The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010180	Escherichia coli strain M1 chromosome, complete genome	4941156	170277	287065	4941156	tail,terminase,integrase,transposase,lysis,tRNA	Escherichia_phage(42.11%)	110	164661:164677	204905:204921
164661:164677	attL	GATCGCAGCAATAAAAA	NA	NA	NA	NA
WP_000628065.1|170277_171510_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|171764_172748_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123739.1|173225_174599_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_053264959.1|174727_175663_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	1.7e-145
WP_000040852.1|175714_176950_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|176951_177167_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_024170988.1|177245_177443_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	97.4	5.6e-14
WP_001317028.1|177435_177630_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|177686_178496_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000105136.1|178488_181089_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	3.9e-248
WP_024251429.1|181190_181466_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	3.4e-41
WP_001352098.1|181540_181711_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560224.1|181710_181932_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	9.9e-36
WP_001312793.1|182373_182862_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|182858_183014_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001326317.1|183024_183204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233319.1|183446_183866_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001072342.1|183945_184200_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000693803.1|184196_184619_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
WP_000788769.1|185490_186237_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	79.7	2.0e-112
WP_000450658.1|186259_187021_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	87.4	3.6e-117
WP_001141107.1|187036_187468_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.3	1.3e-60
WP_000385105.1|187661_188816_+	AAA family ATPase	NA	A0A2H4UTU5	Bodo_saltans_virus	31.3	1.9e-13
WP_000091105.1|188790_191055_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_000940319.1|191471_192071_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_000247763.1|192070_192361_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.7e-46
WP_000640161.1|192357_192900_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	75.7	2.9e-76
WP_000506936.1|193944_194373_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_001348108.1|194544_194919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839565.1|195170_195386_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
WP_001135310.1|195385_195883_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	96.4	9.3e-90
WP_001228688.1|196099_196285_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	96.5	3.6e-15
WP_001097895.1|196481_197939_+	Trk system potassium transporter TrkG	NA	NA	NA	NA	NA
WP_001291094.1|198076_198868_+	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.2	2.8e-48
WP_001204037.1|198860_199793_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.4e-83
WP_000613571.1|199728_199980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000089447.1|199983_201078_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.5	5.9e-113
WP_000625348.1|201058_202360_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	3.6e-149
WP_000763703.1|202362_203769_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.0	6.7e-186
WP_001351715.1|203752_204865_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.5	4.2e-114
WP_000770044.1|204969_205734_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	65.0	4.8e-85
204905:204921	attR	TTTTTATTGCTGCGATC	NA	NA	NA	NA
WP_000918482.1|205832_206972_+	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.0	5.7e-159
WP_000908084.1|207014_207191_+	hypothetical protein	NA	G8C7P8	Escherichia_phage	62.3	4.7e-12
WP_000634214.1|207194_207590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000524260.1|207589_207973_+	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
WP_001029815.1|207973_208354_+	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	1.1e-18
WP_000673076.1|208350_208743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000094292.1|208769_209732_+	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	39.2	4.5e-56
WP_149002945.1|209882_210242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000840622.1|210713_213947_+|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	33.4	1.0e-104
WP_000024051.1|213939_214278_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_001152432.1|214277_214976_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	93.5	1.1e-125
WP_001396591.1|214981_215725_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.2e-146
WP_000741591.1|215622_216270_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.9	1.4e-109
WP_053264956.1|216330_219744_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.0	0.0e+00
WP_001230290.1|219813_220413_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.0	9.7e-110
WP_024251431.1|220477_223549_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	U5N099	Enterobacteria_phage	79.2	2.2e-64
WP_001351719.1|223548_224124_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.2	1.2e-101
WP_000078178.1|224221_224812_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|225128_225362_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|225430_225544_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001082294.1|226320_226755_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
WP_046201463.1|226895_228029_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	5.4e-117
WP_001597803.1|228396_231921_-	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_001295715.1|232194_232461_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_001299385.1|232457_232880_-	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_000762229.1|232990_233980_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
WP_000900972.1|234187_236827_+	YdbH family protein	NA	NA	NA	NA	NA
WP_000698145.1|236823_237009_+	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_001325798.1|237013_237343_+	YdbL family protein	NA	NA	NA	NA	NA
WP_001542872.1|237514_238420_-	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_000138615.1|238655_240155_+	phenylacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000535451.1|240212_242486_-	primary-amine oxidase	NA	NA	NA	NA	NA
WP_001186481.1|242733_244779_-	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_000191073.1|245063_245993_+	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_000073393.1|246004_246292_+	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_001072831.1|246300_247047_+	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_001189197.1|247061_247559_+	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_000206374.1|247566_248637_+	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001292352.1|248633_249401_+	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000969790.1|249400_250189_+	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_000973379.1|250190_251618_+	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_000018413.1|251607_252030_+	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_001206184.1|252029_253235_+	bifunctional 3-oxoadipyl-CoA/3-oxo-5,6-dehydrosuberyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000632280.1|253261_254575_+	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_000039887.1|254675_255626_+	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_001123453.1|255607_256198_+	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_000097794.1|256427_257288_+	pyridoxine 4-dehydrogenase	NA	NA	NA	NA	NA
WP_000177537.1|259827_260433_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_032283186.1|260432_261329_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000431860.1|261344_263102_+	bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_149026030.1|263091_264408_+	dual specificity protein phosphatase family protein	NA	NA	NA	NA	NA
WP_000048948.1|264458_265064_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_000139551.1|265264_269167_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
WP_001027964.1|269438_270239_+	YdcF family protein	NA	NA	NA	NA	NA
WP_000115944.1|270435_271875_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000048667.1|271916_272918_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_001397126.1|273106_273637_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	2.4e-19
WP_000731833.1|273881_274055_+	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_001320773.1|274126_274276_-	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_001098524.1|274674_276315_+	methyl-accepting chemotaxis protein Trg	NA	NA	NA	NA	NA
WP_001356191.1|276352_277276_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000013789.1|277492_278836_+	VOC family protein	NA	NA	NA	NA	NA
WP_000375956.1|279060_280716_+	glucan biosynthesis protein OpgD	NA	NA	NA	NA	NA
WP_001296778.1|280855_281080_+	YdcH family protein	NA	NA	NA	NA	NA
WP_000140877.1|281142_281679_+	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
WP_001341359.1|282776_283769_+	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_000586732.1|283765_284359_+	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_001261013.1|284661_285330_+	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_064759642.1|285856_287065_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	91.0	1.8e-208
>prophage 2
NZ_CP010180	Escherichia coli strain M1 chromosome, complete genome	4941156	811704	856410	4941156	tail,terminase,integrase,holin,portal,protease	Escherichia_phage(53.66%)	56	820366:820380	868499:868513
WP_034172970.1|811704_811929_-|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_073520591.1|811938_813345_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	S5MDN9	Escherichia_phage	74.1	1.4e-103
WP_073520592.1|813486_813627_-	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	95.7	1.0e-17
WP_072019665.1|817526_818165_-|tail	tail assembly protein	tail	S5MDP1	Escherichia_phage	97.8	1.6e-94
WP_073520772.1|818062_818806_-|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	94.7	1.2e-144
WP_073520593.1|818811_819510_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	89.7	1.2e-119
WP_053265008.1|819509_819839_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	81.7	7.6e-48
WP_073520594.1|819835_822451_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	74.7	0.0e+00
820366:820380	attL	TGCGCCAGTTCTGTT	NA	NA	NA	NA
WP_073520595.1|822440_822830_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	80.0	2.2e-38
WP_073520596.1|822856_823273_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	52.9	2.2e-28
WP_073520597.1|823291_824050_-|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	76.2	1.1e-102
WP_073520598.1|824057_824456_-|tail	phage tail protein	tail	S5MW30	Escherichia_phage	85.6	1.7e-62
WP_073520599.1|824465_825092_-|tail	phage tail protein	tail	Q8VNN3	Enterobacteria_phage	91.8	6.4e-96
WP_073520600.1|825094_825376_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	83.9	3.6e-38
WP_073520601.1|825368_825695_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	87.9	6.6e-44
WP_149026032.1|825782_827807_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	S5M7Q8	Escherichia_phage	96.8	0.0e+00
WP_073520602.1|827751_829257_-|portal	phage portal protein	portal	S5MW34	Escherichia_phage	92.6	2.1e-270
WP_053265017.1|829256_829469_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	85.7	4.0e-26
WP_073520603.1|829465_831589_-|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	96.7	0.0e+00
WP_073520604.1|831585_832062_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	93.0	1.0e-77
WP_073520605.1|832705_833185_+	DUF1398 family protein	NA	NA	NA	NA	NA
WP_149026033.1|833400_833586_-	hypothetical protein	NA	A0A1U9AJA4	Stx1_converting_phage	78.7	2.7e-18
WP_073520607.1|834104_834638_-	lysozyme	NA	A0A088CC28	Shigella_phage	93.8	2.0e-98
WP_000284510.1|834642_834858_-|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_073520608.1|834935_835241_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_073520609.1|835266_835443_-	DUF1378 family protein	NA	Q5MBW3	Stx1-converting_phage	64.2	2.6e-10
WP_073520610.1|835586_837530_-	DUF1737 domain-containing protein	NA	S5MDQ7	Escherichia_phage	66.0	1.5e-252
WP_053265055.1|838339_838768_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_000193722.1|839450_840329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000024152.1|840578_840965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000532208.1|840978_841329_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	86.6	2.3e-55
WP_029397194.1|841318_841696_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	9.0e-37
WP_073520612.1|841696_842752_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	8.3e-88
WP_024175747.1|842753_843032_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.0	1.1e-12
WP_024210575.1|843199_843412_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.4e-26
WP_187469051.1|843622_843790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053264976.1|844620_844833_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	81.4	5.1e-29
WP_077897822.1|844878_845235_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	94.1	1.5e-54
WP_001514296.1|845236_845773_-	hypothetical protein	NA	A0A2I6TD51	Escherichia_phage	97.9	6.3e-52
WP_001266136.1|845765_846065_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	98.0	1.9e-50
WP_073520614.1|846061_846484_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.3	5.5e-67
WP_073520615.1|846499_847213_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.1	1.7e-76
WP_073520616.1|847235_847988_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	79.0	2.2e-106
WP_073520617.1|847994_849065_-	phage replisome organizer	NA	A0A088CD36	Shigella_phage	66.2	1.3e-64
WP_073520618.1|849136_849562_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000172735.1|849558_849861_-	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	1.1e-05
WP_135405263.1|849957_850329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302048.1|850349_850541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061892358.1|850542_850821_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_073520775.1|851110_851266_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	2.3e-07
WP_001171942.1|851425_851644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854558.1|852211_852400_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001070255.1|852396_852588_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_073520620.1|852681_855123_+	exonuclease	NA	V5UQJ3	Shigella_phage	46.2	2.9e-112
WP_000096344.1|855181_855385_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_073520621.1|855384_856410_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	3.4e-102
868499:868513	attR	AACAGAACTGGCGCA	NA	NA	NA	NA
>prophage 3
NZ_CP010180	Escherichia coli strain M1 chromosome, complete genome	4941156	935971	944654	4941156		Enterobacteria_phage(42.86%)	8	NA	NA
WP_001767431.1|935971_937072_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	60.7	9.4e-135
WP_158227893.1|937061_938345_-	O132 family O-antigen flippase	NA	NA	NA	NA	NA
WP_001767433.1|938364_938895_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.4	1.1e-51
WP_000857521.1|938899_939778_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	6.6e-107
WP_001459897.1|939835_940735_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.8	1.7e-28
WP_001767434.1|940734_941820_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.5	4.7e-102
WP_001767435.1|942191_943085_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.2	6.6e-46
WP_001767436.1|943259_944654_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
>prophage 4
NZ_CP010180	Escherichia coli strain M1 chromosome, complete genome	4941156	987406	998105	4941156	tail,integrase,lysis	Enterobacteria_phage(72.73%)	12	978151:978165	1002264:1002278
978151:978165	attL	CTCGCTTTCCAGTCG	NA	NA	NA	NA
WP_039264499.1|987406_987991_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.4	7.0e-105
WP_073520627.1|987990_991341_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_039264501.1|992483_992666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039264502.1|992764_993139_-	hypothetical protein	NA	M1FPD9	Enterobacteria_phage	81.5	4.6e-49
WP_039264503.1|993177_993621_-|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	96.6	2.4e-73
WP_000041317.1|994286_994769_+	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	98.8	1.4e-79
WP_024239663.1|994780_995095_+	hypothetical protein	NA	K7PLT4	Enterobacteria_phage	99.0	5.9e-50
WP_024215524.1|995111_995393_+	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	98.9	3.3e-44
WP_039264504.1|995389_995557_+	DUF2737 family protein	NA	Q716F2	Shigella_phage	92.7	1.8e-21
WP_039264505.1|995687_996386_+	DUF1311 domain-containing protein	NA	J9Q6K3	Salmonella_phage	83.2	3.9e-102
WP_039264506.1|996835_997054_+	excisionase	NA	Q77WA4	Escherichia_phage	98.6	2.4e-34
WP_073520628.1|997031_998105_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	96.6	5.1e-194
1002264:1002278	attR	CTCGCTTTCCAGTCG	NA	NA	NA	NA
>prophage 5
NZ_CP010180	Escherichia coli strain M1 chromosome, complete genome	4941156	1053206	1061515	4941156		Enterobacteria_phage(83.33%)	9	NA	NA
WP_001349936.1|1053206_1055207_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.6	0.0e+00
WP_001295429.1|1055331_1055793_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|1055833_1056304_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|1056350_1057070_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|1057066_1058752_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|1058973_1059705_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216961.1|1059764_1059872_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|1059852_1060584_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569329.1|1060588_1061515_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 6
NZ_CP010180	Escherichia coli strain M1 chromosome, complete genome	4941156	1659485	1666625	4941156		Escherichia_phage(83.33%)	6	NA	NA
WP_001272924.1|1659485_1662047_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_001141330.1|1662152_1662809_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_001297141.1|1662859_1663627_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|1663822_1664731_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|1664727_1665990_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|1665986_1666625_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 7
NZ_CP010180	Escherichia coli strain M1 chromosome, complete genome	4941156	3285013	3289792	4941156	transposase	Stx2-converting_phage(50.0%)	7	NA	NA
WP_000692311.1|3285013_3285235_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	44.4	3.2e-10
WP_001186726.1|3285297_3285774_-	RadC family protein	NA	NA	NA	NA	NA
WP_000849591.1|3285789_3286275_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	34.8	9.0e-13
WP_001234620.1|3286329_3287148_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	2.0e-44
WP_073520623.1|3287206_3288778_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	1.7e-169
WP_000624622.1|3288797_3289145_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_077897823.1|3289144_3289792_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	39.8	3.0e-16
>prophage 8
NZ_CP010180	Escherichia coli strain M1 chromosome, complete genome	4941156	3363167	3421521	4941156	tRNA,protease,integrase,transposase	Stx2-converting_phage(13.33%)	57	3355938:3355952	3372102:3372116
3355938:3355952	attL	CCATCACGGAAGACA	NA	NA	NA	NA
WP_073520708.1|3363167_3364760_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	62.4	6.5e-177
WP_000624677.1|3364790_3365141_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	1.8e-39
WP_073520709.1|3365137_3365557_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	89.7	2.9e-44
WP_158304851.1|3366541_3366697_-|transposase	transposase domain-containing protein	transposase	NA	NA	NA	NA
WP_001218783.1|3366890_3368153_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	1.6e-77
WP_001188520.1|3368532_3369108_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000068978.1|3369144_3370842_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_000883400.1|3370817_3371156_-	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000961959.1|3371271_3372573_-	anaerobic C4-dicarboxylate transporter DcuA	NA	NA	NA	NA	NA
3372102:3372116	attR	CCATCACGGAAGACA	NA	NA	NA	NA
WP_000069437.1|3372690_3374127_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_001267448.1|3374463_3374940_+	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000015838.1|3374955_3376212_-	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001026276.1|3376487_3376781_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|3376824_3378471_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_000558209.1|3378608_3378962_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_001008049.1|3379154_3380024_-	YjeJ family protein	NA	NA	NA	NA	NA
WP_000940530.1|3380413_3381442_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_000257278.1|3381483_3382050_+	elongation factor P	NA	NA	NA	NA	NA
WP_000977757.1|3382101_3382227_+	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000239596.1|3382337_3382484_+	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000118482.1|3382658_3382976_+	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_001238378.1|3382972_3383506_-	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
WP_001439279.1|3383594_3384728_-	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_001299198.1|3384790_3385150_-	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_000208757.1|3385160_3385556_-	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_000829498.1|3385566_3386301_-	fumarate reductase iron-sulfur protein	NA	NA	NA	NA	NA
WP_001192973.1|3386293_3388102_-	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000004770.1|3388426_3389404_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	1.2e-27
WP_001339478.1|3389622_3391125_+	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_001236813.1|3391275_3394599_-	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_000934920.1|3394620_3395589_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_000041970.1|3395685_3396738_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_001295188.1|3396832_3397378_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_010723271.1|3398120_3398174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294219.1|3398156_3399296_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_001295189.1|3399294_3400842_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_000981977.1|3400813_3401275_+|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_000990321.1|3401293_3402631_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_001122518.1|3402640_3404488_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.0	6.4e-59
WP_001280345.1|3404480_3405431_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|3405516_3405825_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460360.1|3405900_3407181_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312488.1|3407266_3408526_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|3408528_3409533_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|3409614_3409812_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|3409915_3411214_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177644.1|3411418_3411844_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076316.1|3411882_3414324_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
WP_001293282.1|3414503_3415235_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000220137.1|3415361_3415763_+	DUF2170 family protein	NA	NA	NA	NA	NA
WP_000511955.1|3415781_3416480_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000012553.1|3416530_3417190_+	YjfK family protein	NA	NA	NA	NA	NA
WP_000547760.1|3417207_3417606_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000101653.1|3417615_3418254_+	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000943987.1|3418256_3419420_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.5	1.7e-81
WP_024251351.1|3419503_3421129_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000811566.1|3421245_3421521_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
>prophage 9
NZ_CP010180	Escherichia coli strain M1 chromosome, complete genome	4941156	3797142	3854007	4941156	plate,protease,integrase,tRNA	uncultured_Mediterranean_phage(14.29%)	44	3800805:3800820	3852027:3852042
WP_000753946.1|3797142_3798567_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
WP_000929439.1|3798721_3799879_+	DNA-binding transcriptional regulator CdaR	NA	NA	NA	NA	NA
WP_000272188.1|3799967_3800354_-	DUF3461 family protein	NA	NA	NA	NA	NA
WP_001186650.1|3800668_3801493_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
3800805:3800820	attL	CCCGCCGGAACGCGAC	NA	NA	NA	NA
WP_001094571.1|3801523_3804196_-	bifunctional uridylyltransferase/uridylyl-removing protein GlnD	NA	NA	NA	NA	NA
WP_001018194.1|3804257_3805052_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_000246884.1|3805419_3806145_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_000818114.1|3806402_3807254_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_000224573.1|3807400_3808126_+	UMP kinase	NA	NA	NA	NA	NA
WP_000622418.1|3808417_3808975_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_000811923.1|3809066_3810263_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_001295562.1|3810451_3811210_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
WP_000922446.1|3811222_3812080_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_001325807.1|3812091_3813444_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|3813473_3815906_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|3816027_3816513_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139279.1|3816516_3817542_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|3817646_3818102_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|3818105_3818894_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139654.1|3818893_3820042_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569430.1|3820038_3820635_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294757.1|3820671_3824154_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055741.1|3824166_3825126_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020973.1|3825224_3827366_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|3827422_3827812_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176573.1|3827876_3829175_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|3829223_3829484_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|3829470_3829671_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185290.1|3829836_3830382_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635545.1|3830378_3830801_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239192.1|3830814_3831525_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001260716.1|3832556_3834275_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094031.1|3834385_3835093_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|3835089_3835494_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874224.1|3835611_3836427_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|3836466_3837120_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|3837112_3838144_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140186.1|3838331_3838904_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000279885.1|3844775_3845342_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B5FPC6	Escherichia_phage	45.2	2.2e-34
WP_000666530.1|3846635_3847316_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	41.4	2.6e-50
WP_001542642.1|3849799_3850072_-	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_000450225.1|3850074_3851121_-	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_000063810.1|3851131_3852127_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
3852027:3852042	attR	CCCGCCGGAACGCGAC	NA	NA	NA	NA
WP_000371477.1|3852123_3854007_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 10
NZ_CP010180	Escherichia coli strain M1 chromosome, complete genome	4941156	3928528	4005733	4941156	head,tail,capsid,plate,integrase,holin,transposase,protease	Shigella_phage(54.76%)	93	3988306:3988356	4005822:4005872
WP_001575658.1|3928528_3928759_+	helix-turn-helix domain-containing protein	NA	A0A0C4UQU0	Shigella_phage	40.8	1.8e-08
WP_073520716.1|3928761_3930849_+|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A2D1GNK9	Pseudomonas_phage	46.8	9.7e-165
WP_046201641.1|3930924_3931857_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	49.0	2.8e-71
WP_046201640.1|3931859_3932081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046201639.1|3932093_3932348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053264805.1|3932422_3932716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053264804.1|3932727_3933258_+	host-nuclease inhibitor Gam family protein	NA	C9DGL8	Escherichia_phage	55.4	2.1e-47
WP_053264803.1|3933355_3933898_+	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.2	3.8e-28
WP_053264802.1|3933901_3934435_+	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	66.1	3.0e-62
WP_053264801.1|3934434_3934950_+	hypothetical protein	NA	C9DGM0	Escherichia_phage	53.0	6.1e-44
WP_053264800.1|3934953_3935505_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_053264799.1|3935501_3935834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073520717.1|3935826_3936138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062859313.1|3936134_3936644_+	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	46.1	4.8e-25
WP_053264796.1|3936677_3937019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073520718.1|3937358_3937781_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001125310.1|3937852_3938353_+	lysozyme	NA	B6SD29	Bacteriophage	42.6	8.6e-27
WP_123010451.1|3938387_3938816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005136374.1|3938799_3939018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032230646.1|3939028_3939256_+	TraR/DksA family transcriptional regulator	NA	M4MHG5	Vibrio_phage	41.2	4.2e-05
WP_033816661.1|3939236_3939545_+	DUF2730 family protein	NA	NA	NA	NA	NA
WP_001279080.1|3939541_3939832_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	63.2	2.1e-25
WP_000360580.1|3939834_3940416_+	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	4.2e-49
WP_073520719.1|3940426_3940675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073520720.1|3940674_3942339_+	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.1	4.0e-230
WP_073520788.1|3942338_3943928_+	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	58.1	7.7e-170
WP_073520721.1|3943911_3945243_+|capsid	minor capsid protein	capsid	A0A0C4UQY9	Shigella_phage	59.2	1.1e-153
WP_000094810.1|3945364_3945838_+	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	53.9	1.7e-37
WP_073520722.1|3946015_3947140_+|protease	protease	protease	A0A0C4UQU6	Shigella_phage	46.8	3.5e-76
WP_073520723.1|3947139_3948087_+|head	Mu-like prophage major head subunit gpT family protein	head	A0A0C4UQR9	Shigella_phage	67.2	9.3e-123
WP_073520724.1|3948130_3948544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053264786.1|3948540_3948960_+	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	54.3	1.0e-33
WP_053264785.1|3948956_3949514_+	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	45.9	2.0e-40
WP_053264784.1|3949631_3949898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073520725.1|3949973_3950249_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_073520726.1|3950248_3951730_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0C4UQS0	Shigella_phage	53.1	4.4e-135
WP_012908607.1|3951738_3952104_+|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_012908608.1|3952118_3952598_+|tail	phage tail assembly protein	tail	A0A0C4UR03	Shigella_phage	49.2	2.3e-21
WP_001149937.1|3952575_3952722_+	hypothetical protein	NA	C9DGQ0	Escherichia_phage	55.8	6.8e-09
WP_073520727.1|3952725_3954783_+	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.4	1.8e-70
WP_073520728.1|3954769_3956128_+	DNA circularization protein	NA	A0A0C4UR32	Shigella_phage	30.3	2.6e-49
WP_073520729.1|3956111_3957239_+|tail	phage tail protein	tail	C9DGQ3	Escherichia_phage	48.2	1.5e-95
WP_073520730.1|3957228_3957843_+|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	50.8	1.2e-51
WP_012908613.1|3957835_3958273_+	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	58.3	3.1e-41
WP_001146843.1|3958272_3959355_+|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_073520731.1|3959345_3959906_+	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	49.1	7.9e-45
WP_073520732.1|3959905_3960787_+|tail	phage tail protein	tail	C9DGQ8	Escherichia_phage	47.5	1.1e-37
WP_073520789.1|3960818_3961340_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	46.8	2.0e-42
WP_073520733.1|3961644_3963714_+	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	64.2	1.1e-232
WP_073520734.1|3963878_3964061_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	53.3	4.5e-10
WP_073520735.1|3964096_3964351_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_073520736.1|3964518_3964779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033804460.1|3965069_3965270_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_073520737.1|3965223_3965961_+	protein mom	NA	A0A0C4UQZ7	Shigella_phage	78.6	2.2e-103
WP_001195946.1|3966389_3967367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000949083.1|3968753_3969668_+	lateral flagellin LafA	NA	NA	NA	NA	NA
WP_000609676.1|3969874_3971191_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_000285319.1|3971213_3971606_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_073520739.1|3971610_3971922_+	flagellar protein FliT	NA	NA	NA	NA	NA
WP_001070140.1|3971918_3972980_+	flagellar hook-length control protein FliK	NA	NA	NA	NA	NA
WP_000725257.1|3972987_3973455_+	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_000938723.1|3973474_3974191_+	FliA/WhiG family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_001169518.1|3974203_3975067_+	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001232548.1|3975069_3975993_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226164.1|3976063_3977119_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_001059855.1|3977115_3977568_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000528863.1|3977813_3978953_+	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	32.0	3.1e-32
WP_000602102.1|3978949_3979564_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_000469794.1|3979626_3980136_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000106442.1|3980152_3980434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001293016.1|3980442_3981900_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|3982160_3982619_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189543.1|3982710_3983955_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174677.1|3984012_3984414_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749865.1|3984452_3985508_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	2.0e-118
WP_001285288.1|3985795_3986899_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893255.1|3986910_3988164_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
3988306:3988356	attL	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATT	NA	NA	NA	NA
WP_001082070.1|3988607_3989588_+	SMEK domain-containing protein	NA	NA	NA	NA	NA
WP_000926290.1|3989559_3989808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000470135.1|3989776_3991522_+	DUF2326 domain-containing protein	NA	NA	NA	NA	NA
WP_071840188.1|3991576_3991834_-	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_029380176.1|3992786_3993068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000218773.1|3993351_3993705_+	conjugal transfer transcriptional regulator TraJ	NA	NA	NA	NA	NA
WP_024220864.1|3993786_3994581_+	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_032299469.1|3994768_3996163_+	P-type conjugative transfer protein TrbL	NA	NA	NA	NA	NA
WP_000796434.1|3996232_3996445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149026040.1|3996797_3998795_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	26.9	8.8e-22
WP_000625667.1|3998858_4000136_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_077250174.1|4000313_4001453_+	hypothetical protein	NA	J9Q803	Salmonella_phage	26.3	4.7e-20
WP_000042049.1|4002066_4003320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001039069.1|4003545_4003773_-	antitoxin VbhA family protein	NA	NA	NA	NA	NA
WP_032299471.1|4003759_4004650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000201382.1|4004659_4005733_-|integrase	site-specific integrase	integrase	W6MYA3	Pseudomonas_phage	38.9	3.8e-48
4005822:4005872	attR	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATT	NA	NA	NA	NA
>prophage 11
NZ_CP010180	Escherichia coli strain M1 chromosome, complete genome	4941156	4852222	4910521	4941156	head,tail,terminase,capsid,integrase,holin,portal,tRNA	Escherichia_phage(37.78%)	66	4843972:4843989	4895432:4895449
4843972:4843989	attL	GGTGATGGCGCTGGTCAC	NA	NA	NA	NA
WP_046201496.1|4852222_4853341_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	44.7	4.1e-85
WP_073520751.1|4853309_4853579_-	excisionase	NA	NA	NA	NA	NA
WP_073520752.1|4853640_4856097_-	exonuclease	NA	V5UQJ3	Shigella_phage	44.2	3.7e-107
WP_073520753.1|4856187_4856379_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_001541619.1|4856375_4856564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148886034.1|4857087_4857603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073520790.1|4857716_4857869_-	DUF1391 family protein	NA	NA	NA	NA	NA
WP_073520755.1|4858188_4858665_-	DNA-binding protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_032223163.1|4858790_4859114_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	8.0e-10
WP_034173003.1|4859097_4859523_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_149026041.1|4859558_4859753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000344866.1|4859757_4860153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073520757.1|4860232_4861318_+	DNA-binding protein	NA	V5URT9	Shigella_phage	66.0	9.7e-124
WP_001151151.1|4861358_4861781_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	4.8e-63
WP_000813254.1|4863329_4863485_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_001410105.1|4863652_4863931_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.6e-11
WP_073520758.1|4863932_4864982_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	3.8e-109
WP_073520759.1|4864994_4865369_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.8	4.2e-34
WP_073520760.1|4865365_4866187_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	57.9	6.1e-78
WP_000917768.1|4866413_4866611_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	100.0	6.1e-29
WP_073520761.1|4866760_4867819_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	93.5	1.3e-197
WP_073520762.1|4869959_4871894_+	DUF1737 domain-containing protein	NA	A0A0P0ZBH7	Stx2-converting_phage	70.2	5.9e-265
WP_052232680.1|4872056_4872233_+	DUF1378 family protein	NA	Q5MBW3	Stx1-converting_phage	60.4	4.4e-10
WP_034172997.1|4872258_4872564_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_000284506.1|4872641_4872857_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_139108876.1|4873112_4873385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034172994.1|4873544_4874078_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	89.8	1.9e-93
WP_034172993.1|4874074_4874581_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_034172992.1|4874655_4875198_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	55.6	1.6e-26
WP_139108877.1|4875245_4875431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032317909.1|4875563_4875758_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	95.3	7.4e-27
WP_034172990.1|4876152_4876662_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	34.5	1.5e-13
WP_034172989.1|4876633_4878562_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.7	1.1e-263
WP_000258997.1|4878545_4878752_+|head	phage head-stabilizing protein	head	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_034172988.1|4878748_4880341_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.7	3.2e-184
WP_073520763.1|4880330_4881836_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.4	4.3e-98
WP_073520764.1|4881872_4882220_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	57.0	4.4e-22
WP_034172985.1|4882277_4883306_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	3.9e-114
WP_053265031.1|4883357_4883741_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_034172983.1|4883733_4884087_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
WP_073520765.1|4884101_4884680_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	88.0	5.6e-70
WP_034172981.1|4884676_4885072_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	80.9	5.7e-58
WP_034172980.1|4885079_4885829_+|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	94.8	1.3e-130
WP_034172979.1|4885848_4886280_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	69.4	2.5e-43
WP_049590271.1|4886306_4886720_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	86.9	8.4e-44
WP_034172978.1|4886700_4889283_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	84.3	0.0e+00
WP_034172977.1|4889279_4889609_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	80.7	3.8e-47
WP_034172976.1|4889842_4891006_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	66.9	4.2e-141
WP_034172975.1|4891211_4891910_+|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	88.8	1.3e-118
WP_073520772.1|4891915_4892659_+|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	94.7	1.2e-144
WP_046201473.1|4892556_4893195_+|tail	tail assembly protein	tail	S5MDP1	Escherichia_phage	97.8	2.1e-94
WP_073520766.1|4893436_4896913_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	87.2	0.0e+00
4895432:4895449	attR	GTGACCAGCGCCATCACC	NA	NA	NA	NA
WP_034172972.1|4897110_4897221_+	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	97.1	9.3e-11
WP_073520767.1|4897289_4898696_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	S5MDN9	Escherichia_phage	73.8	5.5e-103
WP_073520768.1|4898705_4898930_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_073520769.1|4898926_4899601_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	76.7	2.8e-97
WP_077781611.1|4899765_4900095_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000799399.1|4900259_4901123_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|4901106_4902243_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_038994720.1|4902492_4903722_+	peptidase T	NA	NA	NA	NA	NA
WP_001295435.1|4903867_4904989_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000735412.1|4905064_4906525_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|4906524_4907196_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|4907363_4908734_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001297479.1|4908737_4909379_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|4909414_4910521_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 1
NZ_CP010181	Escherichia coli strain M1 plasmid A, complete sequence	201930	10757	64591	201930	plate,transposase,protease,integrase	Enterobacteria_phage(30.77%)	44	19168:19184	59726:59742
WP_046201810.1|10757_11411_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_046201811.1|11987_15917_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA54	Enterobacteria_phage	37.1	3.2e-217
WP_046201812.1|16460_16859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052734131.1|16870_17224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046201814.1|17593_18013_-	Exc2 family lipoprotein	NA	NA	NA	NA	NA
WP_000993925.1|19043_19694_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	43.6	4.0e-16
19168:19184	attL	CCATTTTTTCTCTGGTG	NA	NA	NA	NA
WP_000623562.1|19693_20041_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	75.7	4.4e-46
WP_046201816.1|20060_21632_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.9	1.1e-168
WP_046201817.1|21762_22185_-	DUF1380 family protein	NA	NA	NA	NA	NA
WP_139108889.1|22231_22534_-	antirestriction protein	NA	NA	NA	NA	NA
WP_046201818.1|23720_24890_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SLN2	Escherichia_phage	84.6	1.3e-177
WP_046201819.1|25243_26206_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	68.6	8.0e-114
WP_000817642.1|26202_27408_-	AAA family ATPase	NA	Q1MVJ3	Enterobacteria_phage	89.4	5.6e-205
WP_000402944.1|27781_27994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001132895.1|28166_28418_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_001270421.1|28414_28702_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	48.4	5.8e-20
WP_046201820.1|28987_29278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361612.1|30335_31313_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	59.2	3.9e-100
WP_046201823.1|31591_32332_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	56.6	3.5e-24
WP_064756529.1|32452_32614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450723.1|34340_34844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072543.1|35636_36113_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000150697.1|36115_37594_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_046201825.1|37603_38122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046201826.1|38129_38552_+	lysozyme family protein	NA	NA	NA	NA	NA
WP_046201827.1|38544_40347_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000268393.1|40337_41270_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_073520792.1|41282_43265_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	23.0	1.5e-13
WP_000133489.1|43275_43743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032246098.1|43752_44052_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_049590598.1|44055_45132_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000152800.1|45139_45682_+	type VI secretion lipoprotein TssJ	NA	NA	NA	NA	NA
WP_073520793.1|45700_47083_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_046201718.1|47435_48050_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_073520794.1|48056_51461_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_073520795.1|51464_53996_+	type VI secretion system ATPase TssH	NA	A0A1C3S747	Escherichia_phage	33.4	1.4e-93
WP_073520796.1|54668_55808_+	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_073520797.1|56307_56898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077787744.1|57566_58163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024179415.1|59377_59599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071886269.1|59575_59905_-	hypothetical protein	NA	NA	NA	NA	NA
59726:59742	attR	CCATTTTTTCTCTGGTG	NA	NA	NA	NA
WP_032246119.1|61191_61560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046201726.1|63564_63795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046201727.1|64156_64591_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	57.6	2.2e-18
