The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010183	Escherichia coli strain M3 chromosome, complete genome	4940434	22336	80635	4940434	tRNA,portal,terminase,head,capsid,holin,integrase,tail	Escherichia_phage(37.78%)	66	33086:33103	89158:89175
WP_001297484.1|22336_23443_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|23478_24120_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|24123_25494_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001265481.1|25661_26333_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735412.1|26332_27793_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001295435.1|27868_28990_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_038994720.1|29135_30365_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|30614_31751_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799399.1|31734_32598_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_077781611.1|32762_33092_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
33086:33103	attL	AATCTGAAAAATCATCCA	NA	NA	NA	NA
WP_073520769.1|33256_33931_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	76.7	2.8e-97
WP_073520768.1|33927_34152_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_034172971.1|34161_35568_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	S5MDN9	Escherichia_phage	74.1	1.4e-103
WP_034172972.1|35636_35747_-	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	97.1	9.3e-11
WP_073535049.1|35944_39421_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	87.0	0.0e+00
WP_062875249.1|39662_40301_-|tail	tail assembly protein	tail	S5MDP1	Escherichia_phage	98.3	5.5e-95
WP_073520772.1|40198_40942_-|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	94.7	1.2e-144
WP_034172975.1|40947_41646_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	88.8	1.3e-118
WP_034172976.1|41851_43015_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	66.9	4.2e-141
WP_034172977.1|43248_43578_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	80.7	3.8e-47
WP_034172978.1|43574_46157_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	84.3	0.0e+00
WP_049590271.1|46137_46551_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	86.9	8.4e-44
WP_034172979.1|46577_47009_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	69.4	2.5e-43
WP_034172980.1|47028_47778_-|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	94.8	1.3e-130
WP_034172981.1|47785_48181_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	80.9	5.7e-58
WP_073520765.1|48177_48756_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	88.0	5.6e-70
WP_034172983.1|48770_49124_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
WP_053265031.1|49116_49500_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_034172985.1|49551_50580_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	3.9e-114
WP_073520764.1|50637_50985_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	57.0	4.4e-22
WP_073520763.1|51021_52527_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.4	4.3e-98
WP_034172988.1|52516_54109_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.7	3.2e-184
WP_000258997.1|54105_54312_-|head	phage head-stabilizing protein	head	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_034172989.1|54295_56224_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.7	1.1e-263
WP_034172990.1|56195_56705_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	34.5	1.5e-13
WP_032317909.1|57099_57294_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	95.3	7.4e-27
WP_139108877.1|57426_57612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034172992.1|57659_58202_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	55.6	1.6e-26
WP_034172993.1|58276_58783_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_034172994.1|58779_59313_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	89.8	1.9e-93
WP_139108876.1|59472_59745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000284506.1|60000_60216_-|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_034172997.1|60293_60599_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_052232680.1|60624_60801_-	DUF1378 family protein	NA	Q5MBW3	Stx1-converting_phage	60.4	4.4e-10
WP_073535050.1|60963_62898_-	DUF1737 domain-containing protein	NA	A0A0P0ZBH7	Stx2-converting_phage	70.5	9.1e-266
WP_073520761.1|65038_66097_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	93.5	1.3e-197
WP_000917768.1|66246_66444_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	100.0	6.1e-29
WP_073520760.1|66670_67492_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	57.9	6.1e-78
WP_073520759.1|67488_67863_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.8	4.2e-34
WP_073520758.1|67875_68925_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	3.8e-109
WP_001410105.1|68926_69205_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.6e-11
WP_000813254.1|69372_69528_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_001151151.1|71076_71499_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	4.8e-63
WP_073520757.1|71539_72625_-	DNA-binding protein	NA	V5URT9	Shigella_phage	66.0	9.7e-124
WP_000344866.1|72704_73100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149026041.1|73104_73299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034173003.1|73334_73760_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_032223163.1|73743_74067_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	8.0e-10
WP_073520755.1|74192_74669_+	DNA-binding protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_073520790.1|74988_75141_+	DUF1391 family protein	NA	NA	NA	NA	NA
WP_148886034.1|75254_75770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001541619.1|76293_76482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073520753.1|76478_76670_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_073520752.1|76760_79217_+	exonuclease	NA	V5UQJ3	Shigella_phage	44.2	3.7e-107
WP_073520751.1|79278_79548_+	excisionase	NA	NA	NA	NA	NA
WP_046201496.1|79516_80635_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	44.7	4.1e-85
89158:89175	attR	AATCTGAAAAATCATCCA	NA	NA	NA	NA
>prophage 2
NZ_CP010183	Escherichia coli strain M3 chromosome, complete genome	4940434	927121	1004326	4940434	protease,transposase,plate,head,capsid,holin,integrase,tail	Shigella_phage(54.76%)	93	926983:927033	944499:944549
926983:927033	attL	AATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAATGCG	NA	NA	NA	NA
WP_000201382.1|927121_928195_+|integrase	site-specific integrase	integrase	W6MYA3	Pseudomonas_phage	38.9	3.8e-48
WP_032299471.1|928204_929095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001039069.1|929081_929309_+	antitoxin VbhA family protein	NA	NA	NA	NA	NA
WP_000042049.1|929534_930788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077250174.1|931401_932541_-	hypothetical protein	NA	J9Q803	Salmonella_phage	26.3	4.7e-20
WP_000625667.1|932718_933996_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_149026040.1|934059_936057_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	26.9	8.8e-22
WP_000796434.1|936409_936622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032299469.1|936691_938086_-	P-type conjugative transfer protein TrbL	NA	NA	NA	NA	NA
WP_024220864.1|938273_939068_-	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_000218773.1|939149_939503_-	conjugal transfer transcriptional regulator TraJ	NA	NA	NA	NA	NA
WP_029380176.1|939786_940068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071840188.1|941020_941278_+	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_000470135.1|941332_943078_-	DUF2326 domain-containing protein	NA	NA	NA	NA	NA
WP_000926290.1|943046_943295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001082070.1|943266_944247_-	SMEK domain-containing protein	NA	NA	NA	NA	NA
WP_000893255.1|944690_945944_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
944499:944549	attR	AATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAATGCG	NA	NA	NA	NA
WP_001285288.1|945955_947059_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749865.1|947346_948402_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	2.0e-118
WP_000174677.1|948440_948842_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189543.1|948899_950144_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|950235_950694_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293016.1|950954_952412_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_000106442.1|952420_952702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000469794.1|952718_953228_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000602102.1|953290_953905_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_000528863.1|953901_955041_-	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	32.0	3.1e-32
WP_001059855.1|955286_955739_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001226164.1|955735_956791_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_001232548.1|956861_957785_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001169518.1|957787_958651_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_000938723.1|958663_959380_-	FliA/WhiG family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_000725257.1|959399_959867_-	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_001070140.1|959874_960936_-	flagellar hook-length control protein FliK	NA	NA	NA	NA	NA
WP_073520739.1|960932_961244_-	flagellar protein FliT	NA	NA	NA	NA	NA
WP_000285319.1|961248_961641_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_000609676.1|961663_962980_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_000949083.1|963186_964101_-	lateral flagellin LafA	NA	NA	NA	NA	NA
WP_001195946.1|965487_966465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073520737.1|966893_967631_-	protein mom	NA	A0A0C4UQZ7	Shigella_phage	78.6	2.2e-103
WP_033804460.1|967584_967785_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_073520736.1|968075_968336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073520735.1|968503_968758_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_073520734.1|968793_968976_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	53.3	4.5e-10
WP_073520733.1|969140_971210_-	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	64.2	1.1e-232
WP_073520789.1|971514_972036_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	46.8	2.0e-42
WP_073520732.1|972067_972949_-|tail	phage tail protein	tail	C9DGQ8	Escherichia_phage	47.5	1.1e-37
WP_073520731.1|972948_973509_-	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	49.1	7.9e-45
WP_001146843.1|973499_974582_-|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_012908613.1|974581_975019_-	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	58.3	3.1e-41
WP_073520730.1|975011_975626_-|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	50.8	1.2e-51
WP_073520729.1|975615_976743_-|tail	phage tail protein	tail	C9DGQ3	Escherichia_phage	48.2	1.5e-95
WP_073520728.1|976726_978085_-	DNA circularization protein	NA	A0A0C4UR32	Shigella_phage	30.3	2.6e-49
WP_073520727.1|978071_980129_-	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.4	1.8e-70
WP_001149937.1|980132_980279_-	hypothetical protein	NA	C9DGQ0	Escherichia_phage	55.8	6.8e-09
WP_012908608.1|980256_980736_-|tail	phage tail assembly protein	tail	A0A0C4UR03	Shigella_phage	49.2	2.3e-21
WP_012908607.1|980750_981116_-|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_073520726.1|981124_982606_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0C4UQS0	Shigella_phage	53.1	4.4e-135
WP_073520725.1|982605_982881_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_053264784.1|982956_983223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053264785.1|983340_983898_-	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	45.9	2.0e-40
WP_053264786.1|983894_984314_-	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	54.3	1.0e-33
WP_073520724.1|984310_984724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073520723.1|984767_985715_-|head	Mu-like prophage major head subunit gpT family protein	head	A0A0C4UQR9	Shigella_phage	67.2	9.3e-123
WP_073520722.1|985714_986839_-|protease	protease	protease	A0A0C4UQU6	Shigella_phage	46.8	3.5e-76
WP_000094810.1|987016_987490_-	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	53.9	1.7e-37
WP_073520721.1|987611_988943_-|capsid	minor capsid protein	capsid	A0A0C4UQY9	Shigella_phage	59.2	1.1e-153
WP_073520788.1|988926_990516_-	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	58.1	7.7e-170
WP_073520720.1|990515_992180_-	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.1	4.0e-230
WP_073520719.1|992179_992428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000360580.1|992438_993020_-	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	4.2e-49
WP_001279080.1|993022_993313_-	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	63.2	2.1e-25
WP_033816661.1|993309_993618_-	DUF2730 family protein	NA	NA	NA	NA	NA
WP_032230646.1|993598_993826_-	TraR/DksA family transcriptional regulator	NA	M4MHG5	Vibrio_phage	41.2	4.2e-05
WP_005136374.1|993836_994055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123010451.1|994038_994467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001125310.1|994501_995002_-	lysozyme	NA	B6SD29	Bacteriophage	42.6	8.6e-27
WP_073520718.1|995073_995496_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_053264796.1|995835_996177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062859313.1|996210_996720_-	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	46.1	4.8e-25
WP_073520717.1|996716_997028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053264799.1|997020_997353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053264800.1|997349_997901_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_053264801.1|997904_998420_-	hypothetical protein	NA	C9DGM0	Escherichia_phage	53.0	6.1e-44
WP_053264802.1|998419_998953_-	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	66.1	3.0e-62
WP_053264803.1|998956_999499_-	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.2	3.8e-28
WP_053264804.1|999596_1000127_-	host-nuclease inhibitor Gam family protein	NA	C9DGL8	Escherichia_phage	55.4	2.1e-47
WP_053264805.1|1000138_1000432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046201639.1|1000506_1000761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046201640.1|1000773_1000995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046201641.1|1000997_1001930_-	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	49.0	2.8e-71
WP_073520716.1|1002005_1004093_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A2D1GNK9	Pseudomonas_phage	46.8	9.7e-165
WP_001575658.1|1004095_1004326_-	helix-turn-helix domain-containing protein	NA	A0A0C4UQU0	Shigella_phage	40.8	1.8e-08
>prophage 3
NZ_CP010183	Escherichia coli strain M3 chromosome, complete genome	4940434	1049351	1086219	4940434	transposase,integrase,plate	Vibrio_phage(100.0%)	30	1041913:1041972	1088354:1088430
1041913:1041972	attL	TGGCGGAACGGACGGGACTCGAACCCGCGACCCCCTGCGTGACAGGCAGGTATTCTAACC	NA	NA	NA	NA
WP_000420795.1|1049351_1050488_-|transposase	ISAs1-like element ISEc1 family transposase	transposase	NA	NA	NA	NA
WP_071884992.1|1050595_1050913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001402130.1|1051306_1051690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049589778.1|1051849_1056361_-	PAAR/RHS domain-containing protein	NA	NA	NA	NA	NA
WP_001199686.1|1056391_1056823_-	DUF1795 domain-containing protein	NA	NA	NA	NA	NA
WP_032141711.1|1056850_1059070_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_100224276.1|1059094_1059442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001402126.1|1059462_1060029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024170797.1|1060245_1061022_-	DUF2094 domain-containing protein	NA	NA	NA	NA	NA
WP_000522897.1|1064886_1065132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001060994.1|1065182_1065857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001402123.1|1065862_1067179_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_000118770.1|1067175_1068519_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001402122.1|1068522_1069056_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000119441.1|1069123_1069609_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_000871596.1|1069722_1070094_-	type VI secretion system amidase immunity protein Tai4	NA	NA	NA	NA	NA
WP_000533466.1|1070090_1070576_-	type VI secretion system amidase effector protein Tae4	NA	NA	NA	NA	NA
WP_000245849.1|1070628_1072143_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000996814.1|1072167_1072713_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000144225.1|1072774_1073065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001040751.1|1073067_1073631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001542643.1|1073643_1076277_-	type VI secretion system ATPase TssH	NA	A0A2I7SAX5	Vibrio_phage	32.8	2.5e-80
WP_000804010.1|1076609_1077524_+	type VI secretion system-associated protein TagK	NA	NA	NA	NA	NA
WP_000183810.1|1077510_1078341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001276642.1|1078337_1078832_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000371477.1|1078847_1080731_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000063810.1|1080727_1081723_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000450225.1|1081733_1082780_+	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_001542642.1|1082782_1083055_+	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_000666530.1|1085538_1086219_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	41.4	2.6e-50
1088354:1088430	attR	TGGCGGAACGGACGGGACTCGAACCCGCGACCCCCTGCGTGACAGGCAGGTATTCTAACCGACTGAACTACCGCTCC	NA	NA	NA	NA
>prophage 4
NZ_CP010183	Escherichia coli strain M3 chromosome, complete genome	4940434	1511335	1569689	4940434	protease,integrase,tRNA,transposase	Vibrio_phage(13.33%)	57	1560741:1560755	1576905:1576919
WP_000811566.1|1511335_1511611_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_024251351.1|1511727_1513353_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943987.1|1513436_1514600_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.5	1.7e-81
WP_000101653.1|1514602_1515241_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|1515250_1515649_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012553.1|1515666_1516326_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511955.1|1516376_1517075_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220137.1|1517093_1517495_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|1517621_1518353_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076316.1|1518532_1520974_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
WP_001177644.1|1521012_1521438_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|1521642_1522941_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|1523044_1523242_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|1523323_1524328_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|1524330_1525590_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460360.1|1525675_1526956_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|1527031_1527340_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280345.1|1527425_1528376_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001122518.1|1528368_1530216_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.0	6.4e-59
WP_000990321.1|1530225_1531563_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_000981977.1|1531581_1532043_-|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_001295189.1|1532014_1533562_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_001294219.1|1533560_1534700_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_010723271.1|1534682_1534736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295188.1|1535478_1536024_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_000041970.1|1536118_1537171_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_000934920.1|1537267_1538236_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_001236813.1|1538257_1541581_+	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_001339478.1|1541731_1543234_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_000004770.1|1543452_1544430_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	1.2e-27
WP_001192973.1|1544754_1546563_+	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000829498.1|1546555_1547290_+	fumarate reductase iron-sulfur protein	NA	NA	NA	NA	NA
WP_000208757.1|1547300_1547696_+	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_001299198.1|1547706_1548066_+	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_001439279.1|1548128_1549262_+	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_001238378.1|1549350_1549884_+	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
WP_000118482.1|1549880_1550198_-	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_000239596.1|1550372_1550519_-	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000977757.1|1550629_1550755_-	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000257278.1|1550806_1551373_-	elongation factor P	NA	NA	NA	NA	NA
WP_000940530.1|1551414_1552443_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_001008049.1|1552832_1553702_+	YjeJ family protein	NA	NA	NA	NA	NA
WP_000558209.1|1553894_1554248_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_000729117.1|1554385_1556032_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|1556075_1556369_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000015838.1|1556644_1557901_+	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001267448.1|1557916_1558393_-	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000069437.1|1558729_1560166_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_000961959.1|1560283_1561585_+	anaerobic C4-dicarboxylate transporter DcuA	NA	NA	NA	NA	NA
1560741:1560755	attL	TGTCTTCCGTGATGG	NA	NA	NA	NA
WP_000883400.1|1561700_1562039_+	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000068978.1|1562014_1563712_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_001188520.1|1563748_1564324_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001218783.1|1564703_1565966_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	1.6e-77
WP_158304851.1|1566159_1566315_+|transposase	transposase domain-containing protein	transposase	NA	NA	NA	NA
WP_073520709.1|1567299_1567719_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	89.7	2.9e-44
WP_000624677.1|1567715_1568066_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	1.8e-39
WP_073520708.1|1568096_1569689_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	62.4	6.5e-177
1576905:1576919	attR	TGTCTTCCGTGATGG	NA	NA	NA	NA
>prophage 5
NZ_CP010183	Escherichia coli strain M3 chromosome, complete genome	4940434	1643064	1647843	4940434	transposase	Stx2-converting_phage(50.0%)	7	NA	NA
WP_077897823.1|1643064_1643712_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	39.8	3.0e-16
WP_000624622.1|1643711_1644059_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_073520623.1|1644078_1645650_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	1.7e-169
WP_001234620.1|1645708_1646527_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	2.0e-44
WP_000849591.1|1646581_1647067_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	34.8	9.0e-13
WP_001186726.1|1647082_1647559_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692311.1|1647621_1647843_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	44.4	3.2e-10
>prophage 6
NZ_CP010183	Escherichia coli strain M3 chromosome, complete genome	4940434	3265393	3272533	4940434		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|3265393_3266032_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|3266028_3267291_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|3267287_3268196_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|3268391_3269159_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141330.1|3269209_3269866_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_001272924.1|3269971_3272533_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 7
NZ_CP010183	Escherichia coli strain M3 chromosome, complete genome	4940434	3870621	3880063	4940434		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569329.1|3870621_3871548_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|3871552_3872284_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216961.1|3872264_3872372_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|3872431_3873163_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|3873384_3875070_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|3875066_3875786_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|3875832_3876303_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|3876343_3876805_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001349936.1|3876929_3878930_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.6	0.0e+00
WP_001292769.1|3878926_3880063_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
>prophage 8
NZ_CP010183	Escherichia coli strain M3 chromosome, complete genome	4940434	3934031	3944730	4940434	lysis,integrase,tail	Enterobacteria_phage(72.73%)	12	3929859:3929873	3953972:3953986
3929859:3929873	attL	CGACTGGAAAGCGAG	NA	NA	NA	NA
WP_073520628.1|3934031_3935105_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	96.6	5.1e-194
WP_039264506.1|3935082_3935301_-	excisionase	NA	Q77WA4	Escherichia_phage	98.6	2.4e-34
WP_039264505.1|3935750_3936449_-	DUF1311 domain-containing protein	NA	J9Q6K3	Salmonella_phage	83.2	3.9e-102
WP_039264504.1|3936579_3936747_-	DUF2737 family protein	NA	Q716F2	Shigella_phage	92.7	1.8e-21
WP_024215524.1|3936743_3937025_-	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	98.9	3.3e-44
WP_024239663.1|3937041_3937356_-	hypothetical protein	NA	K7PLT4	Enterobacteria_phage	99.0	5.9e-50
WP_000041317.1|3937367_3937850_-	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	98.8	1.4e-79
WP_039264503.1|3938515_3938959_+|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	96.6	2.4e-73
WP_039264502.1|3938997_3939372_+	hypothetical protein	NA	M1FPD9	Enterobacteria_phage	81.5	4.6e-49
WP_039264501.1|3939470_3939653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073520627.1|3940795_3944146_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_039264499.1|3944145_3944730_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.4	7.0e-105
3953972:3953986	attR	CGACTGGAAAGCGAG	NA	NA	NA	NA
>prophage 9
NZ_CP010183	Escherichia coli strain M3 chromosome, complete genome	4940434	3987482	3996165	4940434		Enterobacteria_phage(42.86%)	8	NA	NA
WP_001767436.1|3987482_3988877_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
WP_001767435.1|3989051_3989945_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.2	6.6e-46
WP_001767434.1|3990316_3991402_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.5	4.7e-102
WP_001459897.1|3991401_3992301_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.8	1.7e-28
WP_000857521.1|3992358_3993237_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	6.6e-107
WP_001767433.1|3993241_3993772_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.4	1.1e-51
WP_158227893.1|3993791_3995075_+	O132 family O-antigen flippase	NA	NA	NA	NA	NA
WP_001767431.1|3995064_3996165_+	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	60.7	9.4e-135
>prophage 10
NZ_CP010183	Escherichia coli strain M3 chromosome, complete genome	4940434	4075726	4121103	4940434	protease,portal,terminase,holin,integrase,tail	Escherichia_phage(52.38%)	57	4058426:4058440	4094077:4094091
4058426:4058440	attL	CTGGTCATTGCAGAA	NA	NA	NA	NA
WP_073520621.1|4075726_4076752_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	3.4e-102
WP_000096344.1|4076751_4076955_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_073520620.1|4077013_4079455_-	exonuclease	NA	V5UQJ3	Shigella_phage	46.2	2.9e-112
WP_001070255.1|4079548_4079740_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000854558.1|4079736_4079925_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001171942.1|4080492_4080711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073520775.1|4080870_4081026_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	2.3e-07
WP_061892358.1|4081315_4081594_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|4081595_4081787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135405263.1|4081807_4082179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172735.1|4082275_4082578_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	1.1e-05
WP_073520618.1|4082574_4083000_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_073520617.1|4083071_4084142_+	phage replisome organizer	NA	A0A088CD36	Shigella_phage	66.2	1.3e-64
WP_073520616.1|4084148_4084901_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	79.0	2.2e-106
WP_073520615.1|4084923_4085637_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.1	1.7e-76
WP_073520614.1|4085652_4086075_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.3	5.5e-67
WP_001266136.1|4086071_4086371_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	98.0	1.9e-50
WP_001514296.1|4086363_4086900_+	hypothetical protein	NA	A0A2I6TD51	Escherichia_phage	97.9	6.3e-52
WP_077897822.1|4086901_4087258_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	94.1	1.5e-54
WP_053264976.1|4087303_4087516_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	81.4	5.1e-29
WP_187469051.1|4088346_4088514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024210575.1|4088724_4088937_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.4e-26
WP_024175747.1|4089104_4089383_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.0	1.1e-12
WP_073520612.1|4089384_4090440_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	8.3e-88
WP_029397194.1|4090440_4090818_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	9.0e-37
WP_000532208.1|4090807_4091158_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	86.6	2.3e-55
WP_000024152.1|4091171_4091558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000193722.1|4091807_4092686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053265055.1|4093368_4093797_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_073535060.1|4094606_4096550_+	DUF1737 domain-containing protein	NA	S5MDQ7	Escherichia_phage	66.3	2.3e-253
4094077:4094091	attR	CTGGTCATTGCAGAA	NA	NA	NA	NA
WP_073520609.1|4096693_4096870_+	DUF1378 family protein	NA	Q5MBW3	Stx1-converting_phage	64.2	2.6e-10
WP_073520608.1|4096895_4097201_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_000284510.1|4097278_4097494_+|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_073520607.1|4097498_4098032_+	lysozyme	NA	A0A088CC28	Shigella_phage	93.8	2.0e-98
WP_149026033.1|4098550_4098736_+	hypothetical protein	NA	A0A1U9AJA4	Stx1_converting_phage	78.7	2.7e-18
WP_073520605.1|4098951_4099431_-	DUF1398 family protein	NA	NA	NA	NA	NA
WP_073520604.1|4100074_4100551_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	93.0	1.0e-77
WP_073520603.1|4100547_4102671_+|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	96.7	0.0e+00
WP_053265017.1|4102667_4102880_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	85.7	4.0e-26
WP_073520602.1|4102879_4104385_+|portal	phage portal protein	portal	S5MW34	Escherichia_phage	92.6	2.1e-270
WP_149026032.1|4104329_4106354_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	S5M7Q8	Escherichia_phage	96.8	0.0e+00
WP_073520601.1|4106441_4106768_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	87.9	6.6e-44
WP_073520600.1|4106760_4107042_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	83.9	3.6e-38
WP_073520599.1|4107044_4107671_+|tail	phage tail protein	tail	Q8VNN3	Enterobacteria_phage	91.8	6.4e-96
WP_073520598.1|4107680_4108079_+|tail	phage tail protein	tail	S5MW30	Escherichia_phage	85.6	1.7e-62
WP_073520597.1|4108086_4108845_+|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	76.2	1.1e-102
WP_073520596.1|4108863_4109280_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	52.9	2.2e-28
WP_073520595.1|4109306_4109696_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	80.0	2.2e-38
WP_073520594.1|4109685_4112301_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	74.7	0.0e+00
WP_053265008.1|4112297_4112627_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	81.7	7.6e-48
WP_073520593.1|4112626_4113325_+|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	89.7	1.2e-119
WP_073520772.1|4113330_4114074_+|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	94.7	1.2e-144
WP_072019665.1|4113971_4114610_+|tail	tail assembly protein	tail	S5MDP1	Escherichia_phage	97.8	1.6e-94
WP_073535061.1|4114855_4118332_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	86.9	0.0e+00
WP_073520592.1|4118508_4118649_+	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	95.7	1.0e-17
WP_034172970.1|4120207_4120432_+|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_073520590.1|4120428_4121103_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	76.8	6.2e-97
>prophage 11
NZ_CP010183	Escherichia coli strain M3 chromosome, complete genome	4940434	4645071	4761859	4940434	transposase,lysis,tRNA,terminase,integrase,tail	Escherichia_phage(42.11%)	110	4671503:4671519	4760992:4761008
WP_064759642.1|4645071_4646280_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	91.0	1.8e-208
WP_001261013.1|4646806_4647475_-	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_000586732.1|4647777_4648371_-	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_001341359.1|4648367_4649360_-	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_000140877.1|4650457_4650994_-	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
WP_001296778.1|4651056_4651281_-	YdcH family protein	NA	NA	NA	NA	NA
WP_000375956.1|4651420_4653076_-	glucan biosynthesis protein OpgD	NA	NA	NA	NA	NA
WP_000013789.1|4653300_4654644_-	VOC family protein	NA	NA	NA	NA	NA
WP_001356191.1|4654860_4655784_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001098524.1|4655821_4657462_-	methyl-accepting chemotaxis protein Trg	NA	NA	NA	NA	NA
WP_001320773.1|4657860_4658010_+	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_000731833.1|4658081_4658255_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_001397126.1|4658499_4659030_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	2.4e-19
WP_000048667.1|4659218_4660220_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000115944.1|4660261_4661701_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001027964.1|4661897_4662698_-	YdcF family protein	NA	NA	NA	NA	NA
WP_000139551.1|4662969_4666872_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
WP_000048948.1|4667072_4667678_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_149026030.1|4667728_4669045_-	dual specificity protein phosphatase family protein	NA	NA	NA	NA	NA
WP_000431860.1|4669034_4670792_-	bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_032283186.1|4670807_4671704_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
4671503:4671519	attL	TTATCAGCGCAAAAAAC	NA	NA	NA	NA
WP_000177537.1|4671703_4672309_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_000097794.1|4674848_4675709_-	pyridoxine 4-dehydrogenase	NA	NA	NA	NA	NA
WP_001123453.1|4675938_4676529_-	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_000039887.1|4676510_4677461_-	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_000632280.1|4677561_4678875_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_001206184.1|4678901_4680107_-	bifunctional 3-oxoadipyl-CoA/3-oxo-5,6-dehydrosuberyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000018413.1|4680106_4680529_-	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_000973379.1|4680518_4681946_-	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_000969790.1|4681947_4682736_-	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_001292352.1|4682735_4683503_-	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000206374.1|4683499_4684570_-	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001189197.1|4684577_4685075_-	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_001072831.1|4685089_4685836_-	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_000073393.1|4685844_4686132_-	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_000191073.1|4686143_4687073_-	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_001186481.1|4687357_4689403_+	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_000535451.1|4689650_4691924_+	primary-amine oxidase	NA	NA	NA	NA	NA
WP_000138615.1|4691981_4693481_-	phenylacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001542872.1|4693716_4694622_+	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_001325798.1|4694793_4695123_-	YdbL family protein	NA	NA	NA	NA	NA
WP_000698145.1|4695127_4695313_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_000900972.1|4695309_4697949_-	YdbH family protein	NA	NA	NA	NA	NA
WP_000762229.1|4698156_4699146_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
WP_001299385.1|4699256_4699679_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_001295715.1|4699675_4699942_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_001597803.1|4700215_4703740_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_046201463.1|4704107_4705241_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	5.4e-117
WP_001082294.1|4705381_4705816_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
WP_120795384.1|4706592_4706706_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|4706774_4707008_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000078178.1|4707324_4707915_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_001351719.1|4708012_4708588_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.2	1.2e-101
WP_024251431.1|4708587_4711659_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	U5N099	Enterobacteria_phage	79.2	2.2e-64
WP_001230290.1|4711723_4712323_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.0	9.7e-110
WP_053264956.1|4712392_4715806_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.0	0.0e+00
WP_000741591.1|4715866_4716514_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.9	1.4e-109
WP_001396591.1|4716411_4717155_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.2e-146
WP_001152432.1|4717160_4717859_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	93.5	1.1e-125
WP_000024051.1|4717858_4718197_-|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_000840622.1|4718189_4721423_-|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	33.4	1.0e-104
WP_149002945.1|4721894_4722254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000094292.1|4722404_4723367_-	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	39.2	4.5e-56
WP_000673076.1|4723393_4723786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001029815.1|4723782_4724163_-	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	1.1e-18
WP_000524260.1|4724163_4724547_-	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
WP_000634214.1|4724546_4724942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908084.1|4724945_4725122_-	hypothetical protein	NA	G8C7P8	Escherichia_phage	62.3	4.7e-12
WP_000918482.1|4725164_4726304_-	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.0	5.7e-159
WP_000770044.1|4726402_4727167_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	65.0	4.8e-85
WP_001351715.1|4727271_4728384_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.5	4.2e-114
WP_000763703.1|4728367_4729774_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.0	6.7e-186
WP_000625348.1|4729776_4731078_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	3.6e-149
WP_000089447.1|4731058_4732153_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.5	5.9e-113
WP_000613571.1|4732156_4732408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204037.1|4732343_4733276_-	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.4e-83
WP_001291094.1|4733268_4734060_-	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.2	2.8e-48
WP_001097895.1|4734197_4735655_-	Trk system potassium transporter TrkG	NA	NA	NA	NA	NA
WP_001228688.1|4735851_4736037_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	96.5	3.6e-15
WP_001135310.1|4736253_4736751_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	96.4	9.3e-90
WP_000839565.1|4736750_4736966_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
WP_001348108.1|4737217_4737592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000506936.1|4737763_4738192_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_000640161.1|4739236_4739779_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	75.7	2.9e-76
WP_000247763.1|4739775_4740066_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.7e-46
WP_000940319.1|4740065_4740665_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_000091105.1|4741081_4743346_-	S8 family peptidase	NA	NA	NA	NA	NA
WP_000385105.1|4743320_4744475_-	AAA family ATPase	NA	A0A2H4UTU5	Bodo_saltans_virus	31.3	1.9e-13
WP_001141107.1|4744668_4745100_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.3	1.3e-60
WP_000450658.1|4745115_4745877_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	87.4	3.6e-117
WP_000788769.1|4745899_4746646_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	79.7	2.0e-112
WP_000693803.1|4747517_4747940_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
WP_001072342.1|4747936_4748191_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000233319.1|4748270_4748690_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001326317.1|4748932_4749112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001169151.1|4749122_4749278_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001312793.1|4749274_4749763_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560224.1|4750204_4750426_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	9.9e-36
WP_001352098.1|4750425_4750596_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_024251429.1|4750670_4750946_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	3.4e-41
WP_000105136.1|4751047_4753648_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	3.9e-248
WP_000166319.1|4753640_4754450_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_001317028.1|4754506_4754701_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_024170988.1|4754693_4754891_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	97.4	5.6e-14
WP_000079604.1|4754969_4755185_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040852.1|4755186_4756422_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_053264959.1|4756473_4757409_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	1.7e-145
WP_000123739.1|4757537_4758911_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|4759388_4760372_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628065.1|4760626_4761859_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
4760992:4761008	attR	TTATCAGCGCAAAAAAC	NA	NA	NA	NA
>prophage 1
NZ_CP010184	Escherichia coli strain M3 plasmid A, complete sequence	200925	10761	64595	200925	protease,transposase,integrase,plate	Enterobacteria_phage(30.77%)	44	19172:19188	59730:59746
WP_046201810.1|10761_11415_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_073535065.1|11991_15921_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA54	Enterobacteria_phage	37.2	1.4e-217
WP_046201812.1|16464_16863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052734131.1|16874_17228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046201814.1|17597_18017_-	Exc2 family lipoprotein	NA	NA	NA	NA	NA
WP_000993925.1|19047_19698_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	43.6	4.0e-16
19172:19188	attL	CCATTTTTTCTCTGGTG	NA	NA	NA	NA
WP_000623562.1|19697_20045_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	75.7	4.4e-46
WP_046201816.1|20064_21636_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.9	1.1e-168
WP_046201817.1|21766_22189_-	DUF1380 family protein	NA	NA	NA	NA	NA
WP_139108889.1|22235_22538_-	antirestriction protein	NA	NA	NA	NA	NA
WP_046201818.1|23724_24894_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SLN2	Escherichia_phage	84.6	1.3e-177
WP_046201819.1|25247_26210_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	68.6	8.0e-114
WP_000817642.1|26206_27412_-	AAA family ATPase	NA	Q1MVJ3	Enterobacteria_phage	89.4	5.6e-205
WP_000402944.1|27785_27998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001132895.1|28170_28422_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_001270421.1|28418_28706_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	48.4	5.8e-20
WP_046201820.1|28991_29282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361612.1|30339_31317_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	59.2	3.9e-100
WP_046201823.1|31595_32336_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	56.6	3.5e-24
WP_064756529.1|32456_32618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450723.1|34344_34848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072543.1|35640_36117_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000150697.1|36119_37598_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_046201825.1|37607_38126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046201826.1|38133_38556_+	lysozyme family protein	NA	NA	NA	NA	NA
WP_046201827.1|38548_40351_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000268393.1|40341_41274_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_073520792.1|41286_43269_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	23.0	1.5e-13
WP_000133489.1|43279_43747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032246098.1|43756_44056_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_049590598.1|44059_45136_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000152800.1|45143_45686_+	type VI secretion lipoprotein TssJ	NA	NA	NA	NA	NA
WP_073520793.1|45704_47087_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_046201718.1|47439_48054_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_073520794.1|48060_51465_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_073520795.1|51468_54000_+	type VI secretion system ATPase TssH	NA	A0A1C3S747	Escherichia_phage	33.4	1.4e-93
WP_073520796.1|54672_55812_+	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_073520797.1|56311_56902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077787744.1|57570_58167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024179415.1|59381_59603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071886269.1|59579_59909_-	hypothetical protein	NA	NA	NA	NA	NA
59730:59746	attR	CCATTTTTTCTCTGGTG	NA	NA	NA	NA
WP_032246119.1|61195_61564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046201726.1|63568_63799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046201727.1|64160_64595_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	57.6	2.2e-18
