The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010235	Escherichia coli strain S40 chromosome, complete genome	5399183	1211004	1218144	5399183		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|1211004_1211643_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|1211639_1212902_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|1212898_1213807_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|1214002_1214770_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141330.1|1214820_1215477_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_001272898.1|1215582_1218144_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
>prophage 2
NZ_CP010235	Escherichia coli strain S40 chromosome, complete genome	5399183	1290634	1298398	5399183	transposase,integrase	Escherichia_phage(66.67%)	6	1281795:1281808	1298708:1298721
1281795:1281808	attL	TACCGCCGCAGTCA	NA	NA	NA	NA
WP_113456524.1|1290634_1291796_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.4e-51
WP_000577248.1|1291948_1293667_+	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	99.7	9.4e-307
WP_000214996.1|1293668_1295417_+	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.7	0.0e+00
WP_000448925.1|1295488_1295905_-	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_001341819.1|1295943_1297173_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	100.0	1.5e-234
WP_000162574.1|1297915_1298398_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
1298708:1298721	attR	TGACTGCGGCGGTA	NA	NA	NA	NA
>prophage 3
NZ_CP010235	Escherichia coli strain S40 chromosome, complete genome	5399183	1801778	1811220	5399183		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569325.1|1801778_1802705_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|1802709_1803441_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216961.1|1803421_1803529_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1803588_1804320_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1804541_1806227_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1806223_1806943_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1806989_1807460_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1807500_1807962_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001326004.1|1808086_1810087_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
WP_001292774.1|1810083_1811220_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
>prophage 4
NZ_CP010235	Escherichia coli strain S40 chromosome, complete genome	5399183	1823731	1889151	5399183	integrase,capsid,terminase,head,lysis,holin,plate,tRNA,tail,portal	Escherichia_phage(39.13%)	75	1850981:1851007	1884068:1884094
WP_001295427.1|1823731_1825765_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
WP_001005448.1|1825896_1827006_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001447395.1|1827268_1827550_+	YehE family protein	NA	NA	NA	NA	NA
WP_000830468.1|1827842_1828385_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677398.1|1828465_1829140_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000945409.1|1829155_1831636_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001026151.1|1831649_1832684_+	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000153067.1|1832765_1833104_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134576.1|1833322_1834147_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|1834267_1834540_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001195605.1|1834762_1835551_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822274.1|1835547_1836348_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001307284.1|1836412_1837231_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	1.7e-24
WP_000434038.1|1837282_1838029_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011957.1|1838002_1838968_-	sugar kinase	NA	NA	NA	NA	NA
WP_000846217.1|1838964_1839969_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
WP_000858498.1|1839965_1841243_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129551.1|1841499_1842552_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_001307281.1|1842859_1843714_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000853886.1|1843742_1845005_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182903.1|1845014_1845467_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823287.1|1845497_1845782_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490692.1|1845785_1847141_+	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000844200.1|1847188_1848229_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178552.1|1848328_1849108_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807362.1|1849189_1850089_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001352710.1|1850503_1850821_+	hypothetical protein	NA	NA	NA	NA	NA
1850981:1851007	attL	AAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_000985261.1|1851086_1852100_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	4.1e-193
WP_000020919.1|1852215_1852515_-	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_001081582.1|1852636_1852912_+	regulatory phage cox family protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_001005162.1|1852922_1853093_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_000217677.1|1853089_1853590_+	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
WP_000557703.1|1853653_1853878_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277891.1|1853877_1854177_+	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	100.0	8.4e-46
WP_001113263.1|1854179_1854404_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDG9	Escherichia_phage	100.0	2.2e-35
WP_073534973.1|1854400_1854676_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	97.8	1.9e-44
WP_021546120.1|1854665_1856951_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	96.2	0.0e+00
WP_125075118.1|1857172_1858339_+	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_000181134.1|1858331_1859396_+	serine/threonine protein kinase	NA	G9BWE0	Planktothrix_phage	46.3	4.1e-58
WP_021546119.1|1859392_1860460_+	serine/threonine protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	31.5	1.7e-16
WP_000038193.1|1860774_1861809_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.4	2.1e-200
WP_000156872.1|1861808_1863581_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
WP_001085972.1|1863754_1864609_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MI4	Enterobacteria_phage	100.0	1.3e-139
WP_001248560.1|1864667_1865741_+|capsid	phage major capsid protein, P2 family	capsid	Q94MI3	Enterobacteria_phage	99.7	1.5e-201
WP_000203441.1|1865744_1866488_+|terminase	terminase endonuclease subunit	terminase	Q94MH3	Enterobacteria_phage	99.6	8.1e-122
WP_000988633.1|1866587_1867097_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846409.1|1867096_1867300_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000123124.1|1867303_1867585_+|holin	phage holin family protein	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_001144101.1|1867584_1868082_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_053276449.1|1868096_1868522_+	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	94.3	4.0e-57
WP_032152948.1|1868509_1868935_+|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	96.5	1.4e-65
WP_001774102.1|1869042_1869510_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.1	9.7e-81
WP_001001786.1|1869502_1869955_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	100.0	8.2e-77
WP_053276450.1|1870021_1870657_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	97.2	4.6e-110
WP_001532465.1|1870653_1871001_+	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	98.3	7.2e-57
WP_001532463.1|1871005_1871914_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.7	2.8e-161
WP_001285325.1|1871906_1872437_+|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	100.0	2.3e-102
WP_053276451.1|1872447_1874658_+|tail	tail fiber protein	tail	U5N099	Enterobacteria_phage	93.8	0.0e+00
WP_042036472.1|1874661_1875189_+|tail	tail fiber assembly protein	tail	U5N0T1	Enterobacteria_phage	96.0	1.4e-91
WP_000002748.1|1875409_1875688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042036469.1|1875740_1875920_-	DUF3606 domain-containing protein	NA	NA	NA	NA	NA
WP_001286680.1|1877363_1878554_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.4e-224
WP_001251408.1|1878566_1879085_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|1879141_1879417_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|1879449_1879569_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_073534974.1|1879561_1882009_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	98.8	0.0e+00
WP_001471798.1|1882023_1882503_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	99.4	1.1e-84
WP_023356594.1|1882502_1883666_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.2	2.0e-204
WP_000468308.1|1883747_1883966_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000476011.1|1884238_1885600_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
1884068:1884094	attR	AAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_001220181.1|1885702_1885999_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001307279.1|1886000_1886297_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_000929408.1|1886505_1886838_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137877.1|1887028_1887751_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000675148.1|1887747_1889151_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	2.7e-33
>prophage 5
NZ_CP010235	Escherichia coli strain S40 chromosome, complete genome	5399183	2683869	2744756	5399183	terminase,integrase,lysis,tRNA,tail	Escherichia_phage(49.06%)	68	2707272:2707288	2750356:2750372
WP_000837924.1|2683869_2685003_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_001082294.1|2685143_2685578_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
WP_120795384.1|2686355_2686469_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|2686537_2686771_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086527.1|2687087_2687678_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_001698950.1|2687775_2688351_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_073534989.1|2688350_2691713_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_001230375.1|2691777_2692377_-	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	98.5	5.7e-110
WP_061355519.1|2692446_2695860_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	98.0	0.0e+00
WP_000741591.1|2695920_2696568_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.9	1.4e-109
WP_001379783.1|2696465_2697209_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.7	8.0e-146
WP_001152422.1|2697214_2697913_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	93.1	9.6e-125
WP_000024051.1|2697912_2698251_-|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_065898768.1|2698243_2701477_-|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	34.7	2.4e-114
WP_012565075.1|2701950_2702310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000094292.1|2702460_2703423_-	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	39.2	4.5e-56
WP_000144678.1|2703449_2703842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001029815.1|2703838_2704219_-	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	1.1e-18
WP_000524260.1|2704219_2704603_-	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
WP_000634214.1|2704602_2704998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908084.1|2705001_2705178_-	hypothetical protein	NA	G8C7P8	Escherichia_phage	62.3	4.7e-12
WP_000918487.1|2705220_2706360_-	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.0	7.4e-159
WP_000770042.1|2706458_2707223_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	64.2	6.9e-84
2707272:2707288	attL	GATCGCAGCAATAAAAA	NA	NA	NA	NA
WP_001351715.1|2707327_2708440_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.5	4.2e-114
WP_000763709.1|2708423_2709830_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	68.8	8.8e-186
WP_073534990.1|2709832_2711134_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	60.0	9.4e-150
WP_000089447.1|2711114_2712209_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.5	5.9e-113
WP_000613571.1|2712212_2712464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204037.1|2712399_2713332_-	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.4e-83
WP_001291094.1|2713324_2714116_-	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.2	2.8e-48
WP_001097895.1|2714253_2715711_-	Trk system potassium transporter TrkG	NA	NA	NA	NA	NA
WP_001228688.1|2715907_2716093_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	96.5	3.6e-15
WP_073534991.1|2716309_2716807_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	96.4	3.5e-89
WP_000839565.1|2716806_2717022_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
WP_001348108.1|2717272_2717647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061359043.1|2717818_2718247_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_000640161.1|2719291_2719834_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	75.7	2.9e-76
WP_073534992.1|2719830_2720121_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	86.5	5.3e-45
WP_000940319.1|2720120_2720720_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_021554378.1|2721183_2721339_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	89.6	1.3e-13
WP_029798703.1|2721835_2722540_-	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_024238817.1|2723254_2724481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021554375.1|2724721_2725615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021554374.1|2726025_2727387_-	deoxyguanosinetriphosphate triphosphohydrolase family protein	NA	NA	NA	NA	NA
WP_021554373.1|2727596_2728019_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	87.8	5.3e-62
WP_000450652.1|2728035_2728761_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.8	6.1e-82
WP_073534993.1|2728783_2729530_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	80.5	3.6e-114
WP_001326319.1|2729536_2730325_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	65.7	1.4e-42
WP_000693803.1|2730402_2730825_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
WP_001072342.1|2730821_2731076_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000233319.1|2731155_2731575_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001326317.1|2731817_2731997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001169151.1|2732007_2732163_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001302843.1|2732159_2732588_-	superinfection exclusion B family protein	NA	NA	NA	NA	NA
WP_000560223.1|2733089_2733311_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001352098.1|2733310_2733481_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000632297.1|2733555_2733831_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_073534994.1|2733932_2736533_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.4	2.0e-247
WP_000166319.1|2736525_2737335_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_001317028.1|2737391_2737586_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_073534995.1|2737578_2737788_+	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	96.8	6.7e-26
WP_000079604.1|2737866_2738082_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_073534996.1|2738083_2739319_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.3	1.3e-238
WP_001157407.1|2739370_2740306_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000123738.1|2740434_2741808_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001296046.1|2741837_2742011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000387388.1|2742285_2743269_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001307164.1|2743523_2744756_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
2750356:2750372	attR	TTTTTATTGCTGCGATC	NA	NA	NA	NA
>prophage 6
NZ_CP010235	Escherichia coli strain S40 chromosome, complete genome	5399183	3201642	3289995	5399183	terminase,capsid,integrase,head,lysis,plate,tRNA,protease,tail,portal	Salmonella_phage(58.33%)	95	3237418:3237432	3291332:3291346
WP_000886683.1|3201642_3202935_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067740.1|3203025_3204369_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.6	3.6e-80
WP_001295343.1|3204379_3204991_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077012.1|3205145_3209213_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|3209347_3209842_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_073535010.1|3210386_3211352_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043618.1|3211474_3213241_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	5.4e-23
WP_001202188.1|3213241_3214963_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	1.9e-20
WP_001241678.1|3215004_3215709_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3215993_3216212_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|3216896_3219173_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|3219203_3219524_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|3219846_3220071_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188193.1|3220143_3222090_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	5.0e-38
WP_000746460.1|3222086_3223202_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_001355621.1|3223352_3224309_+	VirK/YbjX family protein	NA	NA	NA	NA	NA
WP_000599806.1|3224305_3225964_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_000488716.1|3226389_3227085_+	aquaporin Z	NA	NA	NA	NA	NA
WP_000491142.1|3227541_3228441_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000458830.1|3228584_3230237_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000178673.1|3230248_3231217_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815352.1|3231349_3233068_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	8.9e-31
WP_000566372.1|3233104_3234106_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_001136554.1|3234116_3235547_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001338420.1|3235645_3236659_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001255146.1|3236655_3237486_-	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	29.4	1.3e-06
3237418:3237432	attL	AATGCCTTTTTCGCC	NA	NA	NA	NA
WP_001160737.1|3237482_3237806_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270735.1|3237931_3238447_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|3238664_3239393_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_000756569.1|3239410_3240142_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001691.1|3240148_3240865_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000464491.1|3240864_3241533_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001295905.1|3241824_3242556_+	ABC transporter substrate-binding protein ArtJ	NA	NA	NA	NA	NA
WP_001149734.1|3242730_3243858_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.3	4.6e-28
WP_000389260.1|3243898_3244387_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061657.1|3244446_3245292_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_001093858.1|3245288_3246242_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000995994.1|3246251_3247385_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.9e-29
WP_000126065.1|3247479_3248592_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|3248943_3249420_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|3249507_3250410_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000189152.1|3250470_3251193_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201560.1|3251176_3251464_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195240.1|3251623_3251881_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_000681108.1|3251910_3252288_-	inner membrane protein YbjM	NA	NA	NA	NA	NA
WP_001024876.1|3252557_3254243_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_139816873.1|3254489_3255011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047643037.1|3255132_3255330_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	75.8	6.2e-21
WP_047643038.1|3255420_3256521_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	2.5e-175
WP_000980395.1|3256517_3257003_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	81.2	1.7e-67
WP_047643039.1|3256999_3260077_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	62.7	0.0e+00
WP_000763311.1|3260069_3260189_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001281009.1|3260203_3260506_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_001207656.1|3260560_3261076_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
WP_073535011.1|3261085_3262258_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	1.3e-203
WP_001555853.1|3262400_3262967_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	84.8	2.2e-87
WP_077898534.1|3262997_3263495_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	59.7	6.7e-48
WP_032331538.1|3263494_3264097_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.5	9.2e-100
WP_032331536.1|3264068_3264512_-|tail	tail fiber assembly protein	tail	M1SNQ2	Escherichia_phage	72.1	1.4e-57
WP_073535013.1|3264513_3265911_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	75.7	9.1e-151
WP_047643049.1|3265907_3266513_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	93.0	5.2e-111
WP_073535014.1|3266505_3267414_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	4.6e-143
WP_047643050.1|3267400_3267760_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	85.7	2.8e-51
WP_000993774.1|3267756_3268335_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	1.6e-93
WP_021532222.1|3268403_3268850_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	83.6	3.6e-61
WP_021532221.1|3268842_3269274_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.0	6.4e-71
WP_047643052.1|3269369_3269798_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	78.0	5.8e-48
WP_000727856.1|3269794_3270172_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	3.9e-16
WP_001069909.1|3270173_3270686_-	lysozyme	NA	E5G6N1	Salmonella_phage	92.3	3.1e-88
WP_000171568.1|3270666_3270882_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_032182336.1|3270885_3271089_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	91.0	2.0e-30
WP_032182334.1|3271088_3271553_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	4.2e-76
WP_016245844.1|3271648_3272299_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	1.5e-111
WP_000742525.1|3272302_3273361_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.7	9.9e-182
WP_000216240.1|3273377_3274211_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	92.1	3.1e-122
WP_073535016.1|3274353_3276120_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_016239486.1|3276119_3277154_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	89.8	3.0e-175
WP_016239485.1|3277223_3277889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047643053.1|3277888_3278323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016239484.1|3278335_3279442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050491752.1|3280172_3281066_-	macro domain-containing protein	NA	B0FIJ9	Escherichia_phage	42.4	5.9e-18
WP_016239482.1|3281148_3281730_-	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_001217575.1|3282197_3282431_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154431.1|3282441_3282630_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
WP_073535018.1|3282782_3285197_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	96.9	0.0e+00
WP_047643055.1|3285193_3286051_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.9	1.2e-161
WP_000752613.1|3286047_3286275_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_001244216.1|3286274_3286508_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	9.2e-32
WP_001352070.1|3286575_3286917_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	96.5	4.3e-54
WP_000956182.1|3286880_3287081_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_000460891.1|3287088_3287598_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
WP_001247707.1|3287630_3287852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047320.1|3287977_3288547_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	43.9	2.9e-39
WP_001513672.1|3288562_3288754_+	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	65.9	6.8e-09
WP_000290937.1|3288942_3289995_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
3291332:3291346	attR	GGCGAAAAAGGCATT	NA	NA	NA	NA
>prophage 7
NZ_CP010235	Escherichia coli strain S40 chromosome, complete genome	5399183	3591582	3647534	5399183	terminase,capsid,integrase,head,transposase,lysis,protease,tail,portal	Enterobacteria_phage(51.92%)	65	3600063:3600109	3647548:3647594
WP_073470664.1|3591582_3592719_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000383951.1|3592987_3595225_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000662373.1|3595211_3598184_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001224602.1|3598184_3599075_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177469.1|3599257_3600019_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
3600063:3600109	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201825.1|3600531_3601485_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226374.1|3601671_3603156_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000239881.1|3603700_3604369_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000885570.1|3604423_3605008_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	6.6e-103
WP_072004409.1|3605007_3608034_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	81.4	3.6e-67
WP_001230378.1|3608098_3608698_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.0	4.4e-110
WP_000090915.1|3612222_3612855_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	7.6e-97
WP_000194779.1|3612791_3613535_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152652.1|3613540_3614239_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	1.1e-131
WP_000847362.1|3614238_3614568_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	1.4e-57
WP_000840260.1|3614564_3617126_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	89.3	0.0e+00
WP_000459458.1|3617118_3617553_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
WP_000479142.1|3617534_3617957_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	1.1e-70
WP_001367716.1|3617972_3618713_-|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	98.8	5.6e-131
WP_000683128.1|3618720_3619116_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	6.5e-70
WP_000975111.1|3619112_3619691_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.4	3.9e-79
WP_000785280.1|3619702_3620056_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_000158875.1|3620067_3620463_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	1.1e-58
WP_000063254.1|3620504_3621530_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.2	2.8e-189
WP_001355467.1|3621585_3621918_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	1.4e-54
WP_000123248.1|3621927_3623247_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.6	1.8e-233
WP_001367714.1|3623227_3624829_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.4	1.0e-310
WP_000198149.1|3624825_3625032_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027292.1|3625028_3626954_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	100.0	0.0e+00
WP_000453566.1|3626928_3627474_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001415975.1|3627862_3628057_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.9	4.3e-27
WP_000738421.1|3628416_3628710_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001228695.1|3628800_3628983_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001135277.1|3629199_3629697_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_000839596.1|3629696_3629912_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737283.1|3630500_3631598_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	76.3	4.8e-155
WP_001204791.1|3631787_3632171_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000971068.1|3632256_3632397_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	5.5e-08
WP_001099712.1|3632393_3632756_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774499.1|3632752_3633043_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	91.7	6.3e-46
WP_000224914.1|3633035_3633206_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001053027.1|3633205_3633661_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	2.2e-61
WP_072097297.1|3633657_3633759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001348590.1|3633853_3634636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000338662.1|3634810_3635134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000709083.1|3635245_3636772_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_032252941.1|3636829_3636937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001089797.1|3637028_3637361_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|3637428_3637731_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788797.1|3637727_3638429_-	hypothetical protein	NA	M1FJ72	Enterobacteria_phage	98.3	3.2e-128
WP_000147956.1|3638425_3639445_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.4	6.7e-111
WP_001182891.1|3639441_3639981_-	toxin YdaT domain-containing protein	NA	K7PJT7	Enterobacteria_phage	67.6	6.8e-62
WP_001067458.1|3640050_3640281_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000858975.1|3640385_3641075_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_000340376.1|3641141_3642005_+	hypothetical protein	NA	M9NYX6	Enterobacteria_phage	62.1	1.8e-93
WP_001309317.1|3642398_3642689_+	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	83.8	5.0e-27
WP_000995439.1|3642764_3643061_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|3643066_3643852_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186811.1|3643848_3644529_+	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	99.6	4.6e-132
WP_000682319.1|3644525_3644687_+	DUF1317 family protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	9.1e-23
WP_000129285.1|3644679_3645237_+	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	62.3	2.0e-61
WP_000188870.1|3645313_3645529_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000763385.1|3645627_3645846_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_000488407.1|3645893_3646172_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_001299447.1|3646370_3647534_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.3	3.4e-199
3647548:3647594	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 8
NZ_CP010235	Escherichia coli strain S40 chromosome, complete genome	5399183	4568992	4631183	5399183	plate,transposase,tRNA,protease	Cronobacter_phage(12.5%)	52	NA	NA
WP_073535036.1|4568992_4569406_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393844.1|4569409_4571260_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348793.1|4571223_4572306_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113721.1|4572330_4573611_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|4573607_4574132_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246437.1|4574134_4575466_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000343298.1|4575470_4576232_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000614366.1|4576240_4579006_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.9	1.4e-81
WP_000088862.1|4579002_4579746_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240530.1|4579750_4581163_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_122985860.1|4581271_4584706_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001087588.1|4584716_4586069_+	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_001284199.1|4586092_4586575_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000908057.1|4586618_4587533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236649.1|4587542_4588022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086143.1|4588158_4588944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297205.1|4589479_4590211_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_000917883.1|4590275_4590743_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001295200.1|4590739_4591462_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052707.1|4591495_4592251_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644683.1|4592322_4593681_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211726.1|4593728_4594499_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|4594576_4595377_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648580.1|4595617_4596532_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997048.1|4596528_4597332_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.1	1.2e-38
WP_001140175.1|4603089_4603665_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593994.1|4603852_4604884_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001294600.1|4604876_4605530_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874224.1|4605569_4606385_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202329.1|4606502_4606907_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094011.1|4606903_4607611_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260716.1|4607721_4609440_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001346133.1|4609492_4610317_+	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000399648.1|4610519_4611500_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000239192.1|4611749_4612460_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635545.1|4612473_4612896_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185293.1|4612892_4613438_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|4613603_4613804_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062312.1|4613790_4614051_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000176573.1|4614099_4615398_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901098.1|4615462_4615852_-	VOC family protein	NA	NA	NA	NA	NA
WP_001021030.1|4615908_4618050_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000055741.1|4618148_4619108_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001294757.1|4619120_4622603_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000569430.1|4622639_4623236_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_000139659.1|4623232_4624381_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000565966.1|4624380_4625169_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|4625172_4625628_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_001139279.1|4625732_4626758_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000758956.1|4626761_4627247_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001240896.1|4627368_4629801_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_001295561.1|4629830_4631183_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
>prophage 9
NZ_CP010235	Escherichia coli strain S40 chromosome, complete genome	5399183	4973620	5031493	5399183	transposase,protease	Klosneuvirus(11.11%)	59	NA	NA
WP_001162171.1|4973620_4974973_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166270.1|4975066_4975618_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219791.1|4975773_4977147_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853753.1|4977322_4978321_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_000596016.1|4978353_4979349_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001367906.1|4979335_4980358_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205794.1|4980371_4981874_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.1e-11
WP_000265912.1|4982013_4982970_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055072.1|4983279_4983810_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
WP_001219160.1|4984189_4984531_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000060936.1|4984533_4988313_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001269327.1|4988309_4990043_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001295196.1|4990248_4990887_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000935042.1|4991209_4992553_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689228.1|4992614_4992821_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000175289.1|4993145_4993703_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_000886909.1|4993692_4994433_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000589460.1|4994622_4996566_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000084622.1|4996694_4997075_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000560552.1|4997163_4998024_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001351395.1|4998132_4999098_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000331456.1|4999205_4999868_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_000228346.1|4999912_5001325_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000211225.1|5001633_5002254_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_001119478.1|5002472_5003111_+	cell division protein YtfB	NA	NA	NA	NA	NA
WP_001367946.1|5003245_5004454_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	9.2e-208
WP_000604912.1|5004461_5004893_+|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.6	1.9e-43
WP_001351393.1|5005515_5006310_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|5006380_5006830_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|5006871_5007099_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|5007103_5007418_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216676.1|5007424_5007820_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000492914.1|5008146_5008422_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000996728.1|5008496_5009048_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_001170812.1|5009144_5009831_-	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000949539.1|5009830_5010685_-	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_000056760.1|5010694_5011345_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000776505.1|5011358_5011823_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218360.1|5011832_5012138_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_001300695.1|5012153_5013551_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001295191.1|5013905_5014970_+	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_000133631.1|5015077_5015833_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_000569708.1|5015829_5016579_-	esterase	NA	NA	NA	NA	NA
WP_000254636.1|5016760_5017090_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000811566.1|5017238_5017514_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001339483.1|5017630_5019256_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943976.1|5019339_5020503_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.5	1.3e-81
WP_000101644.1|5020505_5021144_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|5021153_5021552_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012553.1|5021569_5022229_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511955.1|5022279_5022978_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220137.1|5022996_5023398_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|5023524_5024256_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076316.1|5024435_5026877_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
WP_001177644.1|5026915_5027341_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|5027545_5028844_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|5028947_5029145_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|5029226_5030231_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|5030233_5031493_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
