873_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.5	2.7e-308
WP_000198149.1|3226869_3227076_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_039004545.1|3227072_3228998_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000453587.1|3228972_3229518_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001415975.1|3229906_3230101_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.9	4.3e-27
WP_000738421.1|3230462_3230756_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001228695.1|3230846_3231029_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001135252.1|3231245_3231743_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	95.8	7.9e-89
WP_000839597.1|3231742_3231958_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	2.6e-33
WP_000737280.1|3232530_3233628_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	77.1	6.7e-157
WP_001204791.1|3233817_3234201_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000971055.1|3234286_3234427_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001099702.1|3234423_3234786_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	94.8	3.6e-59
WP_000386641.1|3234992_3235334_-	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	95.6	6.2e-61
WP_001254223.1|3235336_3235513_-	NinE family protein	NA	K7PHE6	Enterobacteria_phage	98.3	1.4e-27
WP_000153280.1|3235509_3236037_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_000736903.1|3236033_3236474_-	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_000145926.1|3236547_3236838_-	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_000788877.1|3236834_3237536_-	Replication protein 14	NA	K7P6G2	Enterobacteria_phage	100.0	9.9e-130
WP_000185516.1|3237532_3238432_-	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	99.7	1.1e-173
WP_000251069.1|3238464_3238758_-	lambda phage CII family protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000437875.1|3238876_3239077_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_001274756.1|3239177_3239891_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_000708836.1|3240018_3240876_+	NYN domain-containing protein	NA	A4JWQ6	Burkholderia_virus	39.7	5.8e-39
WP_001317717.1|3241357_3241681_+	antitermination protein	NA	K7P718	Enterobacteria_phage	100.0	1.0e-52
WP_001278766.1|3241673_3242168_-	hypothetical protein	NA	K7P861	Enterobacteria_phage	99.4	1.4e-85
WP_000065373.1|3242424_3242793_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	99.2	7.6e-65
WP_001198858.1|3242865_3243006_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	3.3e-21
WP_000358700.1|3242998_3243142_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	95.7	1.8e-17
WP_000995439.1|3243216_3243513_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_001317715.1|3243518_3244304_+	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	99.2	4.1e-148
WP_000186851.1|3244300_3244981_+	YqaJ viral recombinase family protein	NA	Q6H9Z0	Enterobacteria_phage	100.0	1.2e-132
WP_000149532.1|3244977_3245160_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	96.7	2.8e-28
WP_000548531.1|3245132_3245324_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_077897612.1|3245334_3245616_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_000763363.1|3245714_3245936_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_001289879.1|3245932_3246481_+	ead/Ea22-like family protein	NA	K7PKY4	Enterobacterial_phage	58.2	7.7e-45
WP_000789830.1|3246611_3247310_+	DUF1311 domain-containing protein	NA	J9Q6K3	Salmonella_phage	81.0	1.6e-100
WP_000545745.1|3247546_3247714_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_001303849.1|3247753_3247972_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533645.1|3247949_3249020_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	1.5e-201
3256966:3256982	attR	CACGCTGCCATCTTCCG	NA	NA	NA	NA
>prophage 7
NZ_CP010157	Escherichia coli strain D10 chromosome, complete genome	5112249	3694091	3794826	5112249	transposase,portal,tail,lysis,holin,protease,integrase,terminase	Escherichia_phage(29.82%)	91	3745229:3745276	3790922:3790969
WP_000131040.1|3694091_3696125_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001314510.1|3696253_3696841_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_073507021.1|3696854_3698327_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159121.1|3698340_3700029_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.1	6.2e-61
WP_001362381.1|3701191_3701755_+	tyrosine-type DNA invertase FimX	NA	A0A2L1IV36	Escherichia_phage	52.7	1.8e-52
WP_001317642.1|3701813_3702608_+	LuxR family transcriptional regulator HyxR	NA	NA	NA	NA	NA
WP_001695470.1|3702761_3703523_+	protein HyxA	NA	NA	NA	NA	NA
WP_088435459.1|3704662_3705856_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_000003133.1|3706037_3706706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370406.1|3706946_3707642_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_073507022.1|3707634_3709062_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102115.1|3709072_3709792_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339603.1|3710319_3711174_-	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001046289.1|3711399_3712725_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	8.5e-114
WP_000474088.1|3712833_3713070_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001298546.1|3713081_3713675_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_001299025.1|3713834_3714704_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.7	9.3e-53
WP_000621016.1|3714952_3715810_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_073507023.1|3715934_3720182_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_001174468.1|3720747_3721599_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.1	8.8e-48
WP_001172276.1|3721625_3722615_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_000910706.1|3722645_3723539_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001317639.1|3723898_3724141_+	NADH-flavin oxidoreductase/NADH oxidase	NA	NA	NA	NA	NA
WP_000662258.1|3724621_3724723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803998.1|3725086_3725350_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|3725349_3725490_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_000389022.1|3726573_3727116_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730984.1|3727190_3727778_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716404.1|3727834_3728503_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_073507024.1|3728528_3731054_+	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_001265664.1|3731043_3732687_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_021525526.1|3732655_3733366_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_032148604.1|3733679_3734009_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019923.1|3734257_3734872_-	YagU family protein	NA	NA	NA	NA	NA
WP_000146236.1|3735086_3735272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000080195.1|3739740_3741354_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624722.1|3741384_3741735_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|3741731_3742157_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_001059463.1|3743808_3744303_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000772639.1|3744737_3745076_-	DUF4102 domain-containing protein	NA	E5AGD0	Erwinia_phage	48.6	5.6e-22
3745229:3745276	attL	AATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_059343318.1|3745765_3746509_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_085947598.1|3747186_3748349_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_000011690.1|3749469_3750108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059342854.1|3750104_3752093_-	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_073507026.1|3752646_3753231_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	4.6e-104
WP_073507027.1|3756826_3757426_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	93.5	6.1e-104
WP_073507028.1|3757493_3760973_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.6	0.0e+00
WP_126123293.1|3761033_3761642_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	6.4e-101
WP_073507030.1|3761578_3762322_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	1.5e-147
WP_001152385.1|3762327_3763026_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	100.0	6.0e-135
WP_000447248.1|3763035_3763365_-|tail	phage tail protein	tail	A0A291AWW9	Escherichia_phage	100.0	1.7e-60
WP_073507031.1|3763364_3766430_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.2	0.0e+00
WP_001161009.1|3766401_3766731_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001297778.1|3766739_3767126_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	99.2	3.6e-65
WP_000211099.1|3767186_3767930_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	99.6	3.0e-132
WP_001079398.1|3767941_3768343_-|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000677108.1|3768339_3768918_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	7.2e-102
WP_001283153.1|3768929_3769205_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|3769197_3769521_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_077897614.1|3769607_3771635_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	99.5	0.0e+00
WP_073507033.1|3771579_3773088_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	98.8	1.9e-287
WP_001072975.1|3773087_3773300_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_073507034.1|3773296_3775399_-|terminase	phage terminase large subunit family protein	terminase	K7PH40	Enterobacteria_phage	99.7	0.0e+00
WP_000373425.1|3775398_3775893_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_032259466.1|3776568_3776721_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	98.0	3.6e-21
WP_048266675.1|3776708_3777170_-|lysis	lysis protein	lysis	K7P6Y5	Enterobacteria_phage	90.8	4.4e-70
WP_001075798.1|3777166_3777781_-	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	99.0	1.4e-111
WP_000422366.1|3777780_3778062_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001283169.1|3778048_3778435_-|holin	phage holin family protein	holin	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_000220228.1|3778525_3779122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000609696.1|3779228_3779807_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	53.9	1.6e-45
WP_001433852.1|3779821_3780811_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	1.9e-195
WP_073507035.1|3780818_3781616_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	4.4e-150
WP_000767113.1|3781635_3782025_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210170.1|3782021_3782348_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_001758754.1|3782347_3782842_-	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	95.7	1.2e-84
WP_000061506.1|3782838_3783657_-	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	89.5	2.7e-126
WP_000933942.1|3783653_3783890_-	hypothetical protein	NA	A0A291AX25	Escherichia_phage	100.0	1.6e-39
WP_059309219.1|3783882_3784719_-	ash family protein	NA	Q8SBF3	Shigella_phage	92.4	3.7e-139
WP_000521508.1|3784715_3785267_-	hypothetical protein	NA	A0A291AWW8	Escherichia_phage	100.0	4.5e-101
WP_000649477.1|3785310_3785511_-	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848749.1|3785601_3786276_+	LexA family transcriptional regulator	NA	U5P0T5	Shigella_phage	99.6	6.0e-132
WP_000135680.1|3786944_3787307_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081270.1|3787372_3788197_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	1.7e-149
WP_001506964.1|3788324_3788861_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.9	1.4e-99
WP_073507037.1|3788851_3789214_+	hypothetical protein	NA	U5P092	Shigella_phage	98.3	5.2e-66
WP_000206735.1|3789213_3789519_+	hypothetical protein	NA	U5P0J0	Shigella_phage	99.0	1.5e-50
WP_000051887.1|3789745_3790909_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000893310.1|3791113_3792367_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	3.7e-95
3790922:3790969	attR	AATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|3792378_3793482_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749899.1|3793770_3794826_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	3.5e-118
>prophage 8
NZ_CP010157	Escherichia coli strain D10 chromosome, complete genome	5112249	4573278	4628197	5112249	transposase,portal,tail,head,lysis,holin,plate,protease,capsid,integrase,terminase	Enterobacteria_phage(33.33%)	67	4589213:4589259	4625409:4625455
WP_000208242.1|4573278_4573809_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293344.1|4573818_4575150_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000139496.1|4575216_4576143_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872909.1|4576235_4576721_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|4576805_4577051_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|4577476_4578322_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_000136788.1|4578344_4579853_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250644.1|4580023_4581034_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796345.1|4581130_4581877_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000323555.1|4581881_4582310_-	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000655986.1|4582336_4582636_-	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000155257.1|4582847_4583288_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802221.1|4583388_4583988_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216325.1|4584095_4584863_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000708998.1|4584917_4585673_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001045701.1|4585779_4586769_-	sulfate/thiosulfate ABC transporter substrate-binding protein Sbp	NA	NA	NA	NA	NA
WP_001318165.1|4587088_4588051_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001076742.1|4588231_4589134_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
4589213:4589259	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_000468308.1|4589370_4589589_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_073507052.1|4589670_4590834_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	98.4	3.8e-203
WP_000978888.1|4590833_4591313_-|tail	phage tail protein	tail	O64315	Escherichia_phage	98.7	7.3e-84
WP_073507053.1|4591327_4593775_-|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	97.8	0.0e+00
WP_000785970.1|4593767_4593887_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|4593919_4594195_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|4594251_4594770_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286680.1|4594782_4595973_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.4e-224
WP_073507054.1|4596292_4597192_-	hypothetical protein	NA	Q7Y4D2	Escherichia_virus	99.7	3.1e-168
WP_000972099.1|4597407_4597935_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	88.6	5.1e-86
WP_000104681.1|4597936_4599958_-|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	64.5	3.5e-260
WP_001285325.1|4599968_4600499_-|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	100.0	2.3e-102
WP_001121500.1|4600491_4601400_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.0	6.3e-161
WP_000127163.1|4601404_4601752_-	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001093714.1|4601748_4602384_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.6	2.6e-113
WP_073507055.1|4602467_4603253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042002651.1|4603324_4603777_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	97.3	1.7e-74
WP_021517192.1|4603769_4604237_-|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	97.4	7.4e-81
WP_001300730.1|4604199_4604373_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_001695628.1|4604344_4604770_-|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	97.2	1.0e-65
WP_073507056.1|4604757_4605183_-	protein lysA	NA	Q858W1	Yersinia_virus	88.7	7.2e-59
WP_001144101.1|4605197_4605695_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123123.1|4605694_4605976_-|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001298859.1|4606179_4607721_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001016257.1|4607735_4608482_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_073507057.1|4608535_4608769_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.6e-31
WP_000988633.1|4608768_4609278_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_073507058.1|4609377_4610121_-|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	96.4	2.1e-125
WP_001248569.1|4610124_4611198_-|capsid	phage major capsid protein, P2 family	capsid	Q94MH9	Enterobacteria_phage	99.7	3.9e-202
WP_001297840.1|4611256_4612111_-|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	97.9	2.4e-133
WP_073507059.1|4612284_4614057_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_000038165.1|4614056_4615091_+|portal	phage portal protein	portal	M1SV64	Escherichia_phage	99.7	4.2e-201
WP_061348396.1|4615478_4616483_+	DNA adenine methylase	NA	M4SLI5	Cyanophage	23.4	1.3e-05
WP_061348395.1|4616485_4617505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061348401.1|4617508_4618624_-	ParB/RepB/Spo0J family partition protein	NA	Q858T2	Yersinia_virus	26.5	1.5e-18
WP_061348400.1|4619041_4619494_-	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	98.0	6.5e-82
WP_073507060.1|4619493_4621779_-	replication endonuclease	NA	Q858T4	Yersinia_virus	97.4	0.0e+00
WP_000027667.1|4621768_4622044_-	DUF5405 family protein	NA	Q858T5	Yersinia_virus	100.0	3.8e-45
WP_001534949.1|4622040_4622265_-	TraR/DksA C4-type zinc finger protein	NA	S4TRY6	Salmonella_phage	98.6	8.5e-35
WP_073507061.1|4622264_4622567_-	DUF5405 family protein	NA	Q7Y4C1	Escherichia_virus	98.0	8.5e-46
WP_000557703.1|4622566_4622791_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217671.1|4622854_4623355_-	hypothetical protein	NA	S4TTB7	Salmonella_phage	99.4	1.7e-91
WP_024210514.1|4623351_4623549_-	hypothetical protein	NA	S4TNZ7	Salmonella_phage	96.9	1.8e-28
WP_000453534.1|4623524_4623797_-	hypothetical protein	NA	Q1JS44	Enterobacteria_phage	100.0	1.5e-46
WP_001192857.1|4623949_4624243_+	helix-turn-helix domain-containing protein	NA	Q1JS45	Enterobacteria_phage	100.0	1.0e-48
WP_000023386.1|4624312_4625293_+|integrase	tyrosine-type recombinase/integrase	integrase	U5N0A8	Enterobacteria_phage	99.7	2.3e-185
WP_001223800.1|4625478_4625979_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4625409:4625455	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_001033720.1|4626128_4626827_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|4626823_4628197_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
>prophage 1
NZ_CP010158	Escherichia coli strain D10 plasmid A, complete sequence	128612	41945	113235	128612	transposase,integrase,protease	Macacine_betaherpesvirus(23.08%)	37	35213:35228	90603:90618
35213:35228	attL	GGCATGAACAACCAGA	NA	NA	NA	NA
WP_073507091.1|41945_42917_+|transposase	IS110-like element ISEc32 family transposase	transposase	Q75QL1	Wolbachia_phage	32.1	1.1e-25
WP_000092896.1|43177_43390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001513511.1|44822_45161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000817028.1|45972_46944_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	96.6	8.8e-169
WP_001238646.1|46943_48110_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	99.7	1.6e-228
WP_000715078.1|49261_50764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000238252.1|51381_51831_-	hypothetical protein	NA	A0A222YWI5	Escherichia_phage	67.1	5.0e-42
WP_000190054.1|51948_52428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000163251.1|52867_53530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000973517.1|54761_56963_-	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_001312878.1|57044_58322_-	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_001015721.1|58318_60061_-	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_000011907.1|60060_61008_-	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_000602863.1|61008_62733_-	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_000095526.1|62868_64062_+	MFS transporter	NA	NA	NA	NA	NA
WP_001318207.1|64441_64822_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	55.0	1.9e-26
WP_000968139.1|66064_66922_-	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_073507092.1|66918_67776_-	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000983712.1|67772_68600_-	iron/manganese ABC transporter ATP-binding protein SitB	NA	A0A1M7XV31	Cedratvirus	27.0	6.2e-14
WP_000949004.1|68599_69514_-	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_000361611.1|72495_73473_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	63.9	4.6e-101
WP_001066954.1|73757_74498_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.2e-24
WP_001312821.1|74618_74807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001312822.1|75180_76083_-	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
WP_000771475.1|76151_77261_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000280980.1|77693_78647_-|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_001312823.1|79919_80078_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_162842477.1|80261_81474_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	2.7e-167
WP_000928803.1|82928_84116_+	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	55.7	1.0e-09
WP_000733250.1|84112_86053_+	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	39.0	1.8e-35
WP_001312828.1|86056_87427_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_000974762.1|88223_89165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450495.1|91425_92619_-	GTP-binding protein	NA	NA	NA	NA	NA
90603:90618	attR	TCTGGTTGTTCATGCC	NA	NA	NA	NA
WP_000738422.1|95698_95992_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_000933675.1|104143_105373_+	catecholate siderophore esterase IroD	NA	NA	NA	NA	NA
WP_000271276.1|105457_106414_+	catecholate siderophore esterase IroE	NA	NA	NA	NA	NA
WP_073507094.1|109101_113235_-|protease	temperature-sensitive protease autotransporter hemagglutinin Tsh	protease	Q9LA54	Enterobacteria_phage	41.7	6.6e-298
