The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010172	Escherichia coli strain H8 chromosome, complete genome	4929892	10199	137315	4929892	integrase,protease,plate,tail,portal,terminase,transposase,lysis	Enterobacteria_phage(31.03%)	110	54569:54628	99095:99154
WP_085967273.1|10199_11412_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.8	2.6e-101
WP_000706914.1|11632_11767_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001091891.1|13018_14413_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000194408.1|14517_15549_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_000671481.1|15523_16543_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_001094740.1|16606_17320_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	37.7	5.2e-17
WP_000849708.1|20336_20615_+	DUF5339 domain-containing protein	NA	NA	NA	NA	NA
WP_001033555.1|20952_21984_-	isoaspartyl peptidase/L-asparaginase	NA	NA	NA	NA	NA
WP_001333102.1|22507_22954_-	maturase	NA	NA	NA	NA	NA
WP_000598813.1|23599_24961_-	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
WP_000355772.1|24957_26214_-	peptidase T	NA	NA	NA	NA	NA
WP_000086506.1|27079_28480_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_000351505.1|28635_29970_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_063625918.1|30457_31504_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_001067029.1|32097_32823_-	two-component system response regulator DcuR	NA	NA	NA	NA	NA
WP_000361270.1|33801_34458_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000455810.1|35983_37363_+	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_000887498.1|37373_37685_+	PTS cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_085967274.1|38757_39931_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	72.5	5.0e-134
WP_085949199.1|39996_41270_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.0	6.6e-172
WP_000282090.1|42031_42595_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_085967274.1|44052_45226_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	72.5	5.0e-134
WP_113262936.1|45458_46304_+	mobilization protein	NA	NA	NA	NA	NA
WP_001296720.1|46562_47270_-	replication initiation protein	NA	A0A218MNI2	uncultured_virus	27.9	1.3e-15
WP_000091749.1|47800_48055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000120392.1|50705_50933_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000266639.1|51038_51266_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001186448.1|51972_53589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024233400.1|53675_54272_-	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	87.9	2.9e-98
54569:54628	attL	CTTATTGATTTAAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_063118745.1|55011_59466_-	hypothetical protein	NA	A0A2H4PQV1	Staphylococcus_phage	32.4	1.1e-43
WP_063628607.1|60003_60588_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.4	1.4e-105
WP_072644212.1|60587_63866_-|tail	phage tail protein	tail	X2KTY7	Enterobacteria_phage	58.8	6.5e-06
WP_001233090.1|63930_64530_-	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
WP_001309913.1|68159_68807_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.7	2.5e-111
WP_032151194.1|68704_69448_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.0	2.3e-148
WP_063628598.1|69453_70152_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.6	3.0e-134
WP_039023164.1|70161_70491_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	99.1	1.7e-60
WP_044064114.1|70490_73556_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.4	0.0e+00
WP_001161009.1|73527_73857_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001440689.1|73865_74252_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	99.2	6.1e-65
WP_000211109.1|74312_75056_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	100.0	7.8e-133
WP_001079398.1|75067_75469_-|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_032171305.1|75465_76044_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	1.6e-101
WP_001283144.1|76055_76331_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	8.6e-45
WP_032171307.1|76323_76647_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	99.1	9.4e-51
WP_077777969.1|76733_78761_-|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.4	0.0e+00
WP_052249886.1|78744_80214_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.8	3.1e-282
WP_001072975.1|80213_80426_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_025670557.1|80422_82525_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	97.1	0.0e+00
WP_000349509.1|82524_83016_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_021512737.1|83691_83844_-	hypothetical protein	NA	A0A291AWZ2	Escherichia_phage	98.0	4.7e-21
WP_001341210.1|83831_84299_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	100.0	7.7e-78
WP_001135250.1|84295_84793_-	lysozyme RrrD	NA	A0A291AWW2	Escherichia_phage	100.0	4.5e-92
WP_000839596.1|84792_85008_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000799656.1|85075_86128_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
WP_001504956.1|86277_86472_-	hypothetical protein	NA	Q8SBE3	Shigella_phage	100.0	5.1e-28
WP_032083250.1|86884_88336_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_001504953.1|88508_88880_-	phage antitermination Q family protein	NA	Q777W5	Enterobacteria_phage	82.5	6.1e-54
WP_001360050.1|88897_89887_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_001061450.1|89894_90704_-	KilA-N domain-containing protein	NA	S5MC03	Escherichia_phage	100.0	8.2e-152
WP_000767133.1|90723_91113_-	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	99.2	1.6e-68
WP_000210181.1|91109_91436_-	LexA family transcriptional regulator	NA	U5P451	Shigella_phage	100.0	9.2e-54
WP_072644209.1|91435_91930_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.6e-86
WP_000061531.1|91926_92745_-	helix-turn-helix domain-containing protein	NA	Q8SBF1	Shigella_phage	99.6	5.2e-122
WP_063628585.1|92970_93807_-	ash family protein	NA	Q8SBF3	Shigella_phage	91.0	2.9e-136
WP_063628586.1|93803_94355_-	protein YmfL	NA	S5FXP0	Shigella_phage	96.2	6.7e-97
WP_000649477.1|94398_94599_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848748.1|94689_95364_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000917896.1|95536_95833_+	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
WP_000008235.1|96509_97046_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.9	8.2e-100
WP_032301943.1|97036_97399_+	phage protein	NA	U5P092	Shigella_phage	98.3	1.0e-66
WP_000627693.1|97398_97704_+	hypothetical protein	NA	U5P0J0	Shigella_phage	99.0	3.4e-50
WP_000433939.1|97703_98054_+	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	100.0	4.9e-61
WP_000051894.1|97930_99094_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.5	4.5e-228
WP_000893278.1|99298_100552_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
99095:99154	attR	CTTATTGATTTAAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|100563_101667_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749867.1|101954_103010_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	1.6e-118
WP_000174677.1|103048_103450_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189532.1|103507_104752_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|104843_105302_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001292994.1|105562_107020_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001326471.1|107076_107613_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001295202.1|107545_107812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059892.1|108117_108570_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263489.1|108579_108978_-	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_000554758.1|108980_109274_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226164.1|109325_110381_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000207552.1|110451_111237_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001334802.1|111181_112921_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000006255.1|113144_113642_-|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_000056849.1|113817_114567_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.5	9.0e-20
WP_000729703.1|114776_115037_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000615983.1|115039_115318_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|115473_116214_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333380.1|116184_116952_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|117157_117736_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973083.1|117975_120420_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532698.1|120462_120936_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118036.1|121089_121860_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000420818.1|121900_123037_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001101839.1|123467_123860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000508724.1|123837_128070_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.1	6.4e-22
WP_032329316.1|128145_130287_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	2.4e-25
WP_001142958.1|130496_131015_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037397.1|131709_132210_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|132244_132469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056989.1|132519_133995_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000611744.1|134001_134415_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393852.1|134418_136269_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348793.1|136232_137315_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 2
NZ_CP010172	Escherichia coli strain H8 chromosome, complete genome	4929892	1884556	1945036	4929892	transposase	Escherichia_phage(13.33%)	57	NA	NA
WP_001067855.1|1884556_1885261_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000779483.1|1886084_1886411_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_025492088.1|1886407_1886671_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_032153714.1|1886742_1887609_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000839265.1|1887693_1887891_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_023155722.1|1887902_1888394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854735.1|1888390_1888768_-	toxin	NA	NA	NA	NA	NA
WP_032153712.1|1888814_1889189_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692345.1|1889268_1889490_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001186715.1|1889558_1890035_-	RadC family protein	NA	NA	NA	NA	NA
WP_032153711.1|1890050_1890536_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	9.0e-13
WP_001234693.1|1890627_1891446_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.0	1.6e-46
WP_023155727.1|1891536_1891746_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_023155728.1|1891775_1892453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024166630.1|1892571_1893456_-	GTPase	NA	NA	NA	NA	NA
WP_023155730.1|1893562_1894495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032153709.1|1894491_1895301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032153707.1|1897051_1897783_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001067608.1|1898967_1900572_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_032153705.1|1902168_1902735_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_001421645.1|1902854_1903004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032153703.1|1903018_1903591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000958154.1|1903659_1903896_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_032153702.1|1904164_1904713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_131501864.1|1906833_1906947_+|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	71.4	3.4e-08
WP_001043260.1|1908604_1909420_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_001082319.1|1909480_1910284_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|1910283_1911120_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_000844627.1|1911425_1911668_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000164043.1|1911699_1912350_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_032153701.1|1912455_1913655_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_001255015.1|1913921_1914227_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023300759.1|1914254_1915469_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
WP_021598067.1|1915685_1916570_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_021512463.1|1917190_1917457_-	P fimbrial regulatory protein KS71A	NA	NA	NA	NA	NA
WP_000930062.1|1917891_1918206_+	major pilus subunit operon regulatory protein PapB	NA	NA	NA	NA	NA
WP_000271619.1|1919126_1920359_-	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_000878218.1|1920509_1921376_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_161954780.1|1921372_1921603_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000174035.1|1921838_1922819_+	thymidylate synthase	NA	A0A218MLB7	uncultured_virus	34.2	7.3e-22
WP_000820616.1|1922815_1923760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000637419.1|1923762_1924845_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A075BTZ7	Microcystis_phage	38.6	5.5e-10
WP_032153698.1|1925311_1925578_+	hypothetical protein	NA	A0A1L2CUJ8	Pectobacterium_phage	71.6	1.0e-26
WP_000438165.1|1926999_1930413_+	DEAD/DEAH box helicase family protein	NA	Q6NDX2	Leptospira_phage	26.2	8.5e-17
WP_000627728.1|1930476_1932111_+	N-6 DNA methylase	NA	J7I0U9	Acinetobacter_phage	30.9	2.6e-32
WP_000742120.1|1932107_1933250_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_000778955.1|1933258_1934881_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000499115.1|1934880_1935777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000571844.1|1936398_1937145_+	porin family protein	NA	NA	NA	NA	NA
WP_000228490.1|1937564_1938461_+	WYL domain-containing protein	NA	A0A0R6PH67	Moraxella_phage	27.3	2.1e-31
WP_001207396.1|1938509_1939589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001100182.1|1939635_1941207_+	ATP--cob(I)alamin adenosyltransferase	NA	NA	NA	NA	NA
WP_000766274.1|1941203_1941470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001238004.1|1941609_1941807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025492097.1|1941859_1943533_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_032153697.1|1943676_1944711_-	tetratricopeptide repeat family protein	NA	NA	NA	NA	NA
WP_023181049.1|1944760_1945036_+|transposase	IS1 family transposase	transposase	Q71TE9	Escherichia_phage	97.8	3.8e-45
>prophage 3
NZ_CP010172	Escherichia coli strain H8 chromosome, complete genome	4929892	2620914	2679024	4929892	integrase,transposase	Stx2-converting_phage(28.57%)	41	2607209:2607227	2679200:2679218
2607209:2607227	attL	TGGTGTCCCCTGCAGGAAT	NA	NA	NA	NA
WP_001610790.1|2620914_2621517_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E036	Clostridioides_phage	33.3	1.8e-07
WP_000998321.1|2621821_2624134_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001493615.1|2624130_2625066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072646255.1|2625876_2627052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000804439.1|2629017_2629620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001347898.1|2629713_2629920_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_072646250.1|2630303_2631095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072146520.1|2632162_2632312_+	hemolysin activation protein	NA	NA	NA	NA	NA
WP_000860849.1|2632543_2633143_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_085947772.1|2633324_2634537_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_000270955.1|2634775_2635159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001610781.1|2635155_2635581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154675828.1|2635925_2636093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001610777.1|2638784_2639813_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001610775.1|2639861_2640290_-	heme-binding protein	NA	NA	NA	NA	NA
WP_001610774.1|2640282_2641188_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_001610773.1|2641181_2642009_-	SDR family oxidoreductase	NA	A0A167REC2	Powai_lake_megavirus	29.2	5.3e-05
WP_001610772.1|2642032_2643136_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	NA	NA	NA	NA
WP_001610771.1|2643193_2644648_-	MFS transporter	NA	NA	NA	NA	NA
WP_001610770.1|2644790_2646446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001610769.1|2646463_2648071_-	FGGY-family carbohydrate kinase	NA	NA	NA	NA	NA
WP_077250878.1|2648908_2649199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032158436.1|2649923_2650601_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	2.5e-21
WP_001610764.1|2650600_2650948_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000906844.1|2652486_2653158_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001361993.1|2653205_2653565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000186596.1|2654325_2654613_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_000950719.1|2654606_2654945_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_000088311.1|2658510_2658813_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001361988.1|2658848_2659655_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.4	8.3e-64
WP_000864948.1|2660210_2661236_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_072646253.1|2661207_2662497_-	MFS transporter	NA	NA	NA	NA	NA
WP_123863910.1|2663730_2664021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000424707.1|2664771_2667081_+	ATPase	NA	NA	NA	NA	NA
WP_000117528.1|2667084_2668401_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_001610752.1|2668397_2670596_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_000100142.1|2671077_2672094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839828.1|2672737_2675098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000165811.1|2675274_2675574_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000160236.1|2676410_2676566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001131472.1|2677833_2679024_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	57.3	7.6e-130
2679200:2679218	attR	TGGTGTCCCCTGCAGGAAT	NA	NA	NA	NA
>prophage 4
NZ_CP010172	Escherichia coli strain H8 chromosome, complete genome	4929892	2957382	3021823	4929892	integrase,transposase,tRNA,capsid	Bacillus_phage(20.0%)	55	2988746:2988761	3019928:3019943
WP_038991242.1|2957382_2958741_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_064141402.1|2958854_2960300_+	ATP-binding protein	NA	E5E3R2	Burkholderia_phage	27.1	4.9e-06
WP_072646268.1|2960458_2961013_-|integrase	tyrosine-type recombinase/integrase	integrase	Q8SBK8	Clostridium_phage	32.9	4.6e-13
WP_032439230.1|2962001_2962361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032719880.1|2963072_2963501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023286072.1|2963709_2963901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072646270.1|2963875_2964505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072646271.1|2964520_2965063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072646272.1|2965224_2965572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072646273.1|2965571_2967728_+	chemotaxis protein	NA	NA	NA	NA	NA
WP_064182896.1|2968369_2968705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072646274.1|2968726_2969785_+|capsid	major capsid protein E	capsid	NA	NA	NA	NA
WP_064151542.1|2969850_2970063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064182910.1|2970189_2970564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072646275.1|2971048_2971837_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822274.1|2971833_2972634_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_012135921.1|2972698_2973517_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	1.9e-23
WP_000434038.1|2973568_2974315_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011957.1|2974288_2975254_-	sugar kinase	NA	NA	NA	NA	NA
WP_000846231.1|2975250_2976255_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.0	6.4e-13
WP_000858484.1|2976251_2977529_-	nucleoside permease	NA	NA	NA	NA	NA
WP_000129551.1|2977785_2978838_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_073529377.1|2979145_2980000_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_001741990.1|2980028_2981291_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182899.1|2981300_2981753_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823270.1|2981783_2982068_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490679.1|2982071_2983427_+	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000844219.1|2983474_2984515_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_023157455.1|2984614_2985394_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807356.1|2985475_2986375_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.7e-12
WP_001318299.1|2986780_2987098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000476014.1|2987428_2988790_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
2988746:2988761	attL	ATTTTTCAGCGTTCCC	NA	NA	NA	NA
WP_000929408.1|2988936_2989269_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137877.1|2989459_2990182_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000675150.1|2990178_2991582_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
WP_000130850.1|2991578_2992994_-	MFS transporter	NA	NA	NA	NA	NA
WP_072643228.1|2992994_2996072_-	multidrug efflux RND transporter permease subunit MdtC	NA	NA	NA	NA	NA
WP_001197905.1|2996072_2999195_-	multidrug efflux RND transporter permease subunit MdtB	NA	NA	NA	NA	NA
WP_000679011.1|2999194_3000442_-	multidrug efflux RND transporter subunit MdtA	NA	NA	NA	NA	NA
WP_001386899.1|3000720_3000777_+	type I toxin-antitoxin system Ibs family toxin	NA	NA	NA	NA	NA
WP_010723109.1|3001049_3001109_+	type I toxin-antitoxin system toxin IbsA	NA	NA	NA	NA	NA
WP_000003154.1|3001329_3001989_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000119090.1|3001985_3002747_+	protein-serine/threonine phosphatase PphC	NA	NA	NA	NA	NA
WP_000722348.1|3002811_3003273_-	YegJ family protein	NA	NA	NA	NA	NA
WP_000856085.1|3003472_3005419_+	protein kinase YegI	NA	NA	NA	NA	NA
WP_000469697.1|3005431_3006784_-	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	21.1	7.1e-07
WP_000288400.1|3006917_3007766_+	DNA-3-methyladenine glycosylase 2	NA	NA	NA	NA	NA
WP_073529378.1|3007883_3011201_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_001295424.1|3011518_3012160_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
WP_001234767.1|3012251_3012833_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_073529379.1|3012854_3014708_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_016230728.1|3015159_3017850_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0R6PEZ3	Moraxella_phage	43.1	9.3e-35
WP_024192426.1|3018602_3019493_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	40.3	1.6e-44
WP_160348101.1|3019768_3020623_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.7e-68
3019928:3019943	attR	ATTTTTCAGCGTTCCC	NA	NA	NA	NA
WP_001254932.1|3020671_3021823_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
>prophage 5
NZ_CP010172	Escherichia coli strain H8 chromosome, complete genome	4929892	4005557	4029211	4929892	holin	Escherichia_phage(30.43%)	33	NA	NA
WP_000102136.1|4005557_4007999_-	exonuclease	NA	V5UQJ3	Shigella_phage	46.9	3.1e-114
WP_001070255.1|4008092_4008284_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000854558.1|4008280_4008469_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001517906.1|4008869_4009073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171946.1|4009037_4009256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001092153.1|4009348_4009549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001420344.1|4009980_4010319_-	peptidase S24	NA	H9C160	Pectobacterium_phage	32.0	2.5e-06
WP_000747951.1|4010710_4010953_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693850.1|4010936_4011362_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262390.1|4011433_4012504_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	56.6	2.6e-52
WP_001151150.1|4012544_4012967_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.6e-64
WP_000761441.1|4012967_4013381_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	2.0e-58
WP_001224662.1|4013474_4013657_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_011076332.1|4014270_4014489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001013636.1|4014691_4014904_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
WP_032155008.1|4015071_4015350_+	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
WP_001221526.1|4015351_4016410_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.0	7.5e-89
WP_000139999.1|4016410_4016791_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	1.3e-35
WP_072646276.1|4016787_4017642_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.2	4.1e-77
WP_106104550.1|4017995_4018082_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001333559.1|4018570_4018783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001333560.1|4018853_4019189_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	1.4e-44
WP_000874243.1|4019449_4019638_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
WP_001333561.1|4019634_4019796_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	87.0	5.9e-14
WP_000372595.1|4019945_4020161_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_000193264.1|4020165_4020516_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
WP_000992097.1|4020579_4021113_+	lysozyme	NA	Q08J98	Stx2-converting_phage	93.2	1.5e-98
WP_075202333.1|4021329_4021512_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	77.0	2.2e-17
WP_000738421.1|4021602_4021896_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001189123.1|4023818_4025327_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_000241001.1|4026004_4026673_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000799406.1|4027227_4028091_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|4028074_4029211_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
>prophage 6
NZ_CP010172	Escherichia coli strain H8 chromosome, complete genome	4929892	4436686	4496466	4929892	integrase,head,tail,holin,portal,terminase,lysis,transposase,capsid	Enterobacteria_phage(36.73%)	71	4468846:4468862	4501161:4501177
WP_000527809.1|4436686_4438147_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.5e-42
WP_000347482.1|4438235_4439519_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|4440123_4440237_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|4440305_4440539_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000078177.1|4440855_4441446_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885611.1|4441543_4442119_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_072646389.1|4442118_4445193_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	81.4	2.1e-67
WP_001233090.1|4445257_4445857_-	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
WP_000090891.1|4449486_4450119_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_072646391.1|4450055_4450799_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.1	5.7e-144
WP_044861874.1|4450804_4451503_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	6.2e-132
WP_000847345.1|4451502_4451832_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_072646392.1|4451828_4454390_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.1	0.0e+00
WP_000459457.1|4454382_4454817_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479155.1|4454798_4455221_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	99.3	1.9e-72
WP_072646397.1|4455236_4455977_-|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	97.2	2.1e-130
WP_000683117.1|4455984_4456380_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	6.5e-70
WP_072646393.1|4456376_4456955_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	1.7e-79
WP_000752994.1|4456966_4457320_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000158868.1|4457331_4457727_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_032140162.1|4457768_4458794_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	96.8	3.8e-186
WP_024238048.1|4458849_4459182_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
WP_072646394.1|4459191_4460511_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	2.6e-232
WP_072646395.1|4460491_4462093_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.8	2.7e-311
WP_000198149.1|4462089_4462296_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_072646396.1|4462292_4464218_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000453611.1|4464192_4464738_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_001307652.1|4465126_4465321_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000548590.1|4465571_4465778_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	77.9	5.8e-22
WP_001019207.1|4466073_4466247_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_085949199.1|4466466_4467739_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.0	6.6e-172
WP_001443523.1|4467755_4467911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071528545.1|4468058_4468247_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|4468257_4468470_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071778.1|4468833_4469331_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
4468846:4468862	attL	TTTTTTATCTCTTAAAG	NA	NA	NA	NA
WP_001101173.1|4469327_4469861_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.8	1.4e-96
WP_001557934.1|4469974_4470235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000189900.1|4470182_4470734_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	51.1	1.0e-36
WP_000839588.1|4470738_4470954_-|holin	holin	holin	A5LH82	Enterobacteria_phage	91.5	1.2e-30
WP_001146314.1|4471144_4471858_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_072646420.1|4472264_4473224_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_001616188.1|4473416_4473941_+	outer membrane lipoprotein Blc	NA	A0A1W6JNX6	Morganella_phage	52.9	1.3e-46
WP_001204787.1|4474096_4474474_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	82.5	1.8e-53
WP_001265274.1|4474491_4475541_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	58.2	3.0e-114
WP_012775982.1|4475542_4475821_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000980999.1|4475887_4476139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072646419.1|4476355_4476568_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.5e-28
WP_021533427.1|4477253_4477949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021533428.1|4477961_4478615_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_021533429.1|4478929_4479829_-	SMEK domain-containing protein	NA	NA	NA	NA	NA
WP_021533430.1|4480081_4480504_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.8	4.8e-63
WP_000054495.1|4480544_4481510_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	3.4e-56
WP_072646418.1|4481490_4482012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000921596.1|4481995_4482223_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000381212.1|4482303_4482711_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
WP_072646417.1|4482879_4483035_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_000344944.1|4483036_4483612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|4484098_4484287_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083281.1|4484283_4484475_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_072652568.1|4484568_4487040_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	2.7e-57
WP_001296941.1|4487127_4487364_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_001459782.1|4487398_4488679_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.6	2.3e-156
WP_001389342.1|4488680_4488809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836066.1|4488866_4489886_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001295394.1|4489897_4491112_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|4491317_4491644_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|4491778_4492120_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|4492154_4492715_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|4492717_4493428_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001300836.1|4493535_4493841_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041675.1|4494039_4496466_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	7.7e-214
4501161:4501177	attR	TTTTTTATCTCTTAAAG	NA	NA	NA	NA
>prophage 1
NZ_CP010173	Escherichia coli strain H8 plasmid A, complete sequence	94395	0	11460	94395	holin,tail	Salmonella_phage(30.77%)	14	NA	NA
WP_001376650.1|532_1210_+	DUF2829 domain-containing protein	NA	A0A1B0VBT1	Salmonella_phage	99.6	1.2e-127
WP_073529421.1|1216_2005_+	hypothetical protein	NA	Q71TF1	Escherichia_phage	95.4	4.8e-141
WP_001376906.1|2034_2352_-	hypothetical protein	NA	Q1MVN0	Enterobacteria_phage	88.6	7.6e-45
WP_073529422.1|2341_5329_-	hypothetical protein	NA	A0A1B0VFX4	Salmonella_phage	99.4	0.0e+00
WP_072649192.1|5341_5707_-	ddrA	NA	A0A1B0V846	Salmonella_phage	100.0	6.4e-48
WP_073529423.1|5703_7623_-	hypothetical protein	NA	A0A1B0V7H1	Salmonella_phage	96.7	0.0e+00
WP_001339178.1|7624_8227_-	hypothetical protein	NA	Q1MVM6	Enterobacteria_phage	99.5	4.6e-99
WP_000580770.1|8213_8657_-	hypothetical protein	NA	A0A077SK09	Escherichia_phage	99.3	2.9e-82
WP_000887652.1|8653_8983_-|holin	holin	holin	Q37876	Escherichia_phage	100.0	1.3e-52
WP_000145199.1|9057_9321_-	hypothetical protein	NA	Q71TD9	Escherichia_phage	67.1	1.1e-22
WP_046598022.1|9756_10329_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	86.1	3.0e-84
WP_073529424.1|10356_10833_+	hypothetical protein	NA	K7P7B1	Enterobacteria_phage	35.5	2.4e-10
WP_001619155.1|10835_11069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073529425.1|11049_11460_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	45.7	1.2e-21
>prophage 2
NZ_CP010173	Escherichia coli strain H8 plasmid A, complete sequence	94395	15607	94072	94395	terminase,integrase,head	Escherichia_phage(65.12%)	88	39815:39831	90848:90864
WP_029487597.1|15607_16042_-	hypothetical protein	NA	Q71TD4	Escherichia_phage	98.6	3.7e-74
WP_001561131.1|16120_16957_-	hypothetical protein	NA	A0A077SLH5	Escherichia_phage	99.6	1.5e-153
WP_029487598.1|16956_18390_-	bleomycin hydrolase	NA	Q71TP2	Escherichia_phage	99.4	3.4e-270
WP_000002800.1|18386_18743_-	hypothetical protein	NA	Q71TP1	Escherichia_phage	100.0	1.0e-61
WP_114142441.1|18742_22564_-	transglycosylase SLT domain-containing protein	NA	A0A077SK38	Escherichia_phage	85.5	0.0e+00
WP_000926345.1|22645_23527_-	hypothetical protein	NA	A0A1B0VBL3	Salmonella_phage	99.7	3.7e-174
WP_000506612.1|23541_24153_-	hypothetical protein	NA	Q71TN8	Escherichia_phage	99.0	8.4e-109
WP_023155386.1|24163_24730_-	hypothetical protein	NA	A0A077SK12	Escherichia_phage	98.9	1.5e-99
WP_000765490.1|24939_25719_-	hypothetical protein	NA	Q71TC6	Escherichia_phage	99.6	3.6e-149
WP_000908460.1|25726_26044_-	hypothetical protein	NA	Q71TC5	Escherichia_phage	100.0	2.9e-28
WP_000245712.1|26622_26844_+	host cell division inhibitor Icd-like protein	NA	A0A077SLM6	Escherichia_phage	100.0	1.3e-38
WP_073529426.1|26840_27884_+	phage antirepressor Ant	NA	Q71TN2	Escherichia_phage	94.5	5.2e-175
WP_001187875.1|28048_28849_+	protein kilA	NA	Q1MVK4	Enterobacteria_phage	100.0	1.9e-148
WP_001667233.1|28878_29724_+	hypothetical protein	NA	Q1MVK3	Enterobacteria_phage	98.9	1.1e-151
WP_001369095.1|29774_30020_+	hypothetical protein	NA	A0A1B0VDM5	Salmonella_phage	45.0	3.5e-13
WP_032186079.1|30201_30357_+	type I toxin-antitoxin system toxin HokD	NA	A0A1I9LJU7	Stx_converting_phage	90.2	5.2e-15
WP_000509938.1|30473_30983_-	hypothetical protein	NA	Q1MVJ9	Enterobacteria_phage	99.4	3.0e-91
WP_001345489.1|30994_31225_-	hypothetical protein	NA	Q1MVJ8	Enterobacteria_phage	98.7	3.0e-35
WP_000041756.1|31611_32427_-	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	99.6	1.2e-113
WP_073529427.1|32436_34026_-	hypothetical protein	NA	A0A077SLN8	Escherichia_phage	99.4	1.1e-304
WP_000067708.1|34086_35793_-	hypothetical protein	NA	Q71TM1	Escherichia_phage	99.8	0.0e+00
WP_000725191.1|36059_37025_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	99.4	1.7e-167
WP_000817632.1|37021_38227_-	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	100.0	2.0e-226
WP_001076427.1|38626_39487_-	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	100.0	4.7e-158
WP_001281115.1|39804_40197_-	hypothetical protein	NA	A0A077SLJ1	Escherichia_phage	97.7	7.6e-71
39815:39831	attL	CTTTCGATAAGAAGACC	NA	NA	NA	NA
WP_032332854.1|40374_40797_-	hypothetical protein	NA	Q71TL5	Escherichia_phage	90.0	3.6e-58
WP_032332855.1|40836_41625_-	hypothetical protein	NA	A0A1B0V830	Salmonella_phage	96.9	3.7e-117
WP_001177860.1|42087_42372_+	hypothetical protein	NA	Q71TA2	Escherichia_phage	100.0	3.5e-49
WP_000472529.1|42364_43270_+	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	99.7	1.6e-159
WP_000660969.1|43266_45531_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A077SL51	Escherichia_phage	68.2	0.0e+00
WP_000467133.1|47285_47720_+	tellurite resistance TerB family protein	NA	Q1MVI3	Enterobacteria_phage	100.0	8.1e-74
WP_000146942.1|47719_47884_+	DUF3927 family protein	NA	Q1MVI2	Enterobacteria_phage	98.1	6.9e-18
WP_001276605.1|48356_49721_+	replicative DNA helicase	NA	O80281	Escherichia_phage	99.6	1.8e-252
WP_001189128.1|49720_50023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001023221.1|50019_50994_+	hypothetical protein	NA	A0A1B0VCH7	Salmonella_phage	98.1	4.2e-187
WP_000535205.1|51040_51673_-	hypothetical protein	NA	A0A1B0V872	Salmonella_phage	100.0	6.9e-90
WP_000212018.1|51665_52682_-	hypothetical protein	NA	A0A077SLQ1	Escherichia_phage	100.0	3.5e-192
WP_000602711.1|52683_53469_-	hypothetical protein	NA	A0A1B0V7N6	Salmonella_phage	99.6	2.7e-144
WP_000896806.1|53455_54184_-	hypothetical protein	NA	Q71TJ9	Escherichia_phage	100.0	4.2e-139
WP_001141908.1|54187_55405_-	hypothetical protein	NA	A0A077SL53	Escherichia_phage	100.0	1.1e-224
WP_000235786.1|55414_55792_-	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
WP_000840931.1|55938_56184_+	hypothetical protein	NA	Q71T86	Escherichia_phage	100.0	5.7e-40
WP_000943607.1|56186_56765_+	norphogenetic protein	NA	Q71T85	Escherichia_phage	99.5	5.7e-107
WP_000096174.1|56831_56987_+	hypothetical protein	NA	Q71TJ4	Escherichia_phage	100.0	7.0e-20
WP_000484110.1|57488_58115_+	norphogenetic protein	NA	Q71T82	Escherichia_phage	100.0	6.1e-123
WP_001354545.1|58111_58789_+	calcineurin phosphoesterase	NA	A0A077SLQ6	Escherichia_phage	100.0	7.6e-135
WP_000684868.1|58785_59487_+	hypothetical protein	NA	Q71TJ0	Escherichia_phage	99.6	2.1e-143
WP_023153718.1|59788_61051_+	hypothetical protein	NA	Q71TI8	Escherichia_phage	99.8	9.2e-235
WP_000021768.1|61123_61630_+	hypothetical protein	NA	A0A1B0VAK0	Salmonella_phage	99.4	1.8e-93
WP_023153717.1|61824_62553_+	hypothetical protein	NA	Q71T76	Escherichia_phage	99.1	1.7e-140
WP_000158004.1|62636_62840_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	95.5	5.2e-31
WP_023352820.1|62832_63072_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	97.5	1.3e-36
WP_023154014.1|63068_63794_+	ead/Ea22-like family protein	NA	A0A0U2QW67	Escherichia_phage	49.8	7.5e-48
WP_000118152.1|63790_64090_+	hypothetical protein	NA	Q716F3	Shigella_phage	100.0	1.5e-58
WP_033550033.1|64091_64649_+	ead/Ea22-like family protein	NA	A0A0N7BYR8	Escherichia_phage	62.8	5.1e-36
WP_000224220.1|64650_64914_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	73.6	6.7e-31
WP_023153863.1|64924_65812_+	DUF551 domain-containing protein	NA	A0A077SK54	Escherichia_phage	59.3	1.8e-80
WP_000516537.1|65894_66128_+	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	97.4	1.6e-36
WP_063123741.1|66306_66600_+	hypothetical protein	NA	A0A077SK23	Escherichia_phage	90.7	2.7e-44
WP_000988658.1|66606_66981_+	hypothetical protein	NA	A0A077SL57	Escherichia_phage	96.0	3.2e-66
WP_000057449.1|66962_67895_+	hypothetical protein	NA	A0A1B0VDS6	Salmonella_phage	98.4	1.4e-179
WP_001261544.1|67891_68254_+	hypothetical protein	NA	Q71TI4	Escherichia_phage	100.0	2.2e-56
WP_001377386.1|68915_69167_+	DNA polymerase III subunit theta	NA	Q71T70	Escherichia_phage	94.0	4.6e-37
WP_000506726.1|69290_69680_+	DNA repair protein	NA	Q1MVE7	Enterobacteria_phage	99.2	1.4e-69
WP_001190712.1|69752_69974_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001216045.1|69973_70354_+	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	100.0	1.9e-63
WP_023153731.1|70358_70538_+	hypothetical protein	NA	Q71TH5	Escherichia_phage	96.6	7.8e-23
WP_000648825.1|70565_71609_+	DUF968 domain-containing protein	NA	A0A1B0VBU2	Salmonella_phage	99.4	3.9e-207
WP_001369802.1|71697_72150_+	hypothetical protein	NA	Q71T63	Escherichia_phage	98.7	1.1e-78
WP_073529428.1|72236_73430_+|terminase	terminase	terminase	Q5QBP3	Enterobacteria_phage	97.0	6.7e-203
WP_000124159.1|73429_74914_+	hypothetical protein	NA	Q5QBP2	Enterobacteria_phage	99.8	4.3e-292
WP_071527722.1|75135_75255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001361625.1|75273_75495_+	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	81.2	6.0e-25
WP_072686753.1|75491_76604_+	phage antirepressor Ant	NA	A0A077SLR9	Escherichia_phage	86.0	4.2e-175
WP_000611664.1|76636_77488_-	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	100.0	1.2e-158
WP_000874154.1|77598_77808_-	hypothetical protein	NA	Q5XLQ8	Enterobacteria_phage	100.0	4.8e-32
WP_000542336.1|78412_78634_+	hypothetical protein	NA	Q5QBN7	Enterobacteria_phage	100.0	4.5e-36
WP_073529429.1|78641_79673_+|integrase	tyrosine-type recombinase/integrase	integrase	Q71TG5	Escherichia_phage	99.1	7.1e-193
WP_001224236.1|79723_80035_+	hypothetical protein	NA	A0A077SK03	Escherichia_phage	99.0	2.3e-46
WP_073529430.1|80281_80842_+	Ref family protein	NA	A0A077SL37	Escherichia_phage	99.5	8.5e-100
WP_023351534.1|81030_81672_+	hypothetical protein	NA	A0A077SK30	Escherichia_phage	96.7	1.2e-110
WP_000526244.1|81774_82902_+	RelA/SpoT domain-containing protein	NA	A0A1B0VBT5	Salmonella_phage	74.1	7.6e-156
WP_000747846.1|82938_83187_-	hypothetical protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
WP_000224043.1|83183_83624_-	hypothetical protein	NA	A0A077SLF0	Escherichia_phage	100.0	1.7e-79
WP_073529431.1|83657_90425_-	N-6 DNA methylase	NA	Q1MVN7	Enterobacteria_phage	98.7	0.0e+00
WP_000774697.1|90501_92211_+	hypothetical protein	NA	Q1MVN6	Enterobacteria_phage	99.5	0.0e+00
90848:90864	attR	CTTTCGATAAGAAGACC	NA	NA	NA	NA
WP_000132937.1|92203_93223_+|head	head processing protein	head	Q71TR6	Escherichia_phage	96.8	4.4e-179
WP_001345478.1|93514_94072_-	lysozyme	NA	Q71TF3	Escherichia_phage	100.0	4.2e-107
>prophage 1
NZ_CP010174	Escherichia coli strain H8 plasmid B, complete sequence	106274	3284	43867	106274	integrase,transposase	Escherichia_phage(36.84%)	40	15809:15826	30907:30924
WP_001389365.1|3284_4049_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000130000.1|4275_4581_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000184001.1|4591_5797_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000376616.1|5952_6156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|6283_7123_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|7116_7464_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000503573.1|7669_8458_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_001389366.1|8588_9062_-	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_000845048.1|9219_10233_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|10435_10786_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001323888.1|10805_10973_-	hypothetical protein	NA	A0A1B0V7I9	Salmonella_phage	98.2	2.3e-24
WP_001161490.1|10961_11522_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_001138014.1|11525_14492_+|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
WP_001039464.1|15338_15725_+	hypothetical protein	NA	NA	NA	NA	NA
15809:15826	attL	GGCTTTGTTGAATAAATC	NA	NA	NA	NA
WP_030005799.1|15864_16833_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	95.7	5.5e-179
WP_072196731.1|18951_19077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000776034.1|20962_21394_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
WP_001754953.1|21393_22665_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	5.4e-150
WP_000064119.1|22746_23721_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.1	5.0e-87
WP_000368714.1|23720_24926_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
WP_000339857.1|25340_25610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118283.1|25786_26653_-	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
WP_032409716.1|27182_27287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000764642.1|27415_27673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000015958.1|27730_28507_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
WP_000129823.1|28503_29247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000493378.1|29297_29648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261276.1|30221_30452_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000754566.1|30448_30865_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_000227969.1|32206_33283_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
30907:30924	attR	GGCTTTGTTGAATAAATC	NA	NA	NA	NA
WP_000557452.1|33565_34426_+	aminoglycoside N-acetyltransferase AAC(3)-IIa	NA	NA	NA	NA	NA
WP_002063889.1|34438_34981_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001067855.1|36174_36879_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_013362817.1|37415_37865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013362818.1|38494_39232_-	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	99.6	6.3e-135
WP_013362819.1|39357_39453_-	23S rRNA methyltransferase attenuation leader peptide	NA	NA	NA	NA	NA
WP_001067855.1|39587_40292_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_013023839.1|41343_41820_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_000239590.1|41866_42742_-	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_001067855.1|43162_43867_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
