The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010178	Escherichia coli strain H15 chromosome, complete genome	4741552	587854	653077	4741552	capsid,transposase,tail,terminase,plate,integrase,head,portal,lysis	Salmonella_phage(77.78%)	73	579241:579257	621677:621693
579241:579257	attL	TCTAATTCTTTTATTTT	NA	NA	NA	NA
WP_000399648.1|587854_588835_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000168797.1|589095_590361_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_000114278.1|590512_591328_-	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_000209304.1|591473_593906_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_001442269.1|593911_594811_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_000424893.1|594941_595604_+	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	34.6	5.7e-26
WP_000829258.1|595679_596429_-	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_000397381.1|596428_597664_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_000513775.1|597867_598833_+	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_001315369.1|598819_600691_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	4.0e-16
WP_000090164.1|600710_602249_+	glutathione ABC transporter substrate-binding protein GsiB	NA	NA	NA	NA	NA
WP_000936043.1|602266_603187_+	glutathione ABC transporter permease GsiC	NA	NA	NA	NA	NA
WP_001236044.1|603189_604101_+	glutathione ABC transporter permease GsiD	NA	NA	NA	NA	NA
WP_001307078.1|604278_606627_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000086904.1|606634_607963_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000049367.1|608009_609335_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_000497137.1|609547_609931_+	biofilm formation regulator BssR	NA	NA	NA	NA	NA
WP_000555022.1|610041_611157_+	aldose sugar dehydrogenase YliI	NA	NA	NA	NA	NA
WP_001295292.1|611153_611780_-	glutathione S-transferase GstB	NA	NA	NA	NA	NA
WP_000195961.1|612026_613229_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
WP_000450121.1|613275_614034_-	DNA-binding transcriptional repressor DeoR	NA	NA	NA	NA	NA
WP_001307079.1|614091_614688_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_001180096.1|614972_616205_+	multidrug efflux MFS transporter MdfA	NA	NA	NA	NA	NA
WP_000480892.1|616245_616530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297001.1|616615_617431_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase	NA	NA	NA	NA	NA
WP_000217848.1|617430_618639_-	MFS transporter	NA	NA	NA	NA	NA
WP_001297003.1|618722_619259_+	DNA-binding transcriptional regulator RcdA	NA	NA	NA	NA	NA
WP_001556497.1|619363_620416_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	2.7e-107
WP_001556498.1|620505_621111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001556499.1|621112_622162_-	hypothetical protein	NA	NA	NA	NA	NA
621677:621693	attR	TCTAATTCTTTTATTTT	NA	NA	NA	NA
WP_024195659.1|622164_623106_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.4	4.0e-33
WP_000188448.1|623194_623416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021518683.1|623448_623958_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
WP_000956182.1|623965_624166_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_000963472.1|624129_624471_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.3e-55
WP_001244230.1|624538_624772_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.1e-32
WP_000752619.1|624771_624999_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	3.5e-36
WP_000104175.1|624995_625853_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	92.6	5.4e-154
WP_021543276.1|625849_628264_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	96.8	0.0e+00
WP_001154431.1|628416_628605_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
WP_001217575.1|628615_628849_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001059830.1|629041_629377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000008839.1|629873_631283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077897212.1|631330_632365_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	87.7	2.2e-170
WP_001595562.1|632364_634131_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_000216237.1|634273_635107_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	2.8e-123
WP_073527824.1|635123_636182_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	6.4e-181
WP_000059193.1|636185_636836_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.4	4.3e-111
WP_000673520.1|636931_637396_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	4.2e-76
WP_000868175.1|637395_637599_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171568.1|637602_637818_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_001069895.1|637798_638311_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.1	4.4e-87
WP_077897213.1|638312_638690_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	3.0e-16
WP_001080935.1|638686_639115_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	73.8	1.6e-45
WP_112914719.1|639210_639642_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	91.6	1.4e-70
WP_000829141.1|639634_640081_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.9	1.5e-62
WP_000993775.1|640149_640728_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	4.2e-94
WP_000177590.1|640724_641084_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	86.6	9.5e-52
WP_000268280.1|641070_641979_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	7.8e-143
WP_001086836.1|641971_642577_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	1.5e-110
WP_073527827.1|642573_643989_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	78.4	7.6e-153
WP_073527828.1|643997_644393_+|tail	tail fiber assembly protein	tail	A0A0M4S6V4	Salmonella_phage	43.5	2.7e-15
WP_000782984.1|644364_644784_-|tail	tail assembly chaperone	tail	M1SNQ2	Escherichia_phage	64.7	3.8e-36
WP_052918874.1|644780_645191_-	hypothetical protein	NA	F1BUP1	Erwinia_phage	41.5	2.7e-10
WP_073527829.1|645221_645788_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.8	2.9e-87
WP_073527830.1|645930_647103_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
WP_001207660.1|647112_647628_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_001281009.1|647682_647985_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_000763311.1|647999_648119_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_073527831.1|648111_651189_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.1	0.0e+00
WP_000980413.1|651185_651671_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	6.3e-67
WP_001011797.1|651667_652768_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.0	1.7e-176
WP_000972391.1|652858_653077_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
>prophage 2
NZ_CP010178	Escherichia coli strain H15 chromosome, complete genome	4741552	1362979	1470941	4741552	capsid,tail,terminase,integrase,head,portal,lysis	Enterobacteria_phage(30.51%)	116	1442253:1442268	1475637:1475652
WP_039497512.1|1362979_1364650_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_000331940.1|1364612_1366136_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_001125463.1|1366374_1367697_-	type II toxin-antitoxin system serine/threonine protein kinase toxin HipA	NA	NA	NA	NA	NA
WP_001296726.1|1367696_1367963_-	type II toxin-antitoxin system antitoxin HipB	NA	NA	NA	NA	NA
WP_001083595.1|1368171_1369572_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	49.2	4.0e-106
WP_000113130.1|1374121_1375714_-	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_000154340.1|1375792_1376746_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_001194889.1|1376994_1378530_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	23.6	2.1e-15
WP_000911143.1|1378523_1379552_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001222721.1|1379551_1380544_+	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000172450.1|1380555_1381578_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000774189.1|1381604_1382480_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_000558520.1|1382503_1382794_+	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_001286555.1|1382850_1383609_+	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_001313828.1|1383612_1384527_-	bestrophin family inner membrane protein	NA	NA	NA	NA	NA
WP_000854624.1|1384733_1386185_-	tagaturonate reductase	NA	NA	NA	NA	NA
WP_000558044.1|1386411_1387830_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
WP_001191027.1|1387968_1388328_-	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
WP_000257418.1|1388327_1389254_-	glutaminase B	NA	NA	NA	NA	NA
WP_001296740.1|1389317_1390706_-	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000366463.1|1390806_1391688_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000258554.1|1391765_1392881_+	putative protein YneK	NA	NA	NA	NA	NA
WP_000210799.1|1393030_1394221_+	L-arabinose MFS transporter	NA	NA	NA	NA	NA
WP_000885033.1|1394245_1394911_-	NAAT family transporter MarC	NA	NA	NA	NA	NA
WP_000843419.1|1395122_1395557_+	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
WP_000091199.1|1395576_1395960_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000803659.1|1395991_1396210_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000012622.1|1396266_1397706_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.1	3.7e-30
WP_001022772.1|1397730_1399404_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_001296721.1|1399459_1399771_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000523802.1|1399798_1401121_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_000722571.1|1401235_1401547_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000577181.1|1401745_1402003_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000667463.1|1402030_1402444_+	UTRA domain-containing protein	NA	NA	NA	NA	NA
WP_001616179.1|1402488_1403388_-	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_001054189.1|1403582_1404770_+	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_000901367.1|1404896_1404992_+	protein MgtS	NA	NA	NA	NA	NA
WP_000592814.1|1405210_1406101_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	8.2e-20
WP_000671731.1|1406355_1406748_-	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_001024561.1|1407023_1407542_+	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
WP_001616181.1|1407586_1409632_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_000636571.1|1409768_1410515_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_000215549.1|1410603_1411290_+	DNA-binding transcriptional regulator YdfH	NA	NA	NA	NA	NA
WP_000214712.1|1411467_1411671_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527753.1|1411706_1413167_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.8	4.3e-42
WP_120795384.1|1415142_1415256_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|1415324_1415558_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086527.1|1415874_1416465_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_073527861.1|1416562_1417138_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	1.9e-102
WP_073527862.1|1417137_1420101_-|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	91.5	9.9e-54
WP_073527863.1|1420165_1420765_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.5	2.0e-110
WP_073527864.1|1420834_1424248_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.2	0.0e+00
WP_000090891.1|1424308_1424941_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_073527865.1|1424877_1425621_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	1.2e-146
WP_001152624.1|1425626_1426325_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	5.6e-133
WP_000847331.1|1426324_1426654_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_073527866.1|1426650_1429230_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	94.9	0.0e+00
WP_000459457.1|1429222_1429657_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479135.1|1429638_1430061_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	97.1	2.4e-70
WP_001543784.1|1430076_1430817_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	5.2e-129
WP_000683128.1|1430824_1431220_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	6.5e-70
WP_073527867.1|1431216_1431795_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.4	1.0e-79
WP_000785282.1|1431806_1432160_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_073527868.1|1432171_1432567_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	94.7	7.4e-58
WP_000063250.1|1432608_1433634_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.9	1.1e-188
WP_001358225.1|1433689_1434022_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	2.5e-54
WP_000123317.1|1434031_1435351_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.1	5.6e-235
WP_001345555.1|1435331_1436933_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.4	1.3e-310
WP_000198149.1|1436929_1437136_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027297.1|1437132_1439058_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.8	0.0e+00
WP_000453611.1|1439032_1439578_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_001368374.1|1439966_1440200_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|1440257_1440668_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|1440819_1440993_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|1441164_1441320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|1441398_1441464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071524604.1|1441466_1441655_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|1441665_1441878_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_073527869.1|1442239_1442737_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.2e-06
1442253:1442268	attL	TTTTTATCTCTTAAAG	NA	NA	NA	NA
WP_001515369.1|1442733_1443267_-	lysozyme	NA	Q08J98	Stx2-converting_phage	93.8	1.1e-99
WP_001515370.1|1443322_1443637_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	97.1	1.6e-50
WP_001515371.1|1443641_1443857_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	95.8	1.3e-32
WP_001146314.1|1444047_1444761_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000592549.1|1445167_1446127_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_000780584.1|1446319_1446844_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	52.9	1.0e-46
WP_001204787.1|1446999_1447377_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	82.5	1.8e-53
WP_073527870.1|1447394_1448444_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.0	1.8e-111
WP_012304870.1|1448445_1448724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|1448790_1449042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|1449258_1449414_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|1449485_1449773_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|1449772_1450012_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|1450036_1450342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073527871.1|1450544_1450877_+	FlxA-like family protein	NA	NA	NA	NA	NA
WP_001374839.1|1454321_1454678_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	71.4	4.8e-40
WP_001151262.1|1454674_1455097_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.0	4.4e-64
WP_000054509.1|1455137_1456103_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.2	5.0e-55
WP_000705355.1|1456083_1456605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000921596.1|1456588_1456816_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000381212.1|1456897_1457305_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
WP_000379588.1|1457473_1457629_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	6.8e-07
WP_001171952.1|1457788_1458007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|1458574_1458763_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083297.1|1458759_1458951_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000048327.1|1459043_1461515_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_000005552.1|1461587_1461839_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000876958.1|1461873_1463154_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	3.3e-155
WP_001360138.1|1463173_1463284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836064.1|1463341_1464361_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	5.7e-17
WP_001295394.1|1464372_1465587_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|1465792_1466119_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705197.1|1466253_1466595_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138584.1|1466629_1467190_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|1467192_1467903_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001295396.1|1468010_1468316_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041531.1|1468514_1470941_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.3	1.6e-214
1475637:1475652	attR	TTTTTATCTCTTAAAG	NA	NA	NA	NA
>prophage 3
NZ_CP010178	Escherichia coli strain H15 chromosome, complete genome	4741552	1980228	2044322	4741552	capsid,portal,tail,plate,terminase,holin,integrase,head,tRNA,lysis	Escherichia_phage(37.78%)	74	1969372:1969389	2045055:2045072
1969372:1969389	attL	CATCACCAGTAATGGCTG	NA	NA	NA	NA
WP_073527894.1|1980228_1981632_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.7	5.0e-32
WP_000137877.1|1981628_1982351_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000929408.1|1982541_1982874_+	YegP family protein	NA	NA	NA	NA	NA
WP_073527895.1|1983082_1983379_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_001220181.1|1983380_1983677_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000476011.1|1983779_1985141_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
WP_000468308.1|1985413_1985632_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882967.1|1985713_1986877_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.7	1.1e-205
WP_025693440.1|1986876_1987356_-|tail	phage tail protein	tail	M1TAU1	Escherichia_phage	98.7	3.3e-84
WP_073527896.1|1987370_1989818_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	95.5	0.0e+00
WP_000785970.1|1989810_1989930_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|1989962_1990238_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|1990294_1990813_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286727.1|1990825_1992016_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	4.8e-225
WP_063109269.1|1992282_1993611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063109270.1|1993976_1994504_-|tail	tail fiber assembly protein	tail	U5N0T1	Enterobacteria_phage	91.4	2.1e-87
WP_073527897.1|1994507_1996637_-|tail	tail fiber protein	tail	U5N099	Enterobacteria_phage	55.8	3.0e-145
WP_023281592.1|1996647_1997178_-|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	99.4	5.1e-102
WP_001121474.1|1997170_1998079_-|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	100.0	1.2e-162
WP_000127164.1|1998083_1998431_-	GPW/gp25 family protein	NA	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_046623125.1|1998427_1999063_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	1.9e-111
WP_046623126.1|1999129_1999582_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	99.3	1.4e-76
WP_000917186.1|1999574_2000042_-|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.7	2.5e-81
WP_001440152.1|2000004_2000178_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_046623127.1|2000149_2000575_-|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	95.7	3.0e-65
WP_046623128.1|2000562_2000988_-	hypothetical protein	NA	Q858W1	Yersinia_virus	95.0	1.1e-62
WP_001144101.1|2001002_2001500_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123124.1|2001499_2001781_-|holin	phage holin family protein	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_000846409.1|2001784_2001988_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000988633.1|2001987_2002497_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_016239051.1|2002596_2003340_-|terminase	terminase endonuclease subunit	terminase	Q94MH8	Enterobacteria_phage	99.6	1.2e-125
WP_149026285.1|2003336_2004416_-|capsid	phage major capsid protein, P2 family	capsid	Q94MF0	Enterobacteria_phage	99.4	2.8e-192
WP_001085972.1|2004474_2005329_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MI4	Enterobacteria_phage	100.0	1.3e-139
WP_000156861.1|2005502_2007275_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_073527898.1|2007274_2008309_+|portal	phage portal protein	portal	M1SV64	Escherichia_phage	99.7	1.9e-201
WP_001389235.1|2008701_2009685_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_001062015.1|2009677_2010961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001532474.1|2011136_2013392_-	replication endonuclease	NA	Q858T4	Yersinia_virus	97.2	0.0e+00
WP_000027664.1|2013381_2013657_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_001113258.1|2013653_2013878_-	TraR/DksA C4-type zinc finger protein	NA	S4TRY6	Salmonella_phage	97.3	2.5e-34
WP_001277958.1|2013877_2014180_-	DUF5405 family protein	NA	U5N0U2	Enterobacteria_phage	98.0	5.0e-46
WP_000557703.1|2014179_2014404_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217670.1|2014467_2014968_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_001005162.1|2014964_2015135_-	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_000043869.1|2015145_2015421_-	regulatory phage cox family protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
WP_001306384.1|2015535_2015835_+	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
WP_000985256.1|2015950_2016964_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	1.4e-193
WP_000716757.1|2017228_2017546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807362.1|2017960_2018860_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000178552.1|2018941_2019721_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000844219.1|2019820_2020861_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000490714.1|2020908_2022264_-	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000823288.1|2022267_2022552_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182914.1|2022582_2023035_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000853892.1|2023044_2024307_-	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000289788.1|2024335_2025190_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000129551.1|2025499_2026552_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000858500.1|2026808_2028086_+	MFS transporter	NA	NA	NA	NA	NA
WP_000846217.1|2028082_2029087_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
WP_000011957.1|2029083_2030049_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434038.1|2030022_2030769_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001297420.1|2030820_2031639_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	2.3e-24
WP_000822274.1|2031703_2032504_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195588.1|2032500_2033289_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000019944.1|2033511_2033784_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000134576.1|2033904_2034729_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000153067.1|2034947_2035286_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000405707.1|2035367_2036402_-	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000945409.1|2036417_2038898_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000677398.1|2038913_2039588_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000830468.1|2039668_2040211_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001447395.1|2040503_2040785_-	YehE family protein	NA	NA	NA	NA	NA
WP_001005448.1|2041047_2042157_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001295427.1|2042288_2044322_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
2045055:2045072	attR	CATCACCAGTAATGGCTG	NA	NA	NA	NA
>prophage 4
NZ_CP010178	Escherichia coli strain H15 chromosome, complete genome	4741552	2056887	2066329	4741552		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292767.1|2056887_2058024_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	4.6e-161
WP_001371026.1|2058020_2060021_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.4	0.0e+00
WP_001295429.1|2060145_2060607_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|2060647_2061118_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2061164_2061884_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2061880_2063566_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|2063787_2064519_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216961.1|2064578_2064686_+	protein YohO	NA	NA	NA	NA	NA
WP_001616305.1|2064666_2065398_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569327.1|2065402_2066329_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 5
NZ_CP010178	Escherichia coli strain H15 chromosome, complete genome	4741552	2660173	2667313	4741552		Escherichia_phage(83.33%)	6	NA	NA
WP_001272924.1|2660173_2662735_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_001141334.1|2662840_2663497_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	47.2	4.3e-50
WP_001297141.1|2663547_2664315_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|2664510_2665419_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_073527920.1|2665415_2666678_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.2	3.7e-135
WP_001278994.1|2666674_2667313_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 6
NZ_CP010178	Escherichia coli strain H15 chromosome, complete genome	4741552	3658912	3669176	4741552	integrase	Enterobacteria_phage(88.89%)	11	3658730:3658752	3669653:3669675
3658730:3658752	attL	GACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
WP_001218979.1|3658912_3660082_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	88.1	1.7e-198
WP_000119815.1|3660101_3661961_+	DEAD/DEAH box helicase family protein	NA	A0A097BY72	Enterococcus_phage	22.4	1.8e-13
WP_000186475.1|3661957_3662383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047657960.1|3662711_3663284_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	98.9	3.1e-97
WP_000984202.1|3663298_3663544_-	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	98.8	3.9e-41
WP_047657961.1|3663540_3664275_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	97.1	2.0e-128
WP_001149160.1|3664827_3665094_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_001244665.1|3665636_3665924_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_073527944.1|3665916_3666372_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
WP_000856729.1|3666507_3666828_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_073527945.1|3666842_3669176_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	99.0	0.0e+00
3669653:3669675	attR	GACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
>prophage 1
NZ_CP010179	Escherichia coli strain H15 plasmid A, complete sequence	116417	4453	71063	116417	bacteriocin,transposase,holin	Escherichia_phage(54.29%)	56	NA	NA
WP_000019450.1|4453_5434_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
WP_001567974.1|7429_7714_-	hypothetical protein	NA	Q71TA2	Escherichia_phage	98.9	1.3e-48
WP_001567973.1|8175_8964_+	hypothetical protein	NA	A0A1B0V830	Salmonella_phage	96.9	1.3e-117
WP_001514466.1|9003_9426_+	hypothetical protein	NA	A0A1B0VCB0	Salmonella_phage	99.3	6.1e-58
WP_001281116.1|9603_9996_+	hypothetical protein	NA	A0A077SLJ1	Escherichia_phage	99.2	2.0e-71
WP_001076427.1|10313_11174_+	replication protein RepA	NA	Q71TL8	Escherichia_phage	100.0	4.7e-158
WP_000817632.1|11573_12779_+	AAA family ATPase	NA	Q1MVJ3	Enterobacteria_phage	100.0	2.0e-226
WP_000725192.1|12775_13741_+	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	100.0	3.3e-168
WP_000887652.1|16095_16425_+|holin	holin	holin	Q37876	Escherichia_phage	100.0	1.3e-52
WP_000580776.1|16421_16865_+	hypothetical protein	NA	A0A077SK09	Escherichia_phage	100.0	1.3e-82
WP_000164724.1|16851_17454_+	hypothetical protein	NA	Q1MVM6	Enterobacteria_phage	99.5	1.6e-99
WP_000224043.1|19905_20346_+	hypothetical protein	NA	A0A077SLF0	Escherichia_phage	100.0	1.7e-79
WP_000747846.1|20342_20591_+	hypothetical protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
WP_001061054.1|21762_22569_-|bacteriocin	bacteriocin family protein	bacteriocin	NA	NA	NA	NA
WP_001567967.1|22570_23626_-	Dyp-type peroxidase	NA	S4VXK8	Pandoravirus	28.0	4.6e-22
WP_096960031.1|23719_24553_-	NAD-dependent formate dehydrogenase	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	30.0	1.6e-17
WP_000002334.1|25822_28888_-	tetrathionate reductase subunit TtrA	NA	A0A077SK27	Escherichia_phage	26.0	3.6e-06
WP_001016644.1|28880_29903_-	tetrathionate reductase subunit TtrC	NA	NA	NA	NA	NA
WP_077910396.1|29903_30656_-	tetrathionate reductase subunit TtrB	NA	NA	NA	NA	NA
WP_149026289.1|30865_32599_+	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_000974596.1|32573_33158_+	two-component system response regulator TtrR	NA	NA	NA	NA	NA
WP_000528119.1|33250_33454_+	fumarate hydratase FumD	NA	NA	NA	NA	NA
WP_077897224.1|33562_34579_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.2e-186
WP_016236473.1|34583_34961_-	hypothetical protein	NA	A0A077SK30	Escherichia_phage	87.6	1.2e-49
WP_001568011.1|34994_35210_-	hypothetical protein	NA	Q71TG2	Escherichia_phage	100.0	1.4e-31
WP_001567352.1|35398_35638_-	recombination enhancement function protein	NA	Q71TG3	Escherichia_phage	78.7	6.3e-20
WP_000545263.1|37627_39181_-	L-lactate permease	NA	NA	NA	NA	NA
WP_001567355.1|39616_41314_+	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_001102107.1|41388_42108_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000023895.1|42118_43546_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_000370412.1|43538_44234_+	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000558568.1|44874_45186_+	type II toxin-antitoxin system HigB family toxin	NA	NA	NA	NA	NA
WP_000990392.1|45182_45602_+	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	31.4	1.8e-06
WP_000753105.1|45638_46841_-	hypothetical protein	NA	A0A222YXT1	Escherichia_phage	63.6	1.4e-126
WP_000121260.1|46833_47163_-	hypothetical protein	NA	A0A222YYR0	Escherichia_phage	66.0	1.8e-36
WP_000078540.1|47159_47819_-	hypothetical protein	NA	A0A222YZ79	Escherichia_phage	52.1	9.5e-58
WP_042111017.1|48242_48836_-	hypothetical protein	NA	Q5QBN4	Enterobacteria_phage	45.5	1.3e-34
WP_001114073.1|49151_49505_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.0	4.1e-23
WP_000783215.1|49552_49915_+	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_001556710.1|49932_51684_+	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_016236471.1|51732_53022_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	3.3e-171
WP_000065758.1|53034_53460_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.2e-50
WP_001567357.1|53490_53895_-	arsenic transporter ATPase	NA	NA	NA	NA	NA
WP_000625672.1|54944_56222_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_008325030.1|56285_58283_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	26.2	2.0e-21
WP_023205625.1|58766_59543_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_021553339.1|59613_60567_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_021553338.1|60586_60985_-	ester cyclase	NA	NA	NA	NA	NA
WP_073527983.1|61734_63270_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	87.7	1.2e-260
WP_000609174.1|63319_63667_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
WP_001201739.1|63663_64047_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	36.3	4.1e-13
WP_021553337.1|64604_66029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073527984.1|66025_68965_-	AAA family ATPase	NA	A0A2K9L5A2	Tupanvirus	23.8	2.2e-21
WP_021553335.1|69005_69263_-	DNA polymerase III subunit theta	NA	Q71T70	Escherichia_phage	81.3	4.4e-27
WP_021553334.1|69262_69550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009364894.1|70358_71063_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	4.0e-139
>prophage 2
NZ_CP010179	Escherichia coli strain H15 plasmid A, complete sequence	116417	91708	116132	116417	integrase,transposase	Escherichia_phage(66.67%)	22	88950:88964	108559:108573
88950:88964	attL	GTGAAATCATCAAAA	NA	NA	NA	NA
WP_009364894.1|91708_92413_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	4.0e-139
WP_023351936.1|94876_95188_-	hypothetical protein	NA	Q71TG4	Escherichia_phage	95.1	4.3e-45
WP_054623395.1|95238_96270_-|integrase	tyrosine-type recombinase/integrase	integrase	Q71TG5	Escherichia_phage	99.7	1.3e-194
WP_054623396.1|96277_96499_-	hypothetical protein	NA	A0A077SLI9	Escherichia_phage	98.6	1.3e-35
WP_000019450.1|97135_98116_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
WP_000874156.1|98303_98513_+	hypothetical protein	NA	A0A077SK26	Escherichia_phage	100.0	1.8e-31
WP_000611664.1|98623_99475_+	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	100.0	1.2e-158
WP_001446093.1|101199_102327_-	hypothetical protein	NA	Q5QBP2	Enterobacteria_phage	98.6	7.5e-212
WP_102384962.1|102390_103618_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
WP_001568004.1|104019_104337_-	hypothetical protein	NA	A0A077SL59	Escherichia_phage	100.0	1.4e-46
WP_000648817.1|104739_105783_-	DUF968 domain-containing protein	NA	A0A1B0VBU2	Salmonella_phage	98.0	1.8e-204
WP_001446091.1|105810_105990_-	hypothetical protein	NA	Q71TH5	Escherichia_phage	96.6	1.3e-22
WP_001216034.1|105994_106375_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
WP_001190712.1|106374_106596_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001568002.1|106778_108335_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.9	3.8e-105
WP_001568001.1|108331_108958_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
108559:108573	attR	TTTTGATGATTTCAC	NA	NA	NA	NA
WP_001568000.1|109079_112196_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.2	5.8e-28
WP_000021755.1|112460_112967_-	hypothetical protein	NA	A0A077SK53	Escherichia_phage	98.8	5.4e-93
WP_001567999.1|113476_114178_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	98.3	5.1e-142
WP_001567998.1|114174_114852_-	metallophosphoesterase	NA	Q71TJ1	Escherichia_phage	97.8	4.6e-132
WP_000484116.1|114848_115475_-	norphogenetic protein	NA	Q1MVG8	Enterobacteria_phage	100.0	2.1e-123
WP_001567997.1|115976_116132_-	hypothetical protein	NA	Q1MVH0	Enterobacteria_phage	98.0	1.2e-19
