The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	0	23824	4733615	protease,transposase	uncultured_Caudovirales_phage(33.33%)	15	NA	NA
WP_041983107.1|484_1111_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_072842169.1|2013_2763_+	DNA-binding transcriptional activator AppY	NA	NA	NA	NA	NA
WP_001201845.1|3012_3966_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177469.1|4479_5241_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
WP_001224567.1|5423_6314_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_000662373.1|6314_9287_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000383951.1|9273_11511_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_047657190.1|11779_12916_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001299580.1|13019_13331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001299578.1|13445_13655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047657189.1|13693_18556_-	PAAR/RHS domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.5	1.1e-20
WP_001160804.1|18575_19037_-	DcrB-related protein	NA	NA	NA	NA	NA
WP_000103215.1|19064_20966_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.1	6.0e-28
WP_000253823.1|21702_23151_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	NA	NA	NA	NA
WP_000770941.1|23140_23824_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	34.7	2.3e-30
>prophage 2
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	26969	30113	4733615		Leptospira_phage(100.0%)	1	NA	NA
WP_047657150.1|26969_30113_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	2.2e-59
>prophage 3
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	41542	47585	4733615		Tupanvirus(50.0%)	3	NA	NA
WP_000077701.1|41542_45424_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.4	5.8e-62
WP_000096744.1|45639_46773_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000140647.1|46769_47585_-	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
>prophage 4
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	61945	63768	4733615		uncultured_marine_virus(50.0%)	2	NA	NA
WP_000502941.1|61945_62575_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	2.9e-56
WP_000029802.1|62547_63768_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	33.0	1.2e-58
>prophage 5
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	66877	68992	4733615		Bacillus_virus(50.0%)	2	NA	NA
WP_000887629.1|66877_68443_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
WP_000278505.1|68563_68992_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
>prophage 6
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	84417	85064	4733615		Morganella_phage(50.0%)	2	NA	NA
WP_000034825.1|84417_84627_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
WP_000939738.1|84680_85064_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
>prophage 7
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	89879	92319	4733615		Stx2-converting_phage(50.0%)	2	NA	NA
WP_001092082.1|89879_91091_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
WP_001231428.1|91230_92319_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
>prophage 8
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	99329	101912	4733615	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001157890.1|99329_101912_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.3	5.2e-184
>prophage 9
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	108851	112384	4733615		Bathycoccus_sp._RCC1105_virus(50.0%)	3	NA	NA
WP_047657148.1|108851_110522_-	molecular chaperone HscC	NA	E5EQT9	Bathycoccus_sp._RCC1105_virus	35.9	8.0e-77
WP_001207522.1|110605_111541_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000631384.1|111658_112384_-	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
>prophage 10
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	120280	121321	4733615		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001018040.1|120280_121321_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.1e-47
>prophage 11
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	125456	127121	4733615		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337066.1|125456_127121_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.3	6.1e-85
>prophage 12
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	131747	135561	4733615	tRNA	Vibrio_phage(50.0%)	2	NA	NA
WP_001023134.1|131747_133694_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
WP_001287154.1|133896_135561_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.1	0.0e+00
>prophage 13
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	139710	140475	4733615		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000773301.1|139710_140475_-	esterase	NA	A0A1J0GVH7	Mycobacterium_phage	35.4	4.4e-06
>prophage 14
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	147130	153111	4733615		Bacillus_phage(33.33%)	4	NA	NA
WP_000186103.1|147130_147808_-	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	31.1	8.9e-27
WP_023140618.1|147804_150489_-	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.5	1.4e-11
WP_001324645.1|150481_151054_-	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_000087966.1|151062_153111_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	22.8	4.2e-27
>prophage 15
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	162445	165387	4733615		Hokovirus(50.0%)	2	NA	NA
WP_000628038.1|162445_163864_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.4	5.2e-61
WP_001032694.1|163905_165387_-	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	2.5e-45
>prophage 16
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	168765	169557	4733615		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114025.1|168765_169557_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	28.8	3.7e-08
>prophage 17
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	205596	209116	4733615		Vibrio_phage(33.33%)	4	NA	NA
WP_000345410.1|205596_206316_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	9.2e-22
WP_000951292.1|206312_207254_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	2.2e-23
WP_000784351.1|207367_207748_-	YbgS-like family protein	NA	NA	NA	NA	NA
WP_001109196.1|208063_209116_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	3.4e-81
>prophage 18
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	213472	214489	4733615		Tupanvirus(100.0%)	1	NA	NA
WP_001265443.1|213472_214489_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	1.0e-79
>prophage 19
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	218989	220048	4733615		Planktothrix_phage(100.0%)	1	NA	NA
WP_000891683.1|218989_220048_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.7	2.6e-20
>prophage 20
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	230403	231693	4733615		Klosneuvirus(100.0%)	1	NA	NA
WP_021542060.1|230403_231693_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.9	3.8e-18
>prophage 21
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	238174	239083	4733615		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295302.1|238174_239083_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
>prophage 22
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	250395	265202	4733615		Anomala_cuprea_entomopoxvirus(14.29%)	13	NA	NA
WP_000996107.1|250395_252132_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
WP_149025603.1|252124_253120_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001296991.1|253122_253794_-	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000007102.1|254022_255387_+	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001145128.1|255618_256101_-	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.7	1.5e-36
WP_001340191.1|256220_258371_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	3.7e-42
WP_000386540.1|258398_259361_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_000443509.1|259501_260587_+	hydroxycarboxylate dehydrogenase HcXB	NA	NA	NA	NA	NA
WP_000849301.1|260815_261076_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000146343.1|261340_261607_-	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
WP_000990176.1|261680_262358_-	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
WP_000430036.1|262399_264682_-	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000710619.1|264941_265202_-	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
>prophage 23
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	268742	273967	4733615		Planktothrix_phage(33.33%)	7	NA	NA
WP_000569080.1|268742_269465_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
WP_001159065.1|269461_270121_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000843866.1|270259_271006_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_000100800.1|271409_271913_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_001119538.1|272211_273099_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_120795379.1|273333_273399_+	protein YliM	NA	NA	NA	NA	NA
WP_001295296.1|273451_273967_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
>prophage 24
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	278964	359250	4733615	terminase,capsid,lysis,integrase,plate,tail,head,portal,transposase	Salmonella_phage(70.0%)	87	280853:280868	326218:326233
WP_000961458.1|278964_280557_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
WP_000399648.1|280835_281816_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
280853:280868	attL	TTATATCGGTATCGAC	NA	NA	NA	NA
WP_000168797.1|282076_283342_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_000114244.1|283493_284309_-	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_000209359.1|284454_286887_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_001442269.1|286892_287792_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_000424893.1|287922_288585_+	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	34.6	5.7e-26
WP_000829258.1|288660_289410_-	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_000397381.1|289409_290645_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_000513775.1|290848_291814_+	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_001315369.1|291800_293672_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	4.0e-16
WP_000090164.1|293691_295230_+	glutathione ABC transporter substrate-binding protein GsiB	NA	NA	NA	NA	NA
WP_000936043.1|295247_296168_+	glutathione ABC transporter permease GsiC	NA	NA	NA	NA	NA
WP_001236044.1|296170_297082_+	glutathione ABC transporter permease GsiD	NA	NA	NA	NA	NA
WP_001471275.1|297259_299608_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000086916.1|299615_300944_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000049367.1|300990_302316_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_000497137.1|302528_302912_+	biofilm formation regulator BssR	NA	NA	NA	NA	NA
WP_000555035.1|303022_304138_+	aldose sugar dehydrogenase YliI	NA	NA	NA	NA	NA
WP_001295292.1|304134_304761_-	glutathione S-transferase GstB	NA	NA	NA	NA	NA
WP_000195961.1|305007_306210_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
WP_000450121.1|306256_307015_-	DNA-binding transcriptional repressor DeoR	NA	NA	NA	NA	NA
WP_000892317.1|307072_307669_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_001180076.1|307953_309186_+	multidrug efflux MFS transporter MdfA	NA	NA	NA	NA	NA
WP_073508631.1|309226_309511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297001.1|309596_310412_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase	NA	NA	NA	NA	NA
WP_000217848.1|310411_311620_-	MFS transporter	NA	NA	NA	NA	NA
WP_001297003.1|311703_312240_+	DNA-binding transcriptional regulator RcdA	NA	NA	NA	NA	NA
WP_004015184.1|312344_313397_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
WP_058905856.1|313479_314811_-	NTPase	NA	R9TRQ8	Vibrio_phage	27.4	4.8e-16
WP_001047318.1|315031_315595_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	46.9	1.5e-40
WP_001247705.1|315720_315942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460951.1|315974_316484_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	90.5	4.0e-80
WP_004015188.1|316491_316788_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.4	4.9e-22
WP_000996717.1|316905_317247_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_001244224.1|317314_317548_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.9e-32
WP_000752619.1|317547_317775_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	3.5e-36
WP_004015189.1|317771_318629_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.1	1.9e-159
WP_073508630.1|318625_321040_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_001154434.1|321192_321381_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217575.1|321391_321625_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_073508629.1|321947_323012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073508628.1|323008_324073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073508627.1|324092_324788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077897010.1|324835_325873_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	87.7	1.7e-170
WP_073508625.1|325872_327639_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
326218:326233	attR	GTCGATACCGATATAA	NA	NA	NA	NA
WP_000216237.1|327781_328615_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	2.8e-123
WP_000742510.1|328631_329690_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	3.8e-181
WP_000059191.1|329693_330344_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_000673529.1|330439_330904_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	8.4e-77
WP_000868175.1|330903_331107_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171568.1|331110_331326_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_001069898.1|331306_331822_+	lysozyme	NA	E5G6N1	Salmonella_phage	92.4	2.8e-89
WP_000196204.1|331818_332247_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	91.5	1.9e-59
WP_077897009.1|332342_332774_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	90.9	9.3e-70
WP_000369270.1|332766_333222_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	79.6	1.8e-55
WP_073508623.1|333351_334404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073508622.1|334527_335106_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	2.5e-94
WP_000177591.1|335102_335462_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	85.7	8.0e-51
WP_001583364.1|335448_336357_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	91.1	4.1e-144
WP_001682745.1|336349_336955_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	9.8e-110
WP_001682746.1|336951_338367_+|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	68.6	3.8e-128
WP_000639074.1|338375_338771_+|tail	tail fiber assembly protein	tail	A0A0M4S6V4	Salmonella_phage	43.5	3.5e-15
WP_024008962.1|338742_339186_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	97.9	2.7e-80
WP_042018473.1|339206_339617_-	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	94.4	7.2e-64
WP_016237350.1|339647_340214_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	8.4e-87
WP_073508621.1|340356_341529_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	89.7	2.5e-202
WP_001504081.1|341538_342054_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	94.7	4.8e-89
WP_001281016.1|342108_342411_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	90.0	8.2e-41
WP_001513105.1|342425_342545_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	84.6	8.2e-13
WP_073508620.1|342537_345615_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.2	0.0e+00
WP_073508619.1|345611_346097_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	2.4e-66
WP_021515761.1|346093_347194_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	7.6e-177
WP_000972391.1|347284_347503_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001024876.1|347738_349424_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000681108.1|349693_350071_+	inner membrane protein YbjM	NA	NA	NA	NA	NA
WP_001195231.1|350100_350358_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
WP_001201576.1|350517_350805_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000189159.1|350788_351511_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684321.1|351571_352474_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|352561_353038_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126097.1|353388_354501_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996024.1|354595_355729_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.4	5.0e-30
WP_000105438.1|355738_356692_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061657.1|356688_357534_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|357593_358082_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149732.1|358122_359250_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
>prophage 25
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	362587	365325	4733615		Planktothrix_phage(50.0%)	4	NA	NA
WP_000027205.1|362587_363316_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001270740.1|363533_364049_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160723.1|364174_364498_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255144.1|364494_365325_+	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
>prophage 26
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	368912	370631	4733615		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815350.1|368912_370631_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	4.0e-31
>prophage 27
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	379887	403650	4733615	protease,tRNA	uncultured_Mediterranean_phage(16.67%)	16	NA	NA
WP_000188194.1|379887_381834_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	5.0e-38
WP_000410785.1|381906_382131_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|382453_382774_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|382804_385081_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|385765_385984_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_073508618.1|386268_386973_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202188.1|387014_388736_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	1.9e-20
WP_001043587.1|388736_390503_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_000537418.1|390625_391591_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_000228473.1|392135_392630_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000077016.1|392764_396832_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|396990_397602_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067751.1|397612_398956_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	4.8e-80
WP_000886683.1|399046_400339_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000850313.1|400577_403022_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.9	3.0e-221
WP_000213098.1|403032_403650_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
>prophage 28
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	409960	413175	4733615		Tetraselmis_virus(100.0%)	2	NA	NA
WP_000111043.1|409960_410701_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001292820.1|410892_413175_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.3e-162
>prophage 29
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	417273	418362	4733615		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057149.1|417273_418362_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
>prophage 30
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	423448	427989	4733615		Bacillus_phage(100.0%)	3	NA	NA
WP_000167336.1|423448_423733_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000705706.1|423939_426204_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551270.1|426240_427989_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
>prophage 31
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	442694	443243	4733615		Rhodobacter_phage(100.0%)	1	NA	NA
WP_001295932.1|442694_443243_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
>prophage 32
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	446792	455106	4733615	tRNA	Enterobacteria_phage(25.0%)	5	NA	NA
WP_000977920.1|446792_447881_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_047657242.1|448482_449883_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_001297200.1|450051_451254_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000193844.1|451519_454132_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	7.0e-19
WP_001090514.1|454338_455106_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.6	1.7e-29
>prophage 33
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	471028	472936	4733615		Tupanvirus(100.0%)	1	NA	NA
WP_000053099.1|471028_472936_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.9e-54
>prophage 34
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	485535	487590	4733615		Bacillus_phage(100.0%)	1	NA	NA
WP_000420533.1|485535_487590_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	7.7e-21
>prophage 35
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	491823	492483	4733615	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000375136.1|491823_492483_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 36
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	511748	524013	4733615		Morganella_phage(20.0%)	13	NA	NA
WP_000066490.1|511748_511961_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|511971_512160_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001316982.1|512134_512365_+	protein YmcE	NA	NA	NA	NA	NA
WP_073508616.1|512354_512528_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000818476.1|512575_513649_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_072034717.1|513720_516465_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	3.5e-37
WP_001264933.1|516547_517576_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120112.1|517548_518241_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001230242.1|518380_519553_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001062101.1|519552_522099_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.2	1.0e-70
WP_000209869.1|522095_522695_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000024560.1|522787_523093_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420631.1|523092_524013_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	3.2e-11
>prophage 37
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	528317	530417	4733615		Enterobacteria_phage(100.0%)	3	NA	NA
WP_001273658.1|528317_528491_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001307098.1|528573_529902_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.9	1.1e-233
WP_001028095.1|529922_530417_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
>prophage 38
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	545328	546117	4733615		Cronobacter_phage(100.0%)	1	NA	NA
WP_000533522.1|545328_546117_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	7.8e-91
>prophage 39
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	552936	555498	4733615	transposase	Bacillus_phage(50.0%)	2	NA	NA
WP_000409849.1|552936_554295_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.0	1.1e-20
WP_085948466.1|554335_555498_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 40
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	560550	561384	4733615		Pelagibacter_phage(100.0%)	1	NA	NA
WP_047657123.1|560550_561384_-	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	6.6e-40
>prophage 41
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	565518	566052	4733615		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857405.1|565518_566052_+	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	5.9e-26
>prophage 42
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	575360	576281	4733615		Morganella_phage(100.0%)	1	NA	NA
WP_000183364.1|575360_576281_-	kdo(2)-lipid IV(A) lauroyltransferase	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 43
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	580943	581189	4733615		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|580943_581189_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 44
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	597035	597977	4733615		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001295441.1|597035_597977_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 45
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	610334	611516	4733615		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_001008535.1|610334_611069_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
WP_000103754.1|611279_611516_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 46
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	614788	616431	4733615		Pseudomonas_phage(50.0%)	2	NA	NA
WP_001257000.1|614788_615430_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
WP_001267931.1|615426_616431_+	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
>prophage 47
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	628754	629012	4733615		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|628754_629012_+	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 48
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	636300	640023	4733615		Planktothrix_phage(50.0%)	4	NA	NA
WP_001033695.1|636300_637002_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.9e-35
WP_047657126.1|637001_638246_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_000291270.1|638274_639186_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_000952736.1|639201_640023_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
>prophage 49
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	643287	645265	4733615		Mycoplasma_phage(100.0%)	2	NA	NA
WP_000799401.1|643287_644145_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531601.1|644128_645265_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
>prophage 50
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	650385	651756	4733615		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_000423750.1|650385_651756_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	5.5e-108
>prophage 51
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	654892	658621	4733615		Enterobacteria_phage(66.67%)	6	NA	NA
WP_000444487.1|654892_656143_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001307134.1|656245_656569_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	8.0e-42
WP_120795380.1|656821_656866_-	protein YmgK	NA	NA	NA	NA	NA
WP_032141808.1|657101_657212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373101.1|657264_657669_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332303.1|657889_658621_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
>prophage 52
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	664488	666810	4733615		Escherichia_phage(100.0%)	1	NA	NA
WP_001683996.1|664488_666810_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	43.0	3.0e-90
>prophage 53
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	675345	677033	4733615		Morganella_phage(50.0%)	2	NA	NA
WP_000897378.1|675345_675765_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_000457616.1|675764_677033_+	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.4	7.9e-210
>prophage 54
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	703793	706545	4733615		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_001033352.1|703793_705473_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_001298109.1|705597_706545_-	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
>prophage 55
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	709681	713689	4733615		Pseudomonas_phage(50.0%)	5	NA	NA
WP_000804726.1|709681_710764_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
WP_000456467.1|710763_711597_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000200374.1|711593_711986_+	SirB family protein	NA	NA	NA	NA	NA
WP_001257044.1|711989_712799_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000811065.1|712834_713689_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
>prophage 56
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	716790	717021	4733615		Spodoptera_litura_granulovirus(100.0%)	1	NA	NA
WP_001146442.1|716790_717021_+	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	6.5e-06
>prophage 57
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	728275	738286	4733615		Escherichia_phage(25.0%)	10	NA	NA
WP_000702660.1|728275_729814_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
WP_000571699.1|729810_730521_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_001160110.1|730520_731198_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000555849.1|731922_732765_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001307143.1|732814_733273_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001226476.1|733385_734291_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_000193447.1|734382_735396_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000718995.1|735597_736506_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_001287378.1|736649_737063_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068079.1|737668_738286_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.3e-53
>prophage 58
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	747700	749715	4733615		Planktothrix_phage(50.0%)	2	NA	NA
WP_000110945.1|747700_748714_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
WP_000994905.1|748710_749715_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
>prophage 59
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	761372	764330	4733615		Acinetobacter_phage(100.0%)	2	NA	NA
WP_000983912.1|761372_762734_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	1.1e-36
WP_000763511.1|762734_764330_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
>prophage 60
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	769263	774555	4733615	protease	Chrysochromulina_ericina_virus(33.33%)	4	NA	NA
WP_000559281.1|769263_770022_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	24.5	4.4e-06
WP_000422045.1|770241_771291_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_001031530.1|771326_771578_-	YciN family protein	NA	NA	NA	NA	NA
WP_001297122.1|771957_774555_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.7e-86
>prophage 61
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	779479	780070	4733615		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|779479_780070_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 62
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	787885	793544	4733615		Lactococcus_phage(50.0%)	5	NA	NA
WP_000484982.1|787885_789820_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.9	3.1e-32
WP_001307157.1|789887_791015_-	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_000506490.1|791158_791947_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_000983281.1|792316_792670_-	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_000573407.1|792737_793544_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
>prophage 63
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	806459	807725	4733615		Klosneuvirus(100.0%)	1	NA	NA
WP_000069228.1|806459_807725_+	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.0	4.6e-24
>prophage 64
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	821728	822811	4733615		Indivirus(100.0%)	1	NA	NA
WP_000057977.1|821728_822811_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.4	4.0e-13
>prophage 65
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	840991	841507	4733615		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945005.1|840991_841507_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	2.4e-24
>prophage 66
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	847833	908789	4733615	terminase,tail,tRNA,coat,lysis,integrase,holin	Escherichia_phage(38.78%)	64	842217:842233	885685:885701
842217:842233	attL	GATCGCAGCAATAAAAA	NA	NA	NA	NA
WP_001307164.1|847833_849066_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|849320_850304_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123763.1|850781_852155_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.9	1.1e-52
WP_001157407.1|852283_853219_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_073508607.1|853270_854506_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.3	1.3e-238
WP_000079604.1|854507_854723_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|854801_855011_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|855003_855198_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|855254_856064_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000105142.1|856056_858648_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.0	1.3e-243
WP_000632297.1|858749_859025_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|859099_859270_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560225.1|859269_859491_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001312793.1|859932_860421_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|860417_860573_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000362155.1|860972_861392_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000391949.1|861492_861774_+	helix-turn-helix domain-containing protein	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
WP_000693836.1|861757_862183_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262352.1|862254_863325_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	64.6	4.7e-62
WP_001151151.1|863365_863788_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	4.8e-63
WP_001676522.1|864128_866126_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	26.2	3.3e-21
WP_000625667.1|866189_867467_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_000019009.1|867597_868479_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000957772.1|868475_869168_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_001634983.1|869179_870379_-	MFS transporter	NA	NA	NA	NA	NA
WP_000149055.1|871102_871441_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_000940319.1|872254_872854_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_000247763.1|872853_873144_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.7e-46
WP_000640161.1|873140_873683_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	75.7	2.9e-76
WP_000506936.1|874727_875156_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_001348108.1|875327_875702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839565.1|875953_876169_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
WP_001135310.1|876168_876666_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	96.4	9.3e-90
WP_001228696.1|876882_877068_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001703139.1|877264_878722_+	Trk system potassium transporter TrkG	NA	NA	NA	NA	NA
WP_073508446.1|878859_879648_+	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.7	7.4e-49
WP_001204033.1|879640_880573_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.5	4.2e-83
WP_172903414.1|880508_880760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032085165.1|880763_881858_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.5	2.2e-112
WP_000625348.1|881838_883140_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	3.6e-149
WP_000763702.1|883142_884549_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.2	1.0e-186
WP_073508444.1|884532_885645_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.8	2.4e-114
WP_073508443.1|885749_886514_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	66.1	8.7e-87
885685:885701	attR	TTTTTATTGCTGCGATC	NA	NA	NA	NA
WP_073508606.1|886612_887752_+|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	74.7	4.8e-158
WP_000634214.1|887967_888363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000524260.1|888362_888746_+	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
WP_001029815.1|888746_889127_+	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	1.1e-18
WP_000144678.1|889123_889516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029488565.1|889542_890505_+	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	39.2	2.6e-56
WP_012565075.1|890655_891015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073508605.1|891488_894722_+|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	33.6	1.7e-107
WP_000024051.1|894714_895053_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_001152434.1|895052_895751_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	93.5	1.1e-125
WP_073508441.1|895756_896500_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	2.3e-148
WP_000741591.1|896397_897045_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.9	1.4e-109
WP_073508604.1|897105_900504_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.4	0.0e+00
WP_023909745.1|900570_901170_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	95.5	7.7e-107
WP_073508439.1|901234_904309_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	82.1	2.5e-68
WP_000885611.1|904308_904884_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_073508603.1|904981_905572_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	39.3	1.9e-25
WP_000836768.1|905888_906122_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|906190_906304_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001082294.1|907080_907515_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
WP_000837924.1|907655_908789_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
>prophage 67
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	913749	914739	4733615		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762229.1|913749_914739_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 68
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	946024	949927	4733615		Klosneuvirus(100.0%)	1	NA	NA
WP_000139567.1|946024_949927_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 69
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	953866	954815	4733615		Escherichia_phage(50.0%)	2	NA	NA
WP_001307188.1|953866_954397_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000731833.1|954641_954815_+	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
>prophage 70
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	966108	976774	4733615	transposase	Helicobacter_phage(20.0%)	10	NA	NA
WP_000604937.1|966108_966615_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	58.4	9.6e-42
WP_072024275.1|966622_967831_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.5	1.8e-208
WP_001307190.1|967870_969085_-	BenE family transporter YdcO	NA	NA	NA	NA	NA
WP_000429155.1|969137_969674_+	DNA-binding transcriptional regulator SutR	NA	NA	NA	NA	NA
WP_001307191.1|969746_971708_+	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.9	7.1e-24
WP_000494244.1|971799_972030_-	YncJ family protein	NA	NA	NA	NA	NA
WP_001270286.1|972451_972868_+	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_000760615.1|972946_974353_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000047456.1|974597_975743_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000220396.1|975760_976774_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
>prophage 71
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	980155	980965	4733615		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000867987.1|980155_980965_+	CatB-related O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	41.0	7.7e-17
>prophage 72
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	985230	987333	4733615		Salmonella_phage(100.0%)	1	NA	NA
WP_000689355.1|985230_987333_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.6	1.1e-134
>prophage 73
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	992242	998626	4733615		Ralstonia_phage(50.0%)	2	NA	NA
WP_065225629.1|992242_994351_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.0	2.8e-26
WP_065225630.1|994417_998626_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.3	4.1e-21
>prophage 74
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1011537	1013082	4733615		Escherichia_phage(100.0%)	1	NA	NA
WP_000702567.1|1011537_1013082_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 75
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1019968	1020259	4733615		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000768384.1|1019968_1020259_-	lipoprotein	NA	Q1MVN1	Enterobacteria_phage	65.1	2.1e-25
>prophage 76
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1026271	1027713	4733615		Escherichia_phage(50.0%)	2	NA	NA
WP_000781370.1|1026271_1026556_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
WP_000642407.1|1026702_1027713_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	9.6e-25
>prophage 77
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1030986	1032892	4733615		Planktothrix_phage(100.0%)	2	NA	NA
WP_001285536.1|1030986_1031913_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	4.1e-14
WP_000193564.1|1031905_1032892_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	1.4e-17
>prophage 78
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1037208	1041015	4733615		Klosneuvirus(50.0%)	2	NA	NA
WP_001307211.1|1037208_1039608_-	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
WP_000426265.1|1039632_1041015_-	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
>prophage 79
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1046290	1053226	4733615		Powai_lake_megavirus(50.0%)	3	NA	NA
WP_001245017.1|1046290_1049074_-	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	24.0	5.7e-19
WP_000832452.1|1049130_1051503_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_001296749.1|1051540_1053226_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.5	1.7e-10
>prophage 80
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1069813	1071214	4733615		Escherichia_phage(100.0%)	1	NA	NA
WP_001083595.1|1069813_1071214_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	49.2	4.0e-106
>prophage 81
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1078637	1080173	4733615		Staphylococcus_phage(100.0%)	1	NA	NA
WP_032214759.1|1078637_1080173_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	24.0	2.5e-16
>prophage 82
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1088054	1089473	4733615		Bacillus_phage(100.0%)	1	NA	NA
WP_073508598.1|1088054_1089473_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
>prophage 83
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1097217	1099347	4733615		Streptococcus_phage(50.0%)	3	NA	NA
WP_000091199.1|1097217_1097601_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000803659.1|1097632_1097851_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000012618.1|1097907_1099347_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.9	1.1e-29
>prophage 84
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1106851	1107742	4733615		Bacillus_phage(100.0%)	1	NA	NA
WP_000592826.1|1106851_1107742_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	1.1e-19
>prophage 85
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1113108	1128546	4733615		Escherichia_phage(44.44%)	15	NA	NA
WP_000214712.1|1113108_1113312_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527797.1|1113347_1114808_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.8	1.1e-42
WP_000151243.1|1114896_1116264_-	MHS family MFS transporter YdfJ	NA	NA	NA	NA	NA
WP_000836079.1|1116321_1117341_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_001295394.1|1117352_1118567_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|1118772_1119099_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|1119233_1119575_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|1119609_1120170_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|1120172_1120883_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001307224.1|1120990_1121296_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041554.1|1121494_1123921_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	2.0e-214
WP_001340362.1|1123981_1126405_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_000213028.1|1126415_1127033_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526492.1|1127034_1127889_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|1127931_1128546_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
>prophage 86
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1146308	1147610	4733615		Bacillus_phage(100.0%)	1	NA	NA
WP_000732487.1|1146308_1147610_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	7.2e-17
>prophage 87
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1157504	1159316	4733615		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945878.1|1157504_1159316_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	100.0	0.0e+00
>prophage 88
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1179199	1180474	4733615	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|1179199_1180474_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 89
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1187385	1188884	4733615		Salmonella_phage(50.0%)	2	NA	NA
WP_001296937.1|1187385_1187907_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
WP_000250661.1|1187987_1188884_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	3.6e-07
>prophage 90
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1197686	1206478	4733615		Streptomyces_phage(20.0%)	9	NA	NA
WP_000101193.1|1197686_1198502_+	peptidoglycan DD-endopeptidase MepH	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
WP_000007283.1|1198629_1199211_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000701040.1|1199356_1200526_-	MFS transporter	NA	NA	NA	NA	NA
WP_000102278.1|1200691_1200781_-	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000190982.1|1201079_1202105_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000269501.1|1202101_1203034_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001182363.1|1203146_1204358_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000098911.1|1204648_1205797_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.7	4.2e-85
WP_023140410.1|1205836_1206478_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	34.7	1.7e-22
>prophage 91
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1211982	1214249	4733615		Edwardsiella_phage(50.0%)	3	NA	NA
WP_000587554.1|1211982_1212795_-	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
WP_001069986.1|1212798_1213584_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_001676577.1|1213580_1214249_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	7.7e-23
>prophage 92
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1222539	1227623	4733615		environmental_halophage(33.33%)	5	NA	NA
WP_000144565.1|1222539_1223760_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	4.4e-93
WP_000908012.1|1223756_1225028_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000948872.1|1225002_1225749_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	24.0	5.1e-07
WP_000089364.1|1225758_1227246_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000367160.1|1227254_1227623_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	4.3e-15
>prophage 93
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1246269	1265809	4733615	tRNA	Tupanvirus(22.22%)	19	NA	NA
WP_000869246.1|1246269_1247916_+	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.8	2.0e-32
WP_000069375.1|1247972_1250351_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	9.4e-172
WP_000368046.1|1250683_1251517_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_001082226.1|1251673_1252720_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_001270810.1|1252851_1253043_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_000175592.1|1253046_1254483_-	YdiU family protein	NA	NA	NA	NA	NA
WP_001326034.1|1254545_1255259_-	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_001209795.1|1255505_1255970_-	endopeptidase	NA	S5MM68	Bacillus_phage	36.9	2.1e-11
WP_000029466.1|1256047_1256797_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001154183.1|1256796_1257348_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956530.1|1257410_1258391_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001229265.1|1258491_1258791_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000672359.1|1258795_1261183_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018596.1|1261197_1262181_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_001386830.1|1262464_1262509_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|1262631_1262988_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|1263040_1263238_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|1263334_1263877_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144192.1|1263880_1265809_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	3.2e-130
>prophage 94
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1277109	1279371	4733615		Tupanvirus(100.0%)	1	NA	NA
WP_000077848.1|1277109_1279371_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.8e-143
>prophage 95
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1285498	1286326	4733615		Bacillus_virus(100.0%)	1	NA	NA
WP_000175009.1|1285498_1286326_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.6	5.9e-73
>prophage 96
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1293802	1295023	4733615		Klosneuvirus(100.0%)	1	NA	NA
WP_000081983.1|1293802_1295023_-	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	5.5e-27
>prophage 97
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1301787	1302441	4733615		Bacillus_phage(100.0%)	1	NA	NA
WP_001299561.1|1301787_1302441_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.7	3.3e-10
>prophage 98
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1308039	1310001	4733615		Streptococcus_phage(100.0%)	1	NA	NA
WP_001235800.1|1308039_1310001_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	3.2e-40
>prophage 99
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1314927	1319012	4733615		Tupanvirus(50.0%)	4	NA	NA
WP_001135062.1|1314927_1315569_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	2.9e-19
WP_000438810.1|1315661_1317020_-	MFS transporter	NA	NA	NA	NA	NA
WP_000719096.1|1317136_1317895_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000723710.1|1318031_1319012_-	NADH-dependent methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	21.5	2.3e-07
>prophage 100
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1327825	1328680	4733615		Indivirus(100.0%)	1	NA	NA
WP_001186343.1|1327825_1328680_-	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	1.5e-10
>prophage 101
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1331998	1336575	4733615		Bacillus_phage(100.0%)	3	NA	NA
WP_000219686.1|1331998_1333282_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
WP_000616433.1|1333428_1334904_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000766132.1|1335084_1336575_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
>prophage 102
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1342526	1343735	4733615	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_000826417.1|1342526_1343735_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.3	2.0e-207
>prophage 103
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1353078	1361184	4733615	tRNA	Staphylococcus_phage(33.33%)	8	NA	NA
WP_000758422.1|1353078_1354764_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
WP_000290576.1|1354968_1355550_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001220981.1|1355589_1356285_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128858.1|1356342_1358253_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001295493.1|1358384_1358729_+	RidA family protein	NA	NA	NA	NA	NA
WP_001300615.1|1359090_1359450_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457334.1|1359569_1359749_-	YoaH family protein	NA	NA	NA	NA	NA
WP_000854972.1|1359822_1361184_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	3.4e-41
>prophage 104
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1365046	1366603	4733615		Moraxella_phage(100.0%)	1	NA	NA
WP_000394987.1|1365046_1366603_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 105
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1372243	1372453	4733615		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|1372243_1372453_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 106
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1377783	1379832	4733615		Moraxella_phage(100.0%)	1	NA	NA
WP_001055778.1|1377783_1379832_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	1.2e-85
>prophage 107
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1387328	1391798	4733615		Escherichia_phage(33.33%)	7	NA	NA
WP_000812724.1|1387328_1387985_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
WP_000976492.1|1388380_1388722_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879285.1|1388734_1389607_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000204699.1|1389610_1389985_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|1390123_1390354_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011652.1|1390455_1391112_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|1391135_1391798_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
>prophage 108
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1399854	1401330	4733615		Cyanophage(100.0%)	1	NA	NA
WP_000301730.1|1399854_1401330_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	5.8e-79
>prophage 109
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1414905	1416033	4733615		Planktothrix_phage(100.0%)	1	NA	NA
WP_000741721.1|1414905_1416033_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	30.5	3.6e-20
>prophage 110
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1423496	1430560	4733615		Bacillus_virus(50.0%)	9	NA	NA
WP_001184045.1|1423496_1424819_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001342995.1|1424834_1425767_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|1425845_1426601_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571479.1|1426597_1427383_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|1427529_1428540_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|1428548_1429160_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_001386853.1|1429298_1429364_-	stress response small protein YobI	NA	NA	NA	NA	NA
WP_001024917.1|1429434_1430037_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|1430038_1430560_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
>prophage 111
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1434578	1436629	4733615		Escherichia_coli_phage(50.0%)	3	NA	NA
WP_000639271.1|1434578_1435397_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	4.9e-72
WP_000252979.1|1435449_1435845_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_000019584.1|1435885_1436629_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
>prophage 112
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1444524	1446258	4733615	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001025326.1|1444524_1446258_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
>prophage 113
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1451510	1457154	4733615		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_000763867.1|1451510_1451900_-	chemotaxis response regulator CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036378.1|1451914_1452964_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204335.1|1452966_1453827_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483220.1|1453845_1455447_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.7	8.3e-15
WP_001307261.1|1455492_1457154_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
>prophage 114
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1467241	1468756	4733615		Cedratvirus(100.0%)	1	NA	NA
WP_001187810.1|1467241_1468756_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
>prophage 115
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1480741	1481494	4733615		Bacillus_virus(100.0%)	1	NA	NA
WP_001272994.1|1480741_1481494_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
>prophage 116
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1493309	1495229	4733615	transposase	uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_000334568.1|1493309_1493981_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.4	1.6e-81
WP_073513886.1|1494020_1495229_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	3.5e-207
>prophage 117
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1512456	1525047	4733615		Bacillus_phage(28.57%)	12	NA	NA
WP_001351364.1|1512456_1514151_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.7e-18
WP_000009306.1|1514388_1514571_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922682.1|1514649_1515567_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212248.1|1515739_1516660_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000786004.1|1516648_1517119_-	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
WP_001157241.1|1517099_1518518_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	4.0e-101
WP_000365565.1|1518584_1519280_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.1e-07
WP_001313057.1|1519319_1519685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824402.1|1520252_1521467_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	53.5	5.2e-102
WP_000218209.1|1522058_1522910_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826769.1|1523017_1524376_-	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.5	8.7e-05
WP_001339045.1|1524375_1525047_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
>prophage 118
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1528591	1529122	4733615		Escherichia_phage(100.0%)	1	NA	NA
WP_001079074.1|1528591_1529122_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
>prophage 119
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1554791	1555958	4733615		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000830169.1|1554791_1555958_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	98.7	1.9e-226
>prophage 120
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1562155	1563055	4733615		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131782.1|1562155_1563055_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 121
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1571433	1576557	4733615		Paramecium_bursaria_Chlorella_virus(33.33%)	4	NA	NA
WP_000704798.1|1571433_1572600_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.2	3.3e-114
WP_047656978.1|1572848_1574255_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.1e-37
WP_047656977.1|1574548_1575454_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_047656976.1|1575450_1576557_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	61.2	1.7e-136
>prophage 122
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1580935	1588259	4733615		Stenotrophomonas_phage(20.0%)	6	NA	NA
WP_047656972.1|1580935_1582039_-	dTDP-4-amino-4,6-dideoxy-D-glucose aminotransferase VioA	NA	A0A2D2W2B8	Stenotrophomonas_phage	27.7	3.9e-11
WP_047656971.1|1582050_1583478_-	O116 family O-antigen flippase	NA	NA	NA	NA	NA
WP_047656970.1|1583484_1584351_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	69.4	2.4e-109
WP_047656969.1|1584347_1585424_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	1.8e-101
WP_000183060.1|1585796_1586690_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_047656968.1|1586864_1588259_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.3	4.4e-20
>prophage 123
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1593980	1600774	4733615		Bacillus_phage(25.0%)	6	NA	NA
WP_032178616.1|1593980_1595351_-	colanic acid biosynthesis phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.7	2.2e-32
WP_000079285.1|1595543_1596980_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	1.3e-46
WP_000699701.1|1596982_1598206_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_029392122.1|1598202_1598682_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000043623.1|1598684_1599650_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	9.9e-88
WP_000048190.1|1599652_1600774_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
>prophage 124
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1605018	1615494	4733615		uncultured_marine_virus(20.0%)	9	NA	NA
WP_000654492.1|1605018_1605858_-	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	1.7e-06
WP_000137136.1|1606035_1608198_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_000482901.1|1608200_1608644_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000978069.1|1608649_1609789_-	polysaccharide export protein Wza	NA	NA	NA	NA	NA
WP_162829205.1|1610097_1610247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001300971.1|1610447_1612031_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_001252331.1|1612304_1614158_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001234767.1|1614179_1614761_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_001295424.1|1614852_1615494_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
>prophage 125
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1620158	1621511	4733615		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000469763.1|1620158_1621511_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	21.3	8.3e-08
>prophage 126
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1634952	1674924	4733615	terminase,tail,capsid,tRNA,lysis,integrase,plate,holin,head,portal	Escherichia_phage(45.45%)	50	1640010:1640037	1673108:1673135
WP_000675150.1|1634952_1636356_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
WP_000137869.1|1636352_1637075_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.4e-30
WP_000929408.1|1637265_1637598_+	YegP family protein	NA	NA	NA	NA	NA
WP_001307279.1|1637806_1638103_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_001220181.1|1638104_1638401_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000476011.1|1638503_1639865_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
1640010:1640037	attL	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000468308.1|1640137_1640356_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882953.1|1640437_1641601_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	2.4e-205
WP_016248270.1|1641600_1642080_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	98.7	2.5e-84
WP_073508586.1|1642094_1644542_-|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	98.8	0.0e+00
WP_000785970.1|1644534_1644654_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|1644686_1644962_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|1645018_1645537_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_023148823.1|1645549_1646740_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.1e-224
WP_106424756.1|1647026_1648217_-	DUF4263 domain-containing protein	NA	Q858S8	Enterobacteria_phage	99.7	5.4e-176
WP_023148826.1|1648543_1649071_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	92.6	8.3e-89
WP_073508585.1|1649072_1651094_-|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	64.6	9.2e-261
WP_001285325.1|1651104_1651635_-|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	100.0	2.3e-102
WP_001121482.1|1651627_1652536_-|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.7	2.0e-162
WP_000127163.1|1652540_1652888_-	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_024176299.1|1652884_1653514_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	95.2	1.8e-106
WP_023148831.1|1653600_1654674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023148832.1|1654776_1655229_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	99.3	2.4e-76
WP_001774102.1|1655221_1655689_-|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.1	9.7e-81
WP_001440152.1|1655651_1655825_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_000040696.1|1655796_1656222_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7L9Y0	Escherichia_phage	96.5	1.4e-65
WP_023278422.1|1656209_1656635_-	hypothetical protein	NA	A0A0F7LDU9	Escherichia_phage	93.6	4.7e-58
WP_001144101.1|1656649_1657147_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123123.1|1657146_1657428_-|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846409.1|1657431_1657635_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000988633.1|1657634_1658144_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_073508584.1|1658243_1658987_-|terminase	terminase endonuclease subunit	terminase	Q94MH3	Enterobacteria_phage	99.6	3.6e-122
WP_073508583.1|1658990_1660064_-|capsid	phage major capsid protein, P2 family	capsid	Q94MI3	Enterobacteria_phage	99.2	7.4e-201
WP_033549327.1|1660122_1660977_-|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	98.6	5.6e-135
WP_033549326.1|1661150_1662923_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.7	0.0e+00
WP_000038162.1|1662922_1663951_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.1	6.2e-197
WP_001350078.1|1664009_1664582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000744812.1|1664574_1666008_-	AAA family ATPase	NA	A0A2I7RNF1	Vibrio_phage	30.1	3.9e-40
WP_073508582.1|1667172_1669449_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	98.0	0.0e+00
WP_000027667.1|1669438_1669714_-	DUF5405 family protein	NA	Q858T5	Yersinia_virus	100.0	3.8e-45
WP_001113264.1|1669710_1669935_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_001277897.1|1669934_1670237_-	DUF5405 family protein	NA	A0A0F7LCL4	Escherichia_phage	98.0	8.5e-46
WP_000557705.1|1670236_1670461_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	1.4e-32
WP_000217670.1|1670524_1671025_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_001005162.1|1671021_1671192_-	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_001081582.1|1671202_1671478_-	regulatory phage cox family protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_000020919.1|1671599_1671899_+	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_077897006.1|1672014_1673028_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	98.8	1.6e-192
WP_000716757.1|1673292_1673610_-	hypothetical protein	NA	NA	NA	NA	NA
1673108:1673135	attR	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000807362.1|1674024_1674924_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
>prophage 127
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1684146	1687703	4733615		Serratia_phage(50.0%)	4	NA	NA
WP_000846217.1|1684146_1685151_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
WP_000011951.1|1685147_1686113_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434038.1|1686086_1686833_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_047656952.1|1686884_1687703_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	3.3e-23
>prophage 128
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1698349	1700383	4733615	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001295427.1|1698349_1700383_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 129
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1712894	1722336	4733615		Enterobacteria_phage(85.71%)	10	NA	NA
WP_073508581.1|1712894_1714031_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	2.5e-162
WP_009008075.1|1714027_1716028_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.4	0.0e+00
WP_001295429.1|1716152_1716614_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_073508580.1|1716654_1717125_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	8.8e-82
WP_000598641.1|1717171_1717891_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|1717887_1719573_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|1719794_1720526_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|1720585_1720693_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|1720673_1721405_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569326.1|1721409_1722336_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 130
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1742669	1744190	4733615		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255042.1|1742669_1744190_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 131
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1747884	1751670	4733615		Cellulophaga_phage(50.0%)	3	NA	NA
WP_001139613.1|1747884_1748553_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
WP_000425438.1|1748810_1749647_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000489244.1|1749678_1751670_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.0e-13
>prophage 132
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1755739	1756597	4733615		Catovirus(100.0%)	1	NA	NA
WP_000873890.1|1755739_1756597_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	34.0	1.4e-24
>prophage 133
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1771092	1775393	4733615		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_000848204.1|1771092_1772559_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.5	1.2e-44
WP_000198822.1|1772676_1773663_+	zinc-binding GTPase YeiR	NA	NA	NA	NA	NA
WP_001296828.1|1773701_1774415_+	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000241011.1|1774826_1775393_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
>prophage 134
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1781147	1788797	4733615		Vibrio_phage(50.0%)	7	NA	NA
WP_000194928.1|1781147_1782737_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	34.0	1.1e-19
WP_000202798.1|1782740_1783085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213382.1|1783418_1784609_-	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	2.9e-20
WP_001234854.1|1784636_1785332_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578079.1|1785481_1787242_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	3.2e-100
WP_000494183.1|1787366_1787651_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000050787.1|1787789_1788797_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.6	6.9e-84
>prophage 135
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1800496	1801114	4733615		Bacillus_virus(100.0%)	1	NA	NA
WP_000888560.1|1800496_1801114_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
>prophage 136
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1809881	1815659	4733615		Bacillus_phage(25.0%)	5	NA	NA
WP_000422185.1|1809881_1811525_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	1.2e-13
WP_000884942.1|1811600_1812251_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000710363.1|1812250_1813315_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_000406087.1|1813388_1814444_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865570.1|1814555_1815659_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.9	1.2e-118
>prophage 137
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1819936	1822786	4733615		Hokovirus(100.0%)	1	NA	NA
WP_000876014.1|1819936_1822786_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
>prophage 138
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1832486	1846540	4733615		Pseudomonas_phage(33.33%)	8	NA	NA
WP_001281225.1|1832486_1835114_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
WP_000990754.1|1835260_1835983_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_001437766.1|1836110_1839845_-	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	24.2	2.2e-18
WP_001075177.1|1840539_1842825_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.1e-283
WP_000332036.1|1842913_1844044_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
WP_000135040.1|1844043_1844298_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000301049.1|1844351_1845002_-	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000779091.1|1845463_1846540_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
>prophage 139
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1852433	1853336	4733615	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000140570.1|1852433_1853336_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	2.5e-69
>prophage 140
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1856488	1861492	4733615		Tupanvirus(50.0%)	4	NA	NA
WP_001297077.1|1856488_1857091_-	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	3.4e-09
WP_001307305.1|1857398_1858538_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.8	1.1e-29
WP_000461661.1|1858541_1859510_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.2	2.0e-35
WP_000860259.1|1859509_1861492_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	1.8e-19
>prophage 141
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1895908	1899136	4733615		Salmonella_phage(50.0%)	3	NA	NA
WP_000813848.1|1895908_1896508_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	37.3	5.9e-06
WP_001012899.1|1896566_1898399_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_001203389.1|1898485_1899136_-	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	34.3	5.2e-08
>prophage 142
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1909696	1911569	4733615		Sodalis_phage(50.0%)	2	NA	NA
WP_000156113.1|1909696_1910599_-	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	44.5	8.2e-68
WP_001293612.1|1910795_1911569_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
>prophage 143
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1915780	1917298	4733615		Mollivirus(100.0%)	1	NA	NA
WP_000334220.1|1915780_1917298_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
>prophage 144
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1923774	1924911	4733615		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699121.1|1923774_1924911_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
>prophage 145
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1933475	1934561	4733615		Pandoravirus(100.0%)	1	NA	NA
WP_001297933.1|1933475_1934561_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
>prophage 146
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1952443	1953376	4733615		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000368131.1|1952443_1953376_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
>prophage 147
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1956415	1957849	4733615		Bacillus_phage(100.0%)	1	NA	NA
WP_047656943.1|1956415_1957849_+	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	25.4	4.1e-29
>prophage 148
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1964490	1972067	4733615		Hokovirus(50.0%)	4	NA	NA
WP_072034716.1|1964490_1968084_+	acid-sensing system histidine kinase EvgS	NA	A0A1V0SGX0	Hokovirus	32.1	1.7e-36
WP_001296867.1|1968139_1969285_-	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_000955028.1|1969358_1970303_-	transporter YfdV	NA	NA	NA	NA	NA
WP_001283499.1|1970372_1972067_-	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.0e-23
>prophage 149
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1975796	1976717	4733615		Morganella_phage(100.0%)	1	NA	NA
WP_000484404.1|1975796_1976717_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
>prophage 150
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	1980535	1981270	4733615		Clostridioides_phage(100.0%)	1	NA	NA
WP_001295458.1|1980535_1981270_+	two-component system response regulator YpdB	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 151
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2002970	2018340	4733615		Streptococcus_phage(33.33%)	15	NA	NA
WP_000443665.1|2002970_2004986_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	6.5e-150
WP_001297862.1|2005056_2006043_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000254843.1|2006272_2007034_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_000034402.1|2007218_2008190_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000487600.1|2008573_2008831_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000623136.1|2008875_2010603_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000522249.1|2010643_2011153_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000096663.1|2011194_2012046_-	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000719943.1|2012150_2012519_+	YfeK family protein	NA	NA	NA	NA	NA
WP_001297645.1|2012521_2013433_-	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	3.5e-58
WP_000021039.1|2013566_2014664_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
WP_000852686.1|2014653_2015529_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000458406.1|2015528_2016362_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000290223.1|2016361_2017378_-	thiosulfate/sulfate ABC transporter substrate-binding protein CysP	NA	NA	NA	NA	NA
WP_000517431.1|2017548_2018340_-	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	8.9e-18
>prophage 152
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2021818	2026756	4733615		Mycobacterium_phage(33.33%)	6	NA	NA
WP_001315775.1|2021818_2023123_+	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	26.2	1.6e-08
WP_000084590.1|2023180_2024080_-	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_000838945.1|2024175_2024751_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_000842944.1|2024811_2025261_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000406000.1|2025247_2025673_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_073508577.1|2025886_2026756_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	3.2e-13
>prophage 153
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2045310	2046261	4733615		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|2045310_2046261_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 154
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2064308	2065022	4733615		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|2064308_2065022_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 155
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2085994	2089996	4733615		Enterobacteria_phage(33.33%)	4	NA	NA
WP_001307334.1|2085994_2087284_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.6	1.7e-63
WP_001295473.1|2087369_2087996_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001295474.1|2088320_2089358_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
WP_001028622.1|2089357_2089996_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.3	9.0e-29
>prophage 156
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2096242	2102727	4733615		Escherichia_phage(66.67%)	7	NA	NA
WP_000017552.1|2096242_2096395_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
WP_000076001.1|2096412_2096604_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_001317257.1|2096914_2097433_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	8.5e-62
WP_000755173.1|2097448_2097988_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	100.0	3.4e-45
WP_000138282.1|2098082_2099660_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_001299507.1|2099728_2101195_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000937892.1|2101356_2102727_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	6.8e-42
>prophage 157
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2111557	2111989	4733615		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963837.1|2111557_2111989_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 158
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2121874	2128331	4733615		Mycoplasma_phage(20.0%)	8	NA	NA
WP_000133582.1|2121874_2123158_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	2.2e-34
WP_000523616.1|2123335_2123536_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001124469.1|2123547_2123883_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_001196597.1|2123884_2125735_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	7.2e-103
WP_000384411.1|2125751_2126267_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_000028953.1|2126362_2126686_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000331707.1|2126702_2127089_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_001295373.1|2127116_2128331_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
>prophage 159
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2143495	2145007	4733615		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000493471.1|2143495_2145007_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	28.9	2.5e-08
>prophage 160
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2150765	2162073	4733615		Bacillus_phage(50.0%)	7	NA	NA
WP_000919159.1|2150765_2152019_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
WP_000883122.1|2152346_2153537_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000717694.1|2153581_2153920_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_001298983.1|2153980_2155315_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_001215888.1|2155304_2156018_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001297612.1|2156182_2157610_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
WP_047657122.1|2158185_2162073_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.2	7.7e-131
>prophage 161
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2166192	2166453	4733615		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196283.1|2166192_2166453_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
>prophage 162
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2169911	2173654	4733615		Tetraselmis_virus(50.0%)	3	NA	NA
WP_001068343.1|2169911_2170592_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000002542.1|2170864_2171839_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790168.1|2171854_2173654_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
>prophage 163
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2179425	2185684	4733615	tRNA	Cafeteria_roenbergensis_virus(25.0%)	7	NA	NA
WP_000219193.1|2179425_2180760_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_000365855.1|2180968_2181850_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189207.1|2181952_2182540_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|2182595_2182979_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262716.1|2183283_2183973_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000997403.1|2184020_2185058_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|2185264_2185684_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
>prophage 164
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2190977	2192276	4733615		Burkholderia_virus(100.0%)	1	NA	NA
WP_000230376.1|2190977_2192276_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
>prophage 165
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2198054	2200628	4733615		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001235102.1|2198054_2200628_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 166
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2206534	2207605	4733615		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001168044.1|2206534_2207605_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
>prophage 167
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2221351	2223789	4733615	integrase	Staphylococcus_phage(50.0%)	2	2214262:2214276	2230580:2230594
2214262:2214276	attL	CTGGGGTGGAAACGG	NA	NA	NA	NA
WP_000162574.1|2221351_2221834_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_057688226.1|2222595_2223789_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	49.9	5.9e-106
2230580:2230594	attR	CCGTTTCCACCCCAG	NA	NA	NA	NA
>prophage 168
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2228084	2234264	4733615		Enterobacteria_phage(75.0%)	8	NA	NA
WP_023304682.1|2228084_2228357_-	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	44.1	3.7e-08
WP_073508570.1|2228358_2228913_-	phage polarity suppression protein	NA	NA	NA	NA	NA
WP_057688230.1|2228909_2229662_-	septation initiation protein	NA	NA	NA	NA	NA
WP_073508569.1|2230566_2230827_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	67.5	2.7e-24
WP_077822506.1|2230823_2231372_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	56.1	6.8e-25
WP_057688232.1|2231371_2231596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023304676.1|2231592_2231916_+	DUF5375 family protein	NA	NA	NA	NA	NA
WP_073508568.1|2231930_2234264_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	72.8	0.0e+00
>prophage 169
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2238354	2238573	4733615		Salmonella_phage(100.0%)	1	NA	NA
WP_071524581.1|2238354_2238573_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	68.0	6.0e-09
>prophage 170
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2248029	2252154	4733615		Klosneuvirus(50.0%)	4	NA	NA
WP_001087606.1|2248029_2249310_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	2.4e-33
WP_001295173.1|2249620_2251021_+	GABA permease	NA	NA	NA	NA	NA
WP_000156811.1|2251041_2251704_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000522422.1|2251704_2252154_-	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	38.2	5.8e-06
>prophage 171
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2256089	2261385	4733615		Oenococcus_phage(20.0%)	5	NA	NA
WP_001223227.1|2256089_2256335_+	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_000080947.1|2256331_2256742_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_000246540.1|2256714_2258859_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.0	2.1e-194
WP_000777969.1|2258868_2259828_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	3.5e-133
WP_000985494.1|2260182_2261385_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
>prophage 172
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2274569	2280129	4733615	tRNA	Vibrio_phage(25.0%)	5	NA	NA
WP_000906486.1|2274569_2274755_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000047176.1|2274989_2277620_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000140506.1|2277747_2278248_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000963143.1|2278490_2279552_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000132231.1|2279631_2280129_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
>prophage 173
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2285595	2286561	4733615		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287446.1|2285595_2286561_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	2.3e-36
>prophage 174
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2294134	2295145	4733615		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001402444.1|2294134_2295145_-	DNA-binding transcriptional regulator AscG	NA	C6ZCU4	Enterobacteria_phage	28.3	1.0e-26
>prophage 175
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2312973	2320113	4733615		Escherichia_phage(83.33%)	6	NA	NA
WP_001272924.1|2312973_2315535_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_001141340.1|2315640_2316297_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	8.0e-49
WP_001297141.1|2316347_2317115_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_047657020.1|2317310_2318219_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	2.3e-118
WP_000590392.1|2318215_2319478_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|2319474_2320113_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 176
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2325327	2329043	4733615		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_012907185.1|2325327_2326320_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272592.1|2326382_2327522_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|2327661_2328288_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001349984.1|2328281_2329043_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	47.2	4.9e-58
>prophage 177
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2332155	2334188	4733615		Tupanvirus(50.0%)	2	NA	NA
WP_001173673.1|2332155_2332761_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
WP_001090361.1|2332760_2334188_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	9.7e-31
>prophage 178
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2358283	2359069	4733615		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_073508567.1|2358283_2359069_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	5.0e-21
>prophage 179
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2364152	2369072	4733615		Vibrio_phage(33.33%)	5	NA	NA
WP_001199970.1|2364152_2364824_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
WP_001288227.1|2364962_2365103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001268451.1|2365116_2365989_+	YgcG family protein	NA	NA	NA	NA	NA
WP_000036723.1|2366048_2367347_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_000210878.1|2367434_2369072_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
>prophage 180
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2373104	2377219	4733615		Erysipelothrix_phage(50.0%)	2	NA	NA
WP_000046785.1|2373104_2374406_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.7	2.0e-38
WP_000186450.1|2374462_2377219_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
>prophage 181
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2384753	2385602	4733615		Vibrio_phage(100.0%)	1	NA	NA
WP_000100430.1|2384753_2385602_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	4.7e-41
>prophage 182
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2390460	2391216	4733615		Bacillus_phage(100.0%)	1	NA	NA
WP_000268232.1|2390460_2391216_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	5.0e-10
>prophage 183
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2402742	2418291	4733615	tRNA	environmental_halophage(16.67%)	9	NA	NA
WP_001299106.1|2402742_2403948_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	37.0	1.7e-73
WP_000184249.1|2403947_2404391_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_000117734.1|2404441_2405248_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	3.8e-16
WP_000678646.1|2405486_2406584_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000016907.1|2407163_2408417_-	N-acetylmuramoyl-L-alanine amidase AmiC	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000237947.1|2408648_2409980_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000775953.1|2410041_2411868_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.7	3.5e-25
WP_001345933.1|2411867_2415410_-	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	21.6	2.0e-08
WP_001138159.1|2415402_2418291_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.7	5.3e-68
>prophage 184
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2423768	2430541	4733615		Geobacillus_virus(33.33%)	6	NA	NA
WP_000816232.1|2423768_2424563_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
WP_000204658.1|2424569_2425445_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000957912.1|2425595_2427842_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000564489.1|2427854_2428385_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000082188.1|2429069_2429759_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000895624.1|2429827_2430541_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
>prophage 185
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2440172	2442667	4733615		Aichi_virus(50.0%)	2	NA	NA
WP_000256438.1|2440172_2441591_-	arabinose-proton symporter AraE	NA	O13311	Aichi_virus	26.9	1.8e-24
WP_000603517.1|2441905_2442667_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
>prophage 186
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2465494	2466250	4733615		Clostridium_phage(100.0%)	1	NA	NA
WP_001272558.1|2465494_2466250_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 187
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2490529	2505921	4733615	tRNA	environmental_Halophage(14.29%)	14	NA	NA
WP_001280215.1|2490529_2491930_+	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
WP_001295158.1|2491947_2493264_+	guanine deaminase	NA	NA	NA	NA	NA
WP_000012140.1|2493299_2494667_+	guanine/hypoxanthine transporter GhxQ	NA	A0A0R6PHV4	Moraxella_phage	73.1	1.6e-160
WP_000838428.1|2494702_2495191_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_047656998.1|2495190_2497110_-	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_001295374.1|2497545_2498994_+	urate/proton symporter UacT	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_001010156.1|2498995_2499121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795390.1|2499117_2499189_-	protein YqfH	NA	NA	NA	NA	NA
WP_001192814.1|2499243_2499792_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_000003068.1|2499834_2501352_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001701073.1|2501361_2502460_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000813215.1|2502550_2504284_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.5	3.2e-60
WP_000715214.1|2504289_2505000_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000806638.1|2505024_2505921_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
>prophage 188
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2509845	2515218	4733615		Pandoravirus(50.0%)	3	NA	NA
WP_001307385.1|2509845_2511279_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.9	5.7e-31
WP_000951964.1|2511335_2512079_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000195023.1|2512344_2515218_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.0	3.7e-263
>prophage 189
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2523745	2524978	4733615		Catovirus(100.0%)	1	NA	NA
WP_047656997.1|2523745_2524978_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 190
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2543029	2543707	4733615		Bacillus_virus(100.0%)	1	NA	NA
WP_000956871.1|2543029_2543707_+	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.1	1.1e-08
>prophage 191
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2564708	2565863	4733615		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|2564708_2565863_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 192
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2622480	2623653	4733615		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000524972.1|2622480_2623653_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	30.7	4.2e-40
>prophage 193
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2645867	2646752	4733615		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018758.1|2645867_2646752_+	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 194
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2654107	2664931	4733615		Staphylococcus_phage(25.0%)	9	NA	NA
WP_000013149.1|2654107_2654935_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
WP_000691598.1|2655134_2656061_+	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000848528.1|2656111_2656369_+	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000095187.1|2656411_2658631_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000059395.1|2658741_2660154_-	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000965712.1|2660228_2660966_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_001281841.1|2661199_2663458_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.8e-84
WP_000183494.1|2664003_2664486_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000712658.1|2664538_2664931_-	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 195
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2668758	2679720	4733615		Bacillus_virus(20.0%)	12	NA	NA
WP_000195296.1|2668758_2670651_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
WP_000105733.1|2670679_2671261_-	esterase YqiA	NA	NA	NA	NA	NA
WP_000444747.1|2671260_2672088_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000833393.1|2672112_2672535_-	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000917117.1|2672535_2673165_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000735278.1|2673369_2674851_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000831543.1|2674998_2675670_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000442860.1|2675675_2676836_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_001299419.1|2676873_2677662_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_001295627.1|2677804_2678578_+	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_000469266.1|2678635_2678806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001076997.1|2679066_2679720_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
>prophage 196
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2689235	2690669	4733615		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869178.1|2689235_2690669_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 197
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2695806	2697045	4733615	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708501.1|2695806_2697045_+|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.6	5.9e-93
>prophage 198
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2703429	2719576	4733615	tRNA	Moraxella_phage(16.67%)	12	NA	NA
WP_001264365.1|2703429_2704443_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	4.8e-109
WP_001144069.1|2704679_2704895_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918827.1|2705005_2706751_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_000437371.1|2706945_2708787_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000228937.1|2708864_2709371_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001065895.1|2709624_2710389_-	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000018005.1|2710676_2711300_+	DNA-binding transcriptional regulator NfeR	NA	NA	NA	NA	NA
WP_000094682.1|2711406_2712927_-	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	52.2	1.4e-35
WP_001297164.1|2713344_2714724_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	4.5e-33
WP_000450589.1|2714765_2715098_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000212470.1|2715316_2716300_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_001082883.1|2716483_2719576_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.2	2.0e-158
>prophage 199
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2731383	2732349	4733615		Escherichia_phage(100.0%)	1	NA	NA
WP_001098806.1|2731383_2732349_+	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 200
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2758365	2760660	4733615		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861734.1|2758365_2760660_-	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	7.4e-158
>prophage 201
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2768979	2770125	4733615		Streptococcus_phage(100.0%)	1	NA	NA
WP_001299416.1|2768979_2770125_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	1.7e-49
>prophage 202
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2793134	2800927	4733615		Streptococcus_phage(25.0%)	10	NA	NA
WP_000809253.1|2793134_2793995_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.3	2.1e-49
WP_000249157.1|2794058_2796095_+	penicillin-binding protein activator LpoA	NA	NA	NA	NA	NA
WP_000246865.1|2796052_2796448_+	YraN family protein	NA	NA	NA	NA	NA
WP_001158035.1|2796467_2797058_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000646033.1|2797067_2797643_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_047657031.1|2797756_2798797_-	permease	NA	NA	NA	NA	NA
WP_001298741.1|2798869_2799505_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000037608.1|2799632_2800151_+	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_000449030.1|2800130_2800574_-	YhbP family protein	NA	NA	NA	NA	NA
WP_000189314.1|2800624_2800927_+	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	3.9e-14
>prophage 203
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2806754	2808644	4733615		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|2806754_2808644_-	ATP-dependent RNA helicase DeaD	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 204
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2814125	2820764	4733615		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_000133044.1|2814125_2816798_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
WP_001031057.1|2816822_2818310_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_001300397.1|2818337_2818790_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000207683.1|2819420_2820764_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
>prophage 205
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2824846	2827719	4733615	protease	Pandoravirus(50.0%)	2	NA	NA
WP_000764731.1|2824846_2825695_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
WP_001107467.1|2825784_2827719_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
>prophage 206
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2834347	2835825	4733615		Indivirus(50.0%)	2	NA	NA
WP_001047336.1|2834347_2835319_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
WP_000445413.1|2835546_2835825_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
>prophage 207
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2839893	2854688	4733615		Staphylococcus_phage(25.0%)	17	NA	NA
WP_000438245.1|2839893_2840703_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
WP_000922872.1|2840912_2841890_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_001295557.1|2841903_2842890_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000030016.1|2842910_2843477_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_000030537.1|2843473_2844049_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000669785.1|2844017_2844575_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000224099.1|2844581_2845307_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000809051.1|2845354_2846788_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_001176599.1|2846810_2847098_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_073508558.1|2847215_2847707_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_000243741.1|2847752_2848607_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000216791.1|2848603_2848876_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000620387.1|2849089_2849722_+	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000047091.1|2849718_2850447_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_001299134.1|2850443_2851097_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000809774.1|2851326_2853663_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001176896.1|2853758_2854688_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
>prophage 208
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2861437	2866185	4733615		Salmonella_phage(50.0%)	5	NA	NA
WP_000445144.1|2861437_2862565_+	DUF1016 family protein	NA	A0A0U2BZN7	Salmonella_phage	88.5	4.7e-73
WP_000979882.1|2862624_2863089_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000209003.1|2863085_2863961_-	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000054239.1|2863957_2864647_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000108459.1|2864694_2866185_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
>prophage 209
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2869889	2870387	4733615	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366129.1|2869889_2870387_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
>prophage 210
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2874353	2876878	4733615	protease	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001295271.1|2874353_2875721_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
WP_000497723.1|2875810_2876878_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
>prophage 211
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2893374	2894418	4733615		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|2893374_2894418_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 212
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2904983	2905868	4733615		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258919.1|2904983_2905868_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.5	4.9e-25
>prophage 213
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2912372	2916526	4733615		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000738575.1|2912372_2913398_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.5	6.9e-71
WP_000019655.1|2913465_2914647_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_001299298.1|2914656_2915760_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000078338.1|2915767_2916526_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.2e-19
>prophage 214
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2926936	2928408	4733615	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_000114984.1|2926936_2927446_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
WP_000004454.1|2927460_2928408_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
>prophage 215
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2948285	2953859	4733615		Tupanvirus(33.33%)	7	NA	NA
WP_000031783.1|2948285_2949470_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000124700.1|2949540_2951655_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_001138043.1|2951751_2952222_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000246815.1|2952318_2952693_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000903377.1|2952818_2953106_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000820724.1|2953113_2953473_-	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_001209710.1|2953472_2953859_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	38.3	5.6e-18
>prophage 216
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2959429	2968970	4733615		Tupanvirus(25.0%)	9	NA	NA
WP_000634793.1|2959429_2961343_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	5.6e-74
WP_000057356.1|2961342_2962365_+	hydrolase	NA	NA	NA	NA	NA
WP_000907085.1|2962358_2962577_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_001274680.1|2962630_2963500_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_001148908.1|2963554_2963959_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000242755.1|2964260_2964893_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001295162.1|2964943_2967034_+	FUSC family protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_000963792.1|2967100_2968321_-	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_000601844.1|2968406_2968970_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	55.8	2.3e-60
>prophage 217
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	2987984	2988821	4733615		Vibrio_phage(100.0%)	1	NA	NA
WP_000742143.1|2987984_2988821_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	4.9e-67
>prophage 218
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3005796	3010308	4733615		Bacillus_phage(66.67%)	5	NA	NA
WP_001265681.1|3005796_3007419_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
WP_000493756.1|3007535_3007853_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000650976.1|3007911_3008208_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001253696.1|3008239_3009592_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_001157751.1|3009588_3010308_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 219
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3023719	3026113	4733615		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081909.1|3023719_3026113_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 220
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3030492	3031719	4733615		Ralstonia_phage(100.0%)	1	NA	NA
WP_001105504.1|3030492_3031719_-	RNA-splicing ligase RtcB	NA	A0A1L7N133	Ralstonia_phage	60.0	4.0e-134
>prophage 221
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3042384	3044832	4733615		Dickeya_phage(100.0%)	1	NA	NA
WP_000993455.1|3042384_3044832_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 222
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3064841	3066652	4733615		Enterococcus_phage(50.0%)	2	NA	NA
WP_000073590.1|3064841_3065585_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	6.4e-10
WP_000907790.1|3065581_3066652_-	sn-glycerol 3-phosphate ABC transporter ATP binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
>prophage 223
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3070192	3071675	4733615		Planktothrix_phage(50.0%)	2	NA	NA
WP_000416895.1|3070192_3070906_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
WP_000082101.1|3070907_3071675_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
>prophage 224
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3077408	3080227	4733615		Salicola_phage(50.0%)	3	NA	NA
WP_000130217.1|3077408_3078263_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
WP_001042003.1|3078507_3079566_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000617723.1|3079558_3080227_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
>prophage 225
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3083230	3087362	4733615		Dickeya_phage(50.0%)	4	NA	NA
WP_000964718.1|3083230_3083857_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
WP_000106527.1|3083930_3086129_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.3	5.0e-119
WP_000130621.1|3086230_3086476_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_001100467.1|3086696_3087362_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	5.6e-58
>prophage 226
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3095255	3101152	4733615		Bacillus_virus(33.33%)	6	NA	NA
WP_000173666.1|3095255_3096062_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	4.5e-17
WP_001190062.1|3096067_3096469_+	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_000593555.1|3096588_3096948_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_001259388.1|3096944_3097220_-	type II toxin-antitoxin system HicA family toxin	NA	R4JMD3	Burkholderia_phage	48.8	3.2e-15
WP_001314210.1|3097292_3098417_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000149125.1|3098416_3101152_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.9	9.2e-22
>prophage 227
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3114564	3116607	4733615		Indivirus(100.0%)	1	NA	NA
WP_001295214.1|3114564_3116607_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.9	3.4e-45
>prophage 228
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3119952	3122087	4733615		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_000008957.1|3119952_3120306_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	9.7e-25
WP_001347664.1|3120359_3121649_+	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.8	2.1e-173
WP_000065786.1|3121661_3122087_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	2.5e-51
>prophage 229
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3126978	3127626	4733615		Bacillus_virus(100.0%)	1	NA	NA
WP_001307446.1|3126978_3127626_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 230
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3174123	3176108	4733615		Bacillus_virus(50.0%)	2	NA	NA
WP_000107035.1|3174123_3175128_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	8.6e-18
WP_001196496.1|3175124_3176108_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	8.7e-15
>prophage 231
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3191857	3194191	4733615		Escherichia_phage(100.0%)	1	NA	NA
WP_000013928.1|3191857_3194191_-	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.4	4.9e-72
>prophage 232
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3197845	3198058	4733615		Morganella_phage(100.0%)	1	NA	NA
WP_000014594.1|3197845_3198058_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 233
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3202282	3203278	4733615		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182653.1|3202282_3203278_+	O-acetyltransferase WecH	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.7	9.1e-12
>prophage 234
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3208596	3210138	4733615		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146479.1|3208596_3210138_+	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	2.5e-16
>prophage 235
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3238562	3240407	4733615		Tupanvirus(100.0%)	1	NA	NA
WP_000582487.1|3238562_3240407_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.6	1.3e-16
>prophage 236
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3271384	3282112	4733615		Rhizobium_phage(16.67%)	10	NA	NA
WP_000024392.1|3271384_3271636_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
WP_001315904.1|3271776_3272208_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_001352773.1|3272452_3273997_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001214147.1|3274006_3275290_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000483856.1|3275293_3276253_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000982091.1|3276239_3277274_-	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
WP_000646014.1|3277512_3278538_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_001213834.1|3278547_3279744_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
WP_000842823.1|3280018_3280876_-	protein YibB	NA	NA	NA	NA	NA
WP_000587764.1|3281179_3282112_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	1.1e-35
>prophage 237
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3294043	3298606	4733615		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_001171866.1|3294043_3294523_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	4.8e-27
WP_001114546.1|3294561_3295371_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.5	1.5e-25
WP_001051798.1|3295468_3295636_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000091955.1|3295656_3295893_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001298959.1|3296109_3296778_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_000050117.1|3296949_3298170_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	5.0e-44
WP_000976070.1|3298147_3298606_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	9.6e-49
>prophage 238
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3301979	3308730	4733615		Morganella_phage(25.0%)	6	NA	NA
WP_047657217.1|3301979_3302804_+	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	76.6	2.4e-90
WP_000924289.1|3303095_3303713_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_001399398.1|3303709_3305392_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.1	5.7e-22
WP_001295237.1|3305649_3306273_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000135058.1|3306327_3306603_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000280488.1|3306621_3308730_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 239
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3313851	3315243	4733615		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|3313851_3315243_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 240
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3327361	3328696	4733615		Moraxella_phage(100.0%)	1	NA	NA
WP_001058151.1|3327361_3328696_-	adenine permease AdeQ	NA	A0A0R6PHV4	Moraxella_phage	37.2	8.6e-66
>prophage 241
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3336001	3345162	4733615		Micromonas_sp._RCC1109_virus(25.0%)	10	NA	NA
WP_000168432.1|3336001_3337690_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	5.4e-57
WP_001315912.1|3337795_3337894_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000060506.1|3338457_3338547_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_000828746.1|3338965_3340150_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	8.9e-14
WP_000148063.1|3340157_3340655_-	radical SAM protein	NA	NA	NA	NA	NA
WP_001113432.1|3340651_3341014_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000703959.1|3341003_3341351_-	YidH family protein	NA	NA	NA	NA	NA
WP_000511287.1|3341460_3341910_+	membrane protein	NA	NA	NA	NA	NA
WP_000828483.1|3341956_3343450_-	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	25.4	1.1e-29
WP_001087147.1|3343446_3345162_-	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.6	5.6e-41
>prophage 242
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3351508	3352462	4733615		Synechococcus_phage(50.0%)	2	NA	NA
WP_001243431.1|3351508_3351937_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
WP_001243437.1|3352048_3352462_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 243
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3356889	3358038	4733615		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705001.1|3356889_3358038_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 244
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3362742	3370111	4733615		Bacillus_virus(33.33%)	8	NA	NA
WP_000072067.1|3362742_3365157_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
WP_000060112.1|3365185_3366259_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000673464.1|3366258_3367359_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000059111.1|3367363_3368767_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_120795392.1|3369063_3369144_+	protein YsdD	NA	NA	NA	NA	NA
WP_000831330.1|3369373_3369514_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_000239730.1|3369530_3369890_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_001307474.1|3369853_3370111_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 245
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3380309	3381647	4733615		Moraxella_phage(100.0%)	1	NA	NA
WP_000082693.1|3380309_3381647_-	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 246
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3392637	3396478	4733615		Bacillus_phage(50.0%)	4	NA	NA
WP_000063125.1|3392637_3393411_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
WP_001251991.1|3393501_3394392_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000741620.1|3394391_3395351_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_000867146.1|3395437_3396478_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
>prophage 247
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3402009	3405371	4733615		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_000334099.1|3402009_3403839_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.4	1.9e-132
WP_000933736.1|3404000_3405371_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
>prophage 248
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3417323	3418316	4733615		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845106.1|3417323_3418316_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.2e-50
>prophage 249
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3421484	3427337	4733615		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_000102319.1|3421484_3423353_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
WP_000715936.1|3423519_3423939_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_047657163.1|3423946_3425452_+	ribose ABC transporter ATP-binding protein RbsA	NA	G3M9Y6	Bacillus_virus	27.7	3.9e-14
WP_000211858.1|3425456_3426422_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_001056273.1|3426446_3427337_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
>prophage 250
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3440729	3442376	4733615		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_033817519.1|3440729_3442376_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	2.2e-66
>prophage 251
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3450849	3456261	4733615		Bacillus_phage(33.33%)	4	NA	NA
WP_001238869.1|3450849_3452871_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	2.9e-113
WP_001295254.1|3452917_3454402_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000047499.1|3454535_3455801_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001280776.1|3455931_3456261_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
>prophage 252
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3460303	3466447	4733615		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000866672.1|3460303_3461434_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	31.3	3.9e-27
WP_000006618.1|3461430_3462693_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	5.9e-24
WP_001226604.1|3462692_3463760_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.7	3.5e-102
WP_000676056.1|3463778_3464660_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001145196.1|3464637_3465312_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000612036.1|3465316_3466447_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.6e-18
>prophage 253
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3484912	3488771	4733615		Bacillus_phage(100.0%)	3	NA	NA
WP_000130691.1|3484912_3485809_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
WP_001213584.1|3485808_3486525_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000383424.1|3486608_3488771_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
>prophage 254
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3496257	3498087	4733615		Catovirus(100.0%)	1	NA	NA
WP_001346040.1|3496257_3498087_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	9.7e-84
>prophage 255
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3510498	3513785	4733615		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_000187530.1|3510498_3512139_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	8.2e-42
WP_001295260.1|3512217_3512487_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000459594.1|3512490_3513006_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_000109943.1|3513008_3513785_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
>prophage 256
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3522575	3523190	4733615		Streptococcus_phage(100.0%)	1	NA	NA
WP_073508554.1|3522575_3523190_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 257
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3536785	3539572	4733615		uncultured_virus(100.0%)	1	NA	NA
WP_073508553.1|3536785_3539572_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	1.7e-71
>prophage 258
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3543650	3546121	4733615		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_001188776.1|3543650_3545060_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
WP_000190577.1|3545071_3546121_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
>prophage 259
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3562344	3565124	4733615		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000718893.1|3562344_3563241_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	90.7	1.3e-60
WP_000621656.1|3563408_3564305_+	sulfofructose kinase	NA	NA	NA	NA	NA
WP_000059678.1|3564338_3565124_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
>prophage 260
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3573997	3577048	4733615		Escherichia_phage(100.0%)	1	NA	NA
WP_011310337.1|3573997_3577048_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 261
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3591756	3596617	4733615		Bacillus_thuringiensis_phage(33.33%)	5	NA	NA
WP_001297064.1|3591756_3592377_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
WP_001166062.1|3592636_3593620_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270270.1|3593768_3594443_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|3594548_3595922_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033722.1|3595918_3596617_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
>prophage 262
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3608191	3612694	4733615		Paramecium_bursaria_Chlorella_virus(50.0%)	5	NA	NA
WP_000084268.1|3608191_3609037_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|3609461_3609707_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|3609791_3610277_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139496.1|3610369_3611296_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293343.1|3611362_3612694_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
>prophage 263
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3635386	3642633	4733615		Synechococcus_phage(33.33%)	5	NA	NA
WP_047657270.1|3635386_3636049_-	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.1	2.1e-28
WP_023140301.1|3636060_3638562_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_073508548.1|3638870_3639950_+	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000161265.1|3639964_3640285_+	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_073508547.1|3640335_3642633_+	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
>prophage 264
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3659733	3661578	4733615		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000591355.1|3659733_3661578_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	7.1e-10
>prophage 265
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3670084	3673137	4733615		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000023081.1|3670084_3671035_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
WP_000031784.1|3671952_3673137_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 266
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3677253	3685582	4733615		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000263098.1|3677253_3681282_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
WP_000653944.1|3681358_3685582_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
>prophage 267
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3694798	3696562	4733615		Klosneuvirus(50.0%)	3	NA	NA
WP_000362388.1|3694798_3695470_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
WP_000940106.1|3695512_3696103_+	YjaG family protein	NA	NA	NA	NA	NA
WP_001044513.1|3696289_3696562_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
>prophage 268
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3701930	3703520	4733615		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187485.1|3701930_3703520_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.4	8.4e-68
>prophage 269
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3718893	3722577	4733615		Dickeya_phage(100.0%)	1	NA	NA
WP_073508546.1|3718893_3722577_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 270
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3728227	3729019	4733615		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001130534.1|3728227_3729019_+	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	45.5	1.4e-47
>prophage 271
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3744881	3745997	4733615		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|3744881_3745997_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 272
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3755213	3755822	4733615		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|3755213_3755822_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 273
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3762443	3764991	4733615		Escherichia_phage(50.0%)	2	NA	NA
WP_000918363.1|3762443_3763859_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
WP_001147325.1|3763911_3764991_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	1.5e-28
>prophage 274
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3769198	3772811	4733615		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000357740.1|3769198_3772021_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
WP_000168305.1|3772274_3772811_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
>prophage 275
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3776628	3777978	4733615		Moraxella_phage(100.0%)	1	NA	NA
WP_000106879.1|3776628_3777978_+	guanine/hypoxanthine transporter GhxP	NA	A0A0R6PHV4	Moraxella_phage	71.6	2.3e-159
>prophage 276
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3783561	3785520	4733615		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078239.1|3783561_3785520_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.9e-90
>prophage 277
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3794802	3796950	4733615		Escherichia_phage(100.0%)	1	NA	NA
WP_077781815.1|3794802_3796950_-	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.7	7.7e-32
>prophage 278
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3802195	3804181	4733615		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001307516.1|3802195_3804181_-	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.5	5.5e-149
>prophage 279
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3808165	3809715	4733615		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_000611428.1|3808165_3808846_-	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	25.0	8.7e-06
WP_001075526.1|3808956_3809715_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	27.8	1.0e-15
>prophage 280
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3815275	3816064	4733615		Cedratvirus(100.0%)	1	NA	NA
WP_001193391.1|3815275_3816064_-	phosphonate ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.1	8.5e-13
>prophage 281
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3820903	3822406	4733615		Burkholderia_virus(100.0%)	1	NA	NA
WP_001296882.1|3820903_3822406_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.0	7.0e-56
>prophage 282
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3843602	3846814	4733615	tRNA	Catovirus(50.0%)	2	NA	NA
WP_001295087.1|3843602_3845120_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.0e-87
WP_000856829.1|3845356_3846814_-	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.4	6.8e-48
>prophage 283
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3861091	3863075	4733615		Cronobacter_phage(50.0%)	2	NA	NA
WP_001026276.1|3861091_3861385_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|3861428_3863075_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
>prophage 284
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3868872	3869406	4733615		Morganella_phage(100.0%)	1	NA	NA
WP_001238378.1|3868872_3869406_-	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 285
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3874326	3875304	4733615		Tupanvirus(100.0%)	1	NA	NA
WP_000004770.1|3874326_3875304_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	1.2e-27
>prophage 286
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3882732	3883278	4733615		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001295188.1|3882732_3883278_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 287
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3887193	3900224	4733615	tRNA,protease	Vibrio_phage(20.0%)	11	NA	NA
WP_047657117.1|3887193_3888531_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_001542593.1|3888540_3890388_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	5.8e-60
WP_001280345.1|3890380_3891331_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|3891416_3891725_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460360.1|3891800_3893081_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312488.1|3893166_3894426_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|3894428_3895433_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|3895514_3895712_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|3895815_3897114_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|3897318_3897744_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076316.1|3897782_3900224_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
>prophage 288
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3904156	3905320	4733615		Ralstonia_phage(100.0%)	1	NA	NA
WP_000943988.1|3904156_3905320_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.2	1.4e-80
>prophage 289
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3947958	3954446	4733615		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_000055075.1|3947958_3948489_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000265933.1|3948798_3949755_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000205795.1|3949894_3951397_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.1e-11
WP_001296689.1|3951410_3952433_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596027.1|3952419_3953415_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|3953447_3954446_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
>prophage 290
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3958756	3961517	4733615		Cronobacter_phage(50.0%)	2	NA	NA
WP_001106236.1|3958756_3959221_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	58.9	2.9e-53
WP_000187795.1|3959378_3961517_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
>prophage 291
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3965155	3971252	4733615		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_001181324.1|3965155_3966103_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001387276.1|3966287_3966341_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471889.1|3966481_3969178_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_000047539.1|3969383_3969770_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|3969842_3970304_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|3970316_3971252_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
>prophage 292
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3979529	3984473	4733615	tRNA	Klosneuvirus(50.0%)	3	NA	NA
WP_000416392.1|3979529_3982385_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.8e-140
WP_000786399.1|3982384_3982828_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|3982961_3984473_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
>prophage 293
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	3988673	3993110	4733615		Acanthamoeba_polyphaga_mimivirus(50.0%)	2	NA	NA
WP_001593906.1|3988673_3989693_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	2.4e-44
WP_001022619.1|3991640_3993110_-	serine/threonine protein kinase	NA	A0A2K9L5Y0	Tupanvirus	26.5	1.4e-11
>prophage 294
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	4004463	4012690	4733615		uncultured_virus(33.33%)	7	NA	NA
WP_001593915.1|4004463_4006611_-	N-6 DNA methylase	NA	B3GAM1	uncultured_virus	42.3	5.7e-19
WP_000148644.1|4006661_4007048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000504880.1|4007044_4008388_-	McrC family protein	NA	NA	NA	NA	NA
WP_000177023.1|4008380_4010456_-	AAA family ATPase	NA	K4I1H4	Acidithiobacillus_phage	33.8	4.5e-37
WP_000168559.1|4010625_4011498_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_001338066.1|4011579_4011702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000991447.1|4011709_4012690_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	55.6	3.9e-100
>prophage 295
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	4016051	4017728	4733615		Escherichia_phage(100.0%)	2	NA	NA
WP_000790583.1|4016051_4016654_+	type 1 fimbria switch DNA invertase FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
WP_000044711.1|4017131_4017728_+	type 1 fimbria switch DNA invertase FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
>prophage 296
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	4027995	4029456	4733615		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208194.1|4027995_4029456_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	9.5e-50
>prophage 297
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	4036024	4036579	4733615		Clostridioides_phage(100.0%)	1	NA	NA
WP_001151854.1|4036024_4036579_+	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
>prophage 298
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	4044080	4045037	4733615	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_047657183.1|4044080_4045037_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	2.3e-60
>prophage 299
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	4051580	4055549	4733615		Acinetobacter_phage(50.0%)	2	NA	NA
WP_001387312.1|4051580_4053050_-	type I restriction-modification system subunit M	NA	J7I0U9	Acinetobacter_phage	27.3	9.6e-34
WP_001593930.1|4053116_4055549_-	DEAD/DEAH box helicase family protein	NA	A0A2I5ARD8	Synechococcus_phage	25.0	1.0e-08
>prophage 300
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	4072077	4077442	4733615		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_073508541.1|4072077_4073742_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
WP_000410129.1|4073790_4075152_-	MFS transporter	NA	NA	NA	NA	NA
WP_000091569.1|4075366_4076281_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000106030.1|4076419_4077442_+	L-galactonate oxidoreductase	NA	A0A2K9L7I1	Tupanvirus	26.3	2.7e-11
>prophage 301
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	4080668	4081948	4733615		Shigella_phage(50.0%)	2	NA	NA
WP_000799911.1|4080668_4081406_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
WP_000098818.1|4081408_4081948_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
>prophage 302
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	4089844	4092720	4733615		Streptococcus_phage(50.0%)	3	NA	NA
WP_000175943.1|4089844_4091434_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001295748.1|4091826_4092432_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|4092558_4092720_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
>prophage 303
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	4098355	4099678	4733615		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477808.1|4098355_4099678_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	1.4e-79
>prophage 304
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	4106421	4111776	4733615		Enterococcus_phage(33.33%)	3	NA	NA
WP_000093810.1|4106421_4107654_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
WP_000046749.1|4107960_4109628_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000409450.1|4109838_4111776_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	35.7	2.3e-11
>prophage 305
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	4115007	4117121	4733615		Bacillus_phage(50.0%)	2	NA	NA
WP_001188659.1|4115007_4115697_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
WP_001219604.1|4115696_4117121_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.7	1.2e-09
>prophage 306
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	4128889	4137958	4733615		Cyanophage(20.0%)	9	NA	NA
WP_000130189.1|4128889_4129843_+	transaldolase	NA	A0A127KNC6	Cyanophage	30.9	4.8e-10
WP_001094682.1|4129957_4130545_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000528538.1|4130579_4131146_-	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001102383.1|4131294_4132008_-	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000843559.1|4132033_4132438_-	DUF2541 family protein	NA	NA	NA	NA	NA
WP_000516135.1|4132814_4134731_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_001118464.1|4134819_4135950_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_000935262.1|4136053_4136263_-	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	73.9	8.0e-19
WP_000681360.1|4136791_4137958_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.3	7.5e-90
>prophage 307
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	4144990	4147807	4733615	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001286857.1|4144990_4147807_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	2.7e-77
>prophage 308
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	4152213	4153362	4733615		Halovirus(100.0%)	1	NA	NA
WP_000597260.1|4152213_4153362_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 309
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	4158832	4164492	4733615		Hepacivirus(50.0%)	4	NA	NA
WP_001395601.1|4158832_4160386_-	crotonobetaine/carnitine-CoA ligase	NA	Q75ZG1	Hepacivirus	25.4	6.2e-31
WP_000349938.1|4160459_4161677_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_000347117.1|4161804_4162947_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000787103.1|4162977_4164492_-	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
>prophage 310
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	4172387	4173787	4733615		Bacillus_phage(50.0%)	2	NA	NA
WP_000624375.1|4172387_4172867_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
WP_000257192.1|4172944_4173787_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH	NA	A0A075BTY6	Microcystis_phage	42.0	1.0e-08
>prophage 311
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	4182810	4188233	4733615		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001117011.1|4182810_4185717_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
WP_000035651.1|4185881_4188233_-	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.3e-37
>prophage 312
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	4194565	4195264	4733615		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916291.1|4194565_4195264_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	37.2	2.8e-23
>prophage 313
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	4207966	4209691	4733615		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_000425657.1|4207966_4209691_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	8.3e-37
>prophage 314
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	4235664	4236708	4733615		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217338.1|4235664_4236708_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 315
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	4240953	4241505	4733615		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923721.1|4240953_4241505_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	32.3	3.0e-12
>prophage 316
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	4250132	4251557	4733615		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|4250132_4251557_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 317
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	4259206	4265674	4733615		Mamastrovirus(33.33%)	5	NA	NA
WP_001189602.1|4259206_4260757_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
WP_001349940.1|4260803_4263194_-	quinoprotein glucose dehydrogenase	NA	NA	NA	NA	NA
WP_000683335.1|4263399_4263936_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_000651599.1|4263976_4264639_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000150637.1|4264747_4265674_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
>prophage 318
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	4268936	4269839	4733615		Sodalis_phage(100.0%)	1	NA	NA
WP_000339945.1|4268936_4269839_+	recombination-promoting nuclease RpnC	NA	Q2A0A7	Sodalis_phage	49.2	5.7e-61
>prophage 319
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	4279745	4286551	4733615	tRNA	unidentified_phage(50.0%)	6	NA	NA
WP_000174643.1|4279745_4281164_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
WP_000937432.1|4281202_4282129_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_001155227.1|4282165_4282621_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000396036.1|4282798_4283503_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001294700.1|4283517_4284048_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_001676320.1|4284121_4286551_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.3	3.9e-40
>prophage 320
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	4291794	4292592	4733615		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158931.1|4291794_4292592_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	2.7e-14
>prophage 321
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	4298503	4298848	4733615		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|4298503_4298848_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 322
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	4302777	4304202	4733615	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753946.1|4302777_4304202_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 323
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	4316086	4390944	4733615	protease,plate,transposase,tRNA	uncultured_Caudovirales_phage(18.18%)	58	NA	NA
WP_001295562.1|4316086_4316845_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
WP_000922446.1|4316857_4317715_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_001346129.1|4317726_4319079_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|4319108_4321541_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|4321662_4322148_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139279.1|4322151_4323177_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|4323281_4323737_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|4323740_4324529_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000166359.1|4324528_4325677_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569430.1|4325673_4326270_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294774.1|4326306_4329789_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055741.1|4329801_4330761_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020973.1|4330859_4333001_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|4333057_4333447_+	VOC family protein	NA	NA	NA	NA	NA
WP_047657065.1|4333511_4334810_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|4334858_4335119_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|4335105_4335306_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185290.1|4335471_4336017_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635545.1|4336013_4336436_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239192.1|4336449_4337160_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001260716.1|4338190_4339909_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094011.1|4340019_4340727_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|4340723_4341128_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874224.1|4341245_4342061_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|4342100_4342754_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|4342746_4343778_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140175.1|4343965_4344541_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997010.1|4350205_4351009_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_000648577.1|4351005_4351920_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|4352160_4352961_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211729.1|4353038_4353809_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|4353856_4355215_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052707.1|4355286_4356042_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001295200.1|4356075_4356798_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|4356794_4357262_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_073508641.1|4357326_4358058_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	4.5e-40
WP_001086142.1|4358593_4359379_+	aminopeptidase	NA	NA	NA	NA	NA
WP_000908057.1|4360004_4360919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284199.1|4360962_4361445_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087754.1|4361468_4362821_-	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_122985538.1|4362831_4366266_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240545.1|4366374_4367787_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088862.1|4367791_4368535_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614399.1|4368531_4371297_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	1.8e-81
WP_000343302.1|4371305_4372067_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_047657263.1|4372071_4373403_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|4373405_4373930_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113725.1|4373926_4375207_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348806.1|4375231_4376314_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393845.1|4376277_4378128_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611742.1|4378131_4378545_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000123970.1|4380077_4380302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037391.1|4380336_4380837_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|4381533_4382052_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000103361.1|4382261_4384403_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	8.2e-26
WP_073508539.1|4384478_4388540_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.9	4.4e-20
WP_001350058.1|4388499_4388937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073513887.1|4389807_4390944_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 324
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	4395109	4399028	4733615		Caulobacter_phage(50.0%)	6	NA	NA
WP_000284050.1|4395109_4395688_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000333380.1|4395893_4396661_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|4396631_4397372_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000615982.1|4397527_4397806_-	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_000729704.1|4397808_4398069_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000543899.1|4398254_4399028_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
>prophage 325
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	4409924	4417506	4733615		Streptococcus_phage(50.0%)	6	NA	NA
WP_000749865.1|4409924_4410980_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	2.0e-118
WP_001285288.1|4411267_4412371_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893255.1|4412382_4413636_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
WP_001111349.1|4413952_4414363_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000121330.1|4414341_4415298_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000667026.1|4415307_4417506_-	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
>prophage 326
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	4437697	4439023	4733615		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_001046295.1|4437697_4439023_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	8.5e-114
>prophage 327
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	4444598	4455074	4733615	holin	Catovirus(33.33%)	5	NA	NA
WP_001159102.1|4444598_4446269_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_000089077.1|4446282_4447755_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001295527.1|4447768_4448356_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_047657037.1|4448484_4450518_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001585377.1|4451090_4455074_+	autotransporter adhesin EhaA	NA	A0A2L1IV18	Escherichia_phage	38.0	1.2e-123
>prophage 328
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	4467068	4471606	4733615		Bacillus_virus(50.0%)	4	NA	NA
WP_000447344.1|4467068_4468553_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.8	8.0e-12
WP_000818900.1|4468545_4469517_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000750340.1|4469513_4470470_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000692742.1|4470556_4471606_+	NADPH-dependent aldehyde reductase YahK	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	42.3	1.1e-71
>prophage 329
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	4479986	4485581	4733615		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000010284.1|4479986_4481873_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	2.4e-53
WP_000076236.1|4482109_4483369_+	cytosine permease	NA	NA	NA	NA	NA
WP_001299008.1|4483358_4484642_+	cytosine/isoguanine deaminase	NA	NA	NA	NA	NA
WP_000952485.1|4484681_4485581_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	4.2e-16
>prophage 330
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	4489421	4493701	4733615		Herpes_simplex_virus(50.0%)	2	NA	NA
WP_000177918.1|4489421_4492496_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	99.1	0.0e+00
WP_000805902.1|4492618_4493701_-	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	100.0	7.5e-193
>prophage 331
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	4499111	4501072	4733615		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
WP_000044314.1|4499111_4500062_+	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
WP_001013499.1|4500058_4501072_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	1.2e-43
>prophage 332
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	4504150	4505260	4733615		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000842102.1|4504150_4505260_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
>prophage 333
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	4510557	4511325	4733615		Planktothrix_phage(100.0%)	1	NA	NA
WP_000939349.1|4510557_4511325_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.3	1.9e-25
>prophage 334
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	4518290	4519448	4733615		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830741.1|4518290_4519448_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	5.1e-06
>prophage 335
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	4526862	4527978	4733615		Bacillus_phage(100.0%)	1	NA	NA
WP_000484055.1|4526862_4527978_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.5e-18
>prophage 336
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	4532267	4542239	4733615		Bacillus_phage(60.0%)	7	NA	NA
WP_001298537.1|4532267_4533179_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
WP_001219320.1|4533303_4534212_+	fructokinase	NA	NA	NA	NA	NA
WP_001345723.1|4534354_4535539_-	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_000698879.1|4535664_4538808_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001221332.1|4538804_4540007_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	1.8e-06
WP_000113933.1|4540196_4540886_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_000893603.1|4540943_4542239_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.3e-26
>prophage 337
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	4549191	4558172	4733615	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_000667319.1|4549191_4550319_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
WP_000007629.1|4550341_4550674_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000934822.1|4550701_4552549_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000046637.1|4552559_4553531_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000974813.1|4553659_4554007_+	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_001295328.1|4554183_4555068_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_001295327.1|4555366_4555906_-	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_000543535.1|4556056_4556506_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001150472.1|4556509_4557613_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.5	5.3e-53
WP_001021161.1|4557701_4558172_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
>prophage 338
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	4582003	4587050	4733615	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_000122253.1|4582003_4582627_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_000130305.1|4582752_4584027_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_001295325.1|4584214_4586569_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_001043542.1|4586777_4587050_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
>prophage 339
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	4590178	4590874	4733615		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817229.1|4590178_4590874_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
>prophage 340
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	4594197	4597744	4733615		Bacillus_phage(100.0%)	2	NA	NA
WP_001235608.1|4594197_4595970_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	2.6e-49
WP_001256180.1|4595962_4597744_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	1.1e-42
>prophage 341
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	4606579	4609729	4733615		Leptospira_phage(100.0%)	1	NA	NA
WP_001132469.1|4606579_4609729_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 342
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	4616737	4625299	4733615		Klosneuvirus(25.0%)	8	NA	NA
WP_000127356.1|4616737_4617289_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
WP_000122008.1|4617417_4619349_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000467098.1|4619401_4619731_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_001195025.1|4619730_4620336_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_000678208.1|4620445_4622320_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_001220233.1|4622500_4623145_+	adenylate kinase	NA	NA	NA	NA	NA
WP_001250088.1|4623380_4624343_+	ferrochelatase	NA	NA	NA	NA	NA
WP_000801832.1|4624339_4625299_-	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.3	1.1e-14
>prophage 343
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	4633543	4636503	4733615		Escherichia_phage(50.0%)	2	NA	NA
WP_001361120.1|4633543_4633885_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	73.6	3.9e-39
WP_000078266.1|4633998_4636503_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.2	2.9e-115
>prophage 344
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	4641042	4641720	4733615		Bacillus_virus(100.0%)	1	NA	NA
WP_001157535.1|4641042_4641720_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	2.4e-27
>prophage 345
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	4644856	4653791	4733615		uncultured_Caudovirales_phage(66.67%)	5	NA	NA
WP_001110573.1|4644856_4645543_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561844.1|4645539_4647954_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_073513888.1|4648383_4652673_+	rhs element protein RhsD	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	41.5	2.1e-20
WP_000877768.1|4652712_4653081_+	YbbC/YhhH family protein	NA	NA	NA	NA	NA
WP_001306947.1|4653080_4653791_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.9	4.2e-19
>prophage 346
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	4659047	4660829	4733615		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_001096878.1|4659047_4660829_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.1	2.1e-38
>prophage 347
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	4667020	4668166	4733615		Streptococcus_phage(100.0%)	1	NA	NA
WP_000706355.1|4667020_4668166_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.8e-48
>prophage 348
NZ_CP010230	Escherichia coli strain S21 chromosome, complete genome	4733615	4679644	4733461	4733615	terminase,capsid,tRNA,lysis,integrase,tail,head,portal,transposase	Enterobacteria_phage(56.36%)	66	4675390:4675405	4711847:4711862
4675390:4675405	attL	TCGCTGCTGGCGCTGG	NA	NA	NA	NA
WP_000912345.1|4679644_4681030_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143552.1|4681065_4681587_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|4681694_4681907_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|4681908_4682775_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|4683255_4683798_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988375.1|4684017_4684710_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_047657191.1|4684740_4687350_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000691056.1|4687362_4688370_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001250422.1|4688380_4688896_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|4688898_4689531_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
WP_001299447.1|4689865_4691029_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.3	3.4e-199
WP_000488407.1|4691227_4691506_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000763385.1|4691553_4691772_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_000151207.1|4691870_4692086_-	hypothetical protein	NA	M1FPM2	Enterobacteria_phage	97.2	8.5e-32
WP_000581108.1|4692093_4692846_-	hypothetical protein	NA	M1FN76	Enterobacteria_phage	99.6	8.4e-151
WP_000682303.1|4692842_4693001_-	DUF1317 family protein	NA	M1FJ61	Enterobacteria_phage	100.0	3.1e-23
WP_021546785.1|4692997_4693678_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	97.8	1.5e-130
WP_000100845.1|4693674_4694460_-	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
WP_000995439.1|4694465_4694762_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000858975.1|4695640_4696330_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067458.1|4696434_4696665_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182899.1|4696734_4697274_+	toxin YdaT domain-containing protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.0e-61
WP_077694507.1|4697270_4698290_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.1	9.7e-110
WP_000788793.1|4698286_4698988_+	Replication protein 14	NA	M1FJ72	Enterobacteria_phage	97.4	2.7e-127
WP_073508532.1|4698984_4699158_+	MarR family transcriptional regulator	NA	A0A0N6WES4	Escherichia_phage	96.4	9.8e-23
WP_073508531.1|4699304_4699799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032227093.1|4700201_4700606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073508529.1|4701201_4701804_+	hypothetical protein	NA	Q7Y5X0	Haemophilus_phage	42.1	3.7e-32
WP_000068668.1|4702008_4702938_+	hypothetical protein	NA	A0A1R3Y6Z6	Salmonella_virus	40.0	3.0e-57
WP_187655762.1|4703004_4704233_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.0	6.3e-172
WP_073508527.1|4704372_4704474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073508526.1|4704470_4704926_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	69.5	2.0e-62
WP_000224914.1|4704925_4705096_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774476.1|4705088_4705379_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	3.0e-48
WP_001099712.1|4705375_4705738_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971074.1|4705734_4705875_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
WP_001204791.1|4705960_4706344_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_073508525.1|4706532_4707615_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	79.0	2.6e-161
WP_000839596.1|4708188_4708404_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_073508524.1|4708403_4708901_+	lysozyme RrrD	NA	A5LH83	Enterobacteria_phage	98.8	1.9e-90
WP_000092273.1|4708897_4709365_+|lysis	lysis protein	lysis	A0A2D1GLQ7	Escherichia_phage	96.8	1.6e-75
WP_001139678.1|4709352_4709505_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
WP_000079508.1|4709856_4710267_-	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_001663509.1|4710323_4710557_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	2.5e-21
WP_000453576.1|4710945_4711491_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	99.4	4.7e-95
WP_001027268.1|4711465_4713391_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
4711847:4711862	attR	TCGCTGCTGGCGCTGG	NA	NA	NA	NA
WP_000198149.1|4713387_4713594_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_072841936.1|4713590_4715192_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.2e-308
WP_000123309.1|4715172_4716492_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.1	7.4e-235
WP_073508523.1|4716501_4716834_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	4.2e-54
WP_000063254.1|4716889_4717915_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.2	2.8e-189
WP_000158875.1|4717956_4718352_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	1.1e-58
WP_000785282.1|4718363_4718717_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_000975081.1|4718728_4719307_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_073508522.1|4719303_4719699_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	97.7	3.2e-69
WP_001317730.1|4719706_4720447_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	5.2e-129
WP_000479193.1|4720462_4720885_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.7	2.2e-60
WP_000459457.1|4720866_4721301_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_073508521.1|4721293_4723855_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	98.4	0.0e+00
WP_073508520.1|4723851_4724181_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	97.2	3.1e-57
WP_001152538.1|4724180_4724879_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	1.1e-131
WP_047088332.1|4724884_4725628_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.1e-147
WP_000090917.1|4725564_4726197_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_073508640.1|4726257_4729656_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.6	0.0e+00
WP_023909745.1|4729722_4730322_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	95.5	7.7e-107
WP_073508439.1|4730386_4733461_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	82.1	2.5e-68
