The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010191	Escherichia coli strain M8 chromosome, complete genome	4803944	372170	452710	4803944	plate,integrase,tail,head,terminase,portal,protease,holin,capsid	Shigella_phage(49.18%)	91	391091:391107	450156:450172
WP_000131044.1|372170_374204_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001295527.1|374332_374920_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089063.1|374933_376406_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159105.1|376419_378090_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_001209091.1|378302_378968_+	membrane protein	NA	NA	NA	NA	NA
WP_000370308.1|379213_379909_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023910.1|379901_381329_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102113.1|381339_382059_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339587.1|382588_383443_-	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001046306.1|383668_384994_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	1.1e-113
WP_000474077.1|385102_385339_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001306921.1|385350_385944_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_001306920.1|386533_387391_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000092619.1|387511_391765_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
391091:391107	attL	CGGCGATTTTTTCCAGC	NA	NA	NA	NA
WP_000662258.1|392880_392982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803999.1|393344_393608_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|393607_393748_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147277.1|393782_394010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001296902.1|394832_395375_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|395449_396037_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|396094_396763_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131095.1|396788_399314_+	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_001265662.1|399303_400947_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001305432.1|400915_401626_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|401938_402268_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|402515_403130_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070694.1|403547_404237_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643322.1|404233_405190_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_073535081.1|405186_407385_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.8	1.9e-38
WP_000121319.1|407394_408351_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111355.1|408329_408740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000842629.1|409384_410002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073535082.1|410358_411795_-	protein kinase	NA	J3IZ74	Acanthamoeba_polyphaga_lentillevirus	32.7	2.6e-15
WP_000355479.1|412423_413197_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	3.2e-36
WP_000904989.1|413257_413812_-	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	89.0	2.8e-87
WP_187661354.1|413838_414372_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	96.0	7.6e-98
WP_001057699.1|414371_414974_+|tail	tail fiber assembly protein	tail	A0A0F7LDQ5	Escherichia_phage	88.4	8.9e-95
WP_000416463.1|414945_415377_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	74.6	4.3e-43
WP_073535085.1|415379_416027_-	hypothetical protein	NA	U5P0I1	Shigella_phage	63.5	9.3e-66
WP_046076242.1|416030_416615_-	YmfQ family protein	NA	O22003	Shigella_phage	99.0	1.2e-112
WP_073535086.1|416605_417664_-|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	98.3	6.2e-200
WP_000424732.1|417650_418076_-	phage GP46 family protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_071290253.1|418075_418624_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	97.3	5.2e-94
WP_071290252.1|418623_419703_-|plate	baseplate protein	plate	Q8SBG7	Shigella_phage	99.2	4.5e-206
WP_001676471.1|419699_421028_-	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	98.9	3.5e-245
WP_071290251.1|421088_422924_-|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	98.2	2.9e-306
WP_000661050.1|423065_423335_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	98.9	1.0e-42
WP_000090997.1|423334_423691_-|tail	phage tail tube protein	tail	U5P076	Shigella_phage	99.2	9.0e-63
WP_016240456.1|423690_425184_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1FN90	Enterobacteria_phage	99.4	1.3e-272
WP_000497749.1|425170_425338_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	96.3	8.6e-24
WP_000779294.1|425346_425907_-	hypothetical protein	NA	Q8SBH4	Shigella_phage	99.5	1.8e-105
WP_000224835.1|425903_426410_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	92.9	1.3e-83
WP_000702401.1|426384_426795_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	94.9	8.0e-71
WP_032296914.1|426791_427115_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	98.1	2.8e-55
WP_000601365.1|427117_427318_-	hypothetical protein	NA	S5FNU1	Shigella_phage	100.0	3.4e-27
WP_000257490.1|427366_428572_-|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	100.0	8.2e-225
WP_001193631.1|428586_429237_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_032296915.1|429214_430456_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.5	7.6e-242
WP_000605606.1|430455_430638_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_072011717.1|430649_432146_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.8	7.4e-300
WP_000929175.1|432379_432874_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	99.4	3.9e-88
WP_032201150.1|433000_433351_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	80.0	6.6e-50
WP_050437385.1|433453_434017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032201148.1|434091_434322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032201145.1|434462_434732_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	71.3	5.8e-22
WP_073535088.1|434739_435354_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	81.4	5.0e-93
WP_072020277.1|435353_435635_-|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	43.0	3.2e-15
WP_001283169.1|435621_436008_-|holin	phage holin family protein	holin	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_044069184.1|436087_436345_-	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	94.1	6.1e-37
WP_073535089.1|436495_437248_-	antitermination protein	NA	Q8SBE4	Shigella_phage	99.6	8.1e-138
WP_024008914.1|437261_438251_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	1.6e-194
WP_069899206.1|438258_439068_-	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	98.9	1.3e-152
WP_000767115.1|439087_439477_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PH72	Enterobacteria_phage	99.2	3.5e-68
WP_000210154.1|439473_439800_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	2.7e-53
WP_001305610.1|439796_440450_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	3.3e-127
WP_073535090.1|440449_440944_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	99.4	1.9e-87
WP_000104954.1|440940_441882_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	4.3e-144
WP_023148278.1|441871_442051_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	66.7	3.9e-14
WP_000515830.1|442226_442778_-	protein YmfL	NA	S5FXP0	Shigella_phage	98.4	2.2e-100
WP_000649477.1|442821_443022_-	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848748.1|443112_443787_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_069899208.1|444199_444391_-	hypothetical protein	NA	S5FM78	Shigella_phage	98.4	9.5e-27
WP_000135680.1|444829_445192_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081287.1|445257_446082_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000008200.1|446209_446746_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
WP_001242749.1|446736_447099_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_069899210.1|447098_447404_+	hypothetical protein	NA	U5P0J0	Shigella_phage	98.0	2.6e-50
WP_000051893.1|447630_448794_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.7	5.3e-229
WP_000893255.1|448998_450252_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
450156:450172	attR	CGGCGATTTTTTCCAGC	NA	NA	NA	NA
WP_001285288.1|450263_451367_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749865.1|451654_452710_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	2.0e-118
>prophage 2
NZ_CP010191	Escherichia coli strain M8 chromosome, complete genome	4803944	514607	551469	4803944	plate,transposase,integrase	Vibrio_phage(100.0%)	31	507168:507227	553604:553680
507168:507227	attL	TGGCGGAACGGACGGGACTCGAACCCGCGACCCCCTGCGTGACAGGCAGGTATTCTAACC	NA	NA	NA	NA
WP_000420795.1|514607_515744_-|transposase	ISAs1-like element ISEc1 family transposase	transposase	NA	NA	NA	NA
WP_187661350.1|515847_516117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001402130.1|516561_516945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032141712.1|517104_521616_-	PAAR/RHS domain-containing protein	NA	NA	NA	NA	NA
WP_001402128.1|521646_522078_-	DUF1795 domain-containing protein	NA	NA	NA	NA	NA
WP_073535102.1|522105_524325_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_100224276.1|524349_524697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001402126.1|524717_525284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024166652.1|525500_526277_-	DUF2094 domain-containing protein	NA	NA	NA	NA	NA
WP_001402124.1|526276_530143_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_000522897.1|530142_530388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001060994.1|530438_531113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001402123.1|531118_532435_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_049589777.1|532431_533769_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001402122.1|533772_534306_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000119441.1|534373_534859_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_000871596.1|534972_535344_-	type VI secretion system amidase immunity protein Tai4	NA	NA	NA	NA	NA
WP_073535103.1|535340_535826_-	type VI secretion system amidase effector protein Tae4	NA	NA	NA	NA	NA
WP_073535104.1|535878_537393_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000996814.1|537417_537963_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000144225.1|538024_538315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001040751.1|538317_538881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001542643.1|538893_541527_-	type VI secretion system ATPase TssH	NA	A0A2I7SAX5	Vibrio_phage	32.8	2.5e-80
WP_000804010.1|541859_542774_+	type VI secretion system-associated protein TagK	NA	NA	NA	NA	NA
WP_000183810.1|542760_543591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001276642.1|543587_544082_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_073535105.1|544097_545981_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000063810.1|545977_546973_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000450225.1|546983_548030_+	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_001542642.1|548032_548305_+	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_000666530.1|550788_551469_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	41.4	2.6e-50
553604:553680	attR	TGGCGGAACGGACGGGACTCGAACCCGCGACCCCCTGCGTGACAGGCAGGTATTCTAACCGACTGAACTACCGCTCC	NA	NA	NA	NA
>prophage 3
NZ_CP010191	Escherichia coli strain M8 chromosome, complete genome	4803944	2608605	2615745	4803944		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|2608605_2609244_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|2609240_2610503_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|2610499_2611408_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|2611603_2612371_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141333.1|2612421_2613078_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	2.8e-49
WP_001272924.1|2613183_2615745_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 4
NZ_CP010191	Escherichia coli strain M8 chromosome, complete genome	4803944	3215811	3225253	4803944		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569329.1|3215811_3216738_+	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	2.0e-08
WP_000783120.1|3216742_3217474_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|3217454_3217562_-	protein YohO	NA	NA	NA	NA	NA
WP_073535178.1|3217621_3218353_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	8.2e-111
WP_001295431.1|3218574_3220260_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|3220256_3220976_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|3221022_3221493_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|3221533_3221995_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001371026.1|3222119_3224120_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.4	0.0e+00
WP_001292767.1|3224116_3225253_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	4.6e-161
>prophage 5
NZ_CP010191	Escherichia coli strain M8 chromosome, complete genome	4803944	3279303	3290002	4803944	lysis,integrase,tail	Enterobacteria_phage(72.73%)	12	3275131:3275145	3299244:3299258
3275131:3275145	attL	CGACTGGAAAGCGAG	NA	NA	NA	NA
WP_039264507.1|3279303_3280377_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	96.6	3.9e-194
WP_039264506.1|3280354_3280573_-	excisionase	NA	Q77WA4	Escherichia_phage	98.6	2.4e-34
WP_039264505.1|3281022_3281721_-	DUF1311 domain-containing protein	NA	J9Q6K3	Salmonella_phage	83.2	3.9e-102
WP_039264504.1|3281851_3282019_-	DUF2737 family protein	NA	Q716F2	Shigella_phage	92.7	1.8e-21
WP_024215524.1|3282015_3282297_-	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	98.9	3.3e-44
WP_024239663.1|3282313_3282628_-	hypothetical protein	NA	K7PLT4	Enterobacteria_phage	99.0	5.9e-50
WP_000041317.1|3282639_3283122_-	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	98.8	1.4e-79
WP_073535179.1|3283787_3284231_+|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	95.9	5.4e-73
WP_039264502.1|3284269_3284644_+	hypothetical protein	NA	M1FPD9	Enterobacteria_phage	81.5	4.6e-49
WP_039264501.1|3284742_3284925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071885001.1|3286067_3289418_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_039264499.1|3289417_3290002_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.4	7.0e-105
3299244:3299258	attR	CGACTGGAAAGCGAG	NA	NA	NA	NA
>prophage 6
NZ_CP010191	Escherichia coli strain M8 chromosome, complete genome	4803944	3991847	4049153	4803944	lysis,integrase,terminase,tail,tRNA	Escherichia_phage(46.15%)	63	4014959:4014975	4054754:4054770
WP_000837924.1|3991847_3992981_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_001082294.1|3993121_3993556_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
WP_001157925.1|3993820_3993994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795384.1|3994333_3994447_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|3994515_3994749_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000078178.1|3995065_3995656_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_001351719.1|3995753_3996329_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.2	1.2e-101
WP_024251431.1|3996328_3999400_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	U5N099	Enterobacteria_phage	79.2	2.2e-64
WP_001230290.1|3999464_4000064_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.0	9.7e-110
WP_073535226.1|4000133_4003547_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	96.8	0.0e+00
WP_000741591.1|4003607_4004255_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.9	1.4e-109
WP_001396591.1|4004152_4004896_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.2e-146
WP_001152432.1|4004901_4005600_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	93.5	1.1e-125
WP_000024051.1|4005599_4005938_-|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_073535227.1|4005930_4009164_-|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	34.2	7.4e-111
WP_012565075.1|4009637_4009997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000094292.1|4010147_4011110_-	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	39.2	4.5e-56
WP_000144678.1|4011136_4011529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001029815.1|4011525_4011906_-	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	1.1e-18
WP_000524260.1|4011906_4012290_-	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
WP_073535228.1|4012289_4012685_-	protein singed	NA	NA	NA	NA	NA
WP_000908084.1|4012688_4012865_-	hypothetical protein	NA	G8C7P8	Escherichia_phage	62.3	4.7e-12
WP_000918487.1|4012907_4014047_-	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.0	7.4e-159
WP_000770042.1|4014145_4014910_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	64.2	6.9e-84
4014959:4014975	attL	GATCGCAGCAATAAAAA	NA	NA	NA	NA
WP_001351715.1|4015014_4016127_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.5	4.2e-114
WP_000763704.1|4016110_4017517_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.0	3.0e-186
WP_000625348.1|4017519_4018821_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	3.6e-149
WP_000089447.1|4018801_4019896_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.5	5.9e-113
WP_000613571.1|4019899_4020151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073535229.1|4020086_4021019_-	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.5	1.9e-83
WP_001291094.1|4021011_4021803_-	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.2	2.8e-48
WP_001097895.1|4021940_4023398_-	Trk system potassium transporter TrkG	NA	NA	NA	NA	NA
WP_001228688.1|4023594_4023780_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	96.5	3.6e-15
WP_001135310.1|4023996_4024494_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	96.4	9.3e-90
WP_000839565.1|4024493_4024709_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
WP_001348108.1|4024960_4025335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000506936.1|4025506_4025935_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_000640161.1|4026979_4027522_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	75.7	2.9e-76
WP_000247763.1|4027518_4027809_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.7e-46
WP_073535231.1|4027808_4028408_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.5e-105
WP_000882660.1|4028874_4029087_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	2.1e-27
WP_033801850.1|4029699_4031958_-	NACHT domain-containing protein	NA	NA	NA	NA	NA
WP_000450666.1|4032404_4033166_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	89.7	1.3e-119
WP_000788768.1|4033188_4033935_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	79.7	2.0e-112
WP_001614419.1|4033941_4034799_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	83.6	7.7e-68
WP_001610069.1|4034811_4035234_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.7	3.1e-70
WP_001072340.1|4035230_4035485_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	63.0	5.7e-19
WP_000233320.1|4035564_4035984_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_001169151.1|4036416_4036572_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001312793.1|4036568_4037057_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560223.1|4037498_4037720_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001352098.1|4037719_4037890_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000632297.1|4037964_4038240_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_073535232.1|4038341_4040942_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.4	3.3e-247
WP_000166319.1|4040934_4041744_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_001317028.1|4041800_4041995_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_024170988.1|4041987_4042185_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	97.4	5.6e-14
WP_000079604.1|4042263_4042479_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040852.1|4042480_4043716_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_001157407.1|4043767_4044703_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000123738.1|4044831_4046205_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|4046682_4047666_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628065.1|4047920_4049153_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
4054754:4054770	attR	TTTTTATTGCTGCGATC	NA	NA	NA	NA
>prophage 7
NZ_CP010191	Escherichia coli strain M8 chromosome, complete genome	4803944	4124132	4184652	4803944	integrase,tail,head,terminase,portal,protease,holin,capsid	Enterobacteria_phage(36.0%)	72	4144115:4144128	4185718:4185731
WP_000422045.1|4124132_4125182_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559280.1|4125401_4126160_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.0	1.5e-06
WP_001278904.1|4126156_4126747_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|4126786_4127659_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_073535235.1|4127759_4128380_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285661.1|4128376_4129258_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|4129395_4129440_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194592.1|4129531_4131094_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763511.1|4131093_4132689_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_073535236.1|4132689_4134051_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	1.1e-36
WP_000209520.1|4134062_4135256_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443069.1|4135255_4136062_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|4136442_4136622_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|4136707_4137208_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079509.1|4137253_4137760_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_073535237.1|4138399_4139008_-	DUF4376 domain-containing protein	NA	Q9LA61	Enterobacterial_phage	43.6	3.8e-37
WP_073535301.1|4139015_4140209_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q9LA62	Enterobacterial_phage	68.1	1.4e-35
WP_073535238.1|4140273_4140873_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	84.9	2.2e-93
4144115:4144128	attL	ACCGTGACACCGGA	NA	NA	NA	NA
WP_122991393.1|4144371_4144974_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	84.7	6.8e-87
WP_000194780.1|4144910_4145654_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_001152639.1|4145659_4146358_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000847379.1|4146357_4146687_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_073535240.1|4146683_4149245_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	98.6	0.0e+00
WP_073535241.1|4149237_4149672_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.3	4.5e-64
WP_000479153.1|4149653_4150076_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_001349920.1|4150091_4150832_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
WP_000683105.1|4150839_4151235_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000985116.1|4151231_4151810_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	7.8e-80
WP_000752994.1|4151821_4152175_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_073535242.1|4152186_4152582_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	9.7e-58
WP_000063263.1|4152622_4153648_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.4	1.2e-187
WP_001338090.1|4153703_4154036_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	6.5e-55
WP_028120449.1|4154045_4155365_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.6	1.8e-233
WP_073535243.1|4155345_4156947_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	8.5e-310
WP_000198149.1|4156943_4157150_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_073535244.1|4157146_4159072_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000453587.1|4159046_4159592_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_073535245.1|4160222_4160702_+	DUF1398 family protein	NA	NA	NA	NA	NA
WP_077898677.1|4160917_4161103_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	78.0	1.7e-17
WP_073535248.1|4161753_4162287_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	88.7	3.4e-90
WP_139108876.1|4162446_4162719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000284506.1|4162974_4163190_-|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_073535249.1|4163267_4163573_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_073535250.1|4163598_4163775_-	DUF1378 family protein	NA	Q5MBW3	Stx1-converting_phage	66.0	1.1e-10
WP_073535251.1|4163910_4165842_-	DUF1737 domain-containing protein	NA	A0A0P0ZBH7	Stx2-converting_phage	67.6	2.3e-253
WP_073535252.1|4166171_4166498_+	anti-adapter protein IraM	NA	Q20GJ2	Phage_258-320	65.7	4.6e-37
WP_073535302.1|4166984_4167944_+	DUF2219 family protein	NA	NA	NA	NA	NA
WP_073535253.1|4168448_4168667_-	TrmB family transcriptional regulator	NA	Q9MC00	Enterobacteria_phage	89.2	5.0e-24
WP_073535254.1|4168840_4169554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073535255.1|4169805_4170474_-	antiterminator	NA	I6PDF8	Cronobacter_phage	48.4	2.0e-55
WP_073535256.1|4170470_4170830_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.0	1.1e-36
WP_073535257.1|4170842_4171892_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	1.4e-108
WP_073535258.1|4171893_4172172_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	8.2e-11
WP_042022595.1|4172307_4172565_+	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	86.7	1.5e-30
WP_073535259.1|4172570_4172870_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	92.9	3.1e-48
WP_077898674.1|4173074_4173551_-	hypothetical protein	NA	Q9G078	Enterobacteria_phage	45.8	2.1e-06
WP_073535260.1|4173697_4174171_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	74.2	1.7e-64
WP_073535261.1|4174167_4174590_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.5	1.5e-64
WP_073535262.1|4174605_4175319_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	66.0	1.2e-82
WP_187661353.1|4175352_4175895_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.8	1.2e-79
WP_149025813.1|4175806_4176820_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	91.7	1.5e-179
WP_073535264.1|4176899_4177295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073535266.1|4177528_4177954_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_073535267.1|4177937_4178219_-	helix-turn-helix domain-containing protein	NA	K7PHA1	Enterobacteria_phage	72.6	1.1e-23
WP_000362155.1|4178319_4178739_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_073535268.1|4179004_4179157_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_149025816.1|4179272_4179788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449205.1|4180331_4180520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072134143.1|4180516_4180678_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_073535269.1|4180792_4183231_+	exonuclease	NA	V5UQJ3	Shigella_phage	61.0	4.6e-182
WP_000113182.1|4183295_4183544_+	excisionase	NA	NA	NA	NA	NA
WP_073535270.1|4183521_4184652_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	50.3	1.4e-101
4185718:4185731	attR	ACCGTGACACCGGA	NA	NA	NA	NA
>prophage 8
NZ_CP010191	Escherichia coli strain M8 chromosome, complete genome	4803944	4453318	4579982	4803944	plate,lysis,integrase,tail,head,terminase,portal,protease,holin,capsid,tRNA	Escherichia_phage(35.59%)	114	4465256:4465276	4566215:4566235
WP_000156526.1|4453318_4455079_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227927.1|4455147_4455666_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000828648.1|4455735_4455903_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759120.1|4456158_4456722_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000445533.1|4456718_4458359_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333176.1|4458363_4459617_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053089.1|4459746_4461654_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.4e-53
WP_001086549.1|4461664_4463773_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000258205.1|4464016_4465126_+	6-N-hydroxylaminopurine resistance protein YcbX	NA	NA	NA	NA	NA
WP_001295353.1|4465122_4465665_-	cell division protein ZapC	NA	NA	NA	NA	NA
4465256:4465276	attL	AGTGCGGCATTTTCGCCAGAT	NA	NA	NA	NA
WP_001295352.1|4465838_4466849_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001111470.1|4466960_4467698_-	fimbrial chaperone	NA	NA	NA	NA	NA
WP_000919489.1|4467663_4468179_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000730614.1|4468186_4468729_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001165655.1|4468740_4469811_-	fimbrial protein	NA	NA	NA	NA	NA
WP_073535277.1|4469801_4472402_-	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000845152.1|4472426_4473128_-	molecular chaperone	NA	NA	NA	NA	NA
WP_000750284.1|4473210_4473753_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001263933.1|4474108_4474684_+	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
WP_032215248.1|4474676_4475636_+	aliphatic sulfonate ABC transporter substrate-binding protein SsuA	NA	NA	NA	NA	NA
WP_000055996.1|4475632_4476778_+	FMNH2-dependent alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
WP_000235203.1|4476788_4477580_+	aliphatic sulfonate ABC transporter permease SsuC	NA	NA	NA	NA	NA
WP_001090508.1|4477576_4478344_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
WP_000193859.1|4478550_4481163_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	4.1e-19
WP_001297200.1|4481428_4482631_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000117881.1|4482799_4484200_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_000977920.1|4484801_4485890_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000462687.1|4486074_4487265_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_001109487.1|4487486_4488134_-	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_001295932.1|4488160_4488709_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_000925997.1|4488889_4490737_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000572635.1|4490997_4495458_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_001295347.1|4495457_4496162_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_001288850.1|4496142_4497465_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001297198.1|4497461_4498247_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_000899591.1|4498382_4499162_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_000436922.1|4499138_4500032_-	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000011590.1|4500185_4500932_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000350058.1|4500928_4501111_-	protein YcaR	NA	NA	NA	NA	NA
WP_000056529.1|4501162_4502395_-	YcaQ family DNA glycosylase	NA	NA	NA	NA	NA
WP_000570542.1|4502431_4503418_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000551270.1|4503414_4505163_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_000705706.1|4505199_4507464_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|4507670_4507955_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000140327.1|4508114_4509788_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000125016.1|4509898_4510582_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_001295345.1|4510754_4511519_-	metallopeptidase YcaL	NA	NA	NA	NA	NA
WP_000445231.1|4511687_4512971_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_001471308.1|4513041_4514130_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	4.5e-81
WP_000642849.1|4514328_4515021_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_001297197.1|4515150_4516911_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_000642546.1|4517316_4518174_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_001292822.1|4518228_4520511_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_000468308.1|4520829_4521048_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_073535278.1|4521129_4522293_-	phage late control D family protein	NA	A0A0F7LDZ2	Escherichia_phage	99.0	2.0e-204
WP_000978907.1|4522292_4522772_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
WP_073535279.1|4522786_4525234_-|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	98.5	0.0e+00
WP_000785970.1|4525226_4525346_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031307.1|4525378_4525654_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_001251408.1|4525711_4526230_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286716.1|4526242_4527433_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	100.0	1.6e-225
WP_000382497.1|4527733_4528840_+	hypothetical protein	NA	U5N3F3	Enterobacteria_phage	99.5	3.1e-210
WP_023281594.1|4528939_4529467_-|tail	tail fiber assembly protein	tail	U5N0T1	Enterobacteria_phage	95.4	4.4e-90
WP_069904676.1|4529470_4531789_-|tail	tail fiber protein	tail	U5N099	Enterobacteria_phage	66.8	2.4e-212
WP_001285325.1|4531799_4532330_-|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	100.0	2.3e-102
WP_073535280.1|4532322_4533231_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.3	1.3e-161
WP_000127163.1|4533235_4533583_-	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001093751.1|4533579_4534215_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	97.6	6.5e-112
WP_073535281.1|4534281_4534734_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	99.3	4.1e-76
WP_000917139.1|4534726_4535194_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	97.4	1.6e-80
WP_024261711.1|4535283_4535727_-|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	97.2	1.7e-66
WP_001605748.1|4535714_4536140_-	hypothetical protein	NA	U5N096	Enterobacteria_phage	98.6	1.7e-60
WP_001144101.1|4536154_4536652_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123124.1|4536651_4536933_-|holin	phage holin family protein	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_001668220.1|4536936_4537140_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	98.5	5.2e-31
WP_000988633.1|4537139_4537649_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_024261710.1|4537748_4538492_-|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	97.6	1.3e-127
WP_073535282.1|4538495_4539569_-|capsid	phage major capsid protein, P2 family	capsid	Q94MD1	Enterobacteria_phage	99.4	1.3e-200
WP_001085948.1|4539627_4540482_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	89.4	1.7e-139
WP_000156844.1|4540655_4542428_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	99.8	0.0e+00
WP_000038161.1|4542427_4543462_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	100.0	1.9e-201
WP_033548893.1|4543801_4544737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073535283.1|4545096_4547382_-	replication endonuclease	NA	Q858T4	Yersinia_virus	97.6	0.0e+00
WP_032219063.1|4547371_4547647_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	98.9	1.1e-44
WP_053879358.1|4547643_4547868_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	97.3	5.5e-34
WP_000789843.1|4547867_4548158_-	DUF5405 family protein	NA	M1RZ07	Escherichia_phage	81.7	5.5e-34
WP_000185628.1|4548154_4548400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000557709.1|4548414_4548627_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	92.9	8.6e-29
WP_001446416.1|4548690_4549191_-	hypothetical protein	NA	S4TTB7	Salmonella_phage	98.8	1.1e-90
WP_001005162.1|4549187_4549358_-	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_000022051.1|4549368_4549725_-	hypothetical protein	NA	A0A0F7LDH4	Escherichia_phage	100.0	1.1e-63
WP_000072552.1|4549829_4550141_+	helix-turn-helix transcriptional regulator	NA	Q1JS25	Enterobacteria_phage	100.0	4.3e-53
WP_000023391.1|4550234_4551230_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	99.7	7.1e-190
WP_000067979.1|4551261_4552059_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
WP_001190377.1|4552140_4552731_-	NAD(P)H oxidoreductase	NA	NA	NA	NA	NA
WP_001242676.1|4552830_4553739_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000918506.1|4553739_4555170_-	amino acid permease	NA	NA	NA	NA	NA
WP_000109295.1|4555379_4556528_-	MFS transporter	NA	NA	NA	NA	NA
WP_000165876.1|4556842_4557469_+	hydrolase	NA	NA	NA	NA	NA
WP_000534635.1|4557504_4558368_-	dimethyl sulfoxide reductase anchor subunit DmsC	NA	NA	NA	NA	NA
WP_000213098.1|4558369_4558987_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000850317.1|4558997_4561442_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.7	1.1e-220
WP_000886683.1|4561680_4562973_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067755.1|4563063_4564407_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|4564417_4565029_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077018.1|4565183_4569329_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
4566215:4566235	attR	AGTGCGGCATTTTCGCCAGAT	NA	NA	NA	NA
WP_000228473.1|4569463_4569958_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|4570502_4571468_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043587.1|4571590_4573357_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001202188.1|4573357_4575079_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	1.9e-20
WP_001241678.1|4575120_4575825_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|4576109_4576328_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|4577354_4579631_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|4579661_4579982_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
>prophage 9
NZ_CP010191	Escherichia coli strain M8 chromosome, complete genome	4803944	4614975	4636820	4803944	plate,lysis,terminase,tail,head,portal,capsid	Salmonella_phage(82.76%)	29	NA	NA
WP_000972391.1|4614975_4615194_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_024220389.1|4615284_4616385_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.7	2.9e-176
WP_073535284.1|4616381_4616867_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	81.2	2.2e-67
WP_073535285.1|4616863_4619941_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
WP_001513105.1|4619933_4620053_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	84.6	8.2e-13
WP_001281016.1|4620067_4620370_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	90.0	8.2e-41
WP_001504081.1|4620424_4620940_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	94.7	4.8e-89
WP_073535286.1|4620949_4622122_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	6.0e-204
WP_000905033.1|4622264_4622831_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.8	3.8e-87
WP_001578906.1|4622861_4623242_+	hypothetical protein	NA	I3PGW0	Xanthomonas_phage	31.8	3.0e-08
WP_049143284.1|4623394_4624000_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	86.9	1.5e-94
WP_073535287.1|4623999_4625586_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	70.8	1.1e-200
WP_073535288.1|4625582_4626188_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	2.9e-109
WP_073535289.1|4626180_4627089_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	2.0e-143
WP_000177580.1|4627075_4627435_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	87.4	3.2e-52
WP_001741449.1|4627431_4628010_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	9.4e-94
WP_073535290.1|4628078_4628525_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	85.6	1.5e-62
WP_053891415.1|4628517_4628949_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.0	7.6e-72
WP_073535291.1|4629044_4629473_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	74.5	9.3e-46
WP_063112263.1|4629469_4629847_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.8	1.4e-16
WP_001069909.1|4629848_4630361_-	lysozyme	NA	E5G6N1	Salmonella_phage	92.3	3.1e-88
WP_000171568.1|4630341_4630557_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868175.1|4630560_4630764_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_042044472.1|4630763_4631228_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	88.3	4.2e-76
WP_000059191.1|4631323_4631974_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_042044473.1|4631977_4633036_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	6.4e-181
WP_024240751.1|4633052_4633886_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	5.0e-120
WP_001098428.1|4634028_4635795_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_063082208.1|4635794_4636820_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	89.2	3.1e-172
>prophage 10
NZ_CP010191	Escherichia coli strain M8 chromosome, complete genome	4803944	4640251	4649437	4803944	integrase	Salmonella_phage(81.82%)	12	4644108:4644120	4650675:4650687
WP_073535294.1|4640251_4640485_-	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	2.3e-35
WP_001154434.1|4640495_4640684_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_023150402.1|4643274_4644132_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.8	1.7e-160
4644108:4644120	attL	CCGCCCATTTCAG	NA	NA	NA	NA
WP_000752613.1|4644128_4644356_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_001244165.1|4644355_4644589_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.9e-32
WP_000963472.1|4644656_4644998_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.3e-55
WP_023150404.1|4644961_4645162_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	3.5e-32
WP_000460901.1|4645169_4645679_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.7e-86
WP_000188448.1|4645711_4645933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000107902.1|4646028_4646625_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	42.4	1.1e-39
WP_023150405.1|4646645_4648322_+	DUF4041 domain-containing protein	NA	A0A142LP25	Marinitoga_camini_virus	67.0	5.7e-83
WP_000290938.1|4648405_4649437_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	56.1	1.9e-105
4650675:4650687	attR	CTGAAATGGGCGG	NA	NA	NA	NA
>prophage 1
NZ_CP010192	Escherichia coli strain M8 plasmid A, complete sequence	162720	6536	80836	162720	integrase,transposase,plate	Enterobacteria_phage(44.44%)	45	1901:1914	13317:13330
1901:1914	attL	TCAAGAATATTACT	NA	NA	NA	NA
WP_001066926.1|6536_7277_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_073535365.1|7397_7559_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000450723.1|9285_9789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072543.1|10580_11057_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000150697.1|11059_12538_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_073535366.1|12586_13066_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_073535310.1|13073_13496_+	lysozyme family protein	NA	NA	NA	NA	NA
13317:13330	attR	TCAAGAATATTACT	NA	NA	NA	NA
WP_073535311.1|13488_15291_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_073535312.1|15281_16214_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001307039.1|16226_18209_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	23.0	1.5e-13
WP_000133489.1|18219_18687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032246098.1|18696_18996_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_001307038.1|18999_20076_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000152800.1|20083_20626_+	type VI secretion lipoprotein TssJ	NA	NA	NA	NA	NA
WP_073535313.1|20644_22009_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_077898682.1|22380_22995_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_073535314.1|23001_26406_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_073535315.1|26409_28941_+	type VI secretion system ATPase TssH	NA	A0A1C3S747	Escherichia_phage	33.4	1.9e-93
WP_000359995.1|29633_30773_+	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_000819279.1|31272_31863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077787744.1|32530_33127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024179415.1|34341_34563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071886269.1|34539_34869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032246119.1|36155_36524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073535368.1|38528_38810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000421276.1|38916_39192_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001307030.1|39191_39476_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_073535316.1|39834_40269_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	58.8	1.5e-19
WP_073535317.1|42411_46341_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA54	Enterobacteria_phage	36.8	1.6e-213
WP_073535318.1|47310_47811_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_046201729.1|47839_48322_-	DNA-directed RNA polymerase sigma-70 factor	NA	Q9LA52	Enterobacteria_phage	30.9	1.2e-14
WP_077898692.1|48443_50693_-	hemolysin activation protein	NA	NA	NA	NA	NA
WP_073535319.1|52473_53721_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_073535320.1|53780_55928_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	22.5	4.0e-20
WP_034173814.1|55952_57194_-	TolC family protein	NA	NA	NA	NA	NA
WP_072035418.1|57256_57550_-	PbsX family transcriptional regulator	NA	NA	NA	NA	NA
WP_052734128.1|60671_61517_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_071886272.1|61913_62465_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_024179409.1|62571_63291_+	molecular chaperone	NA	NA	NA	NA	NA
WP_077898685.1|63312_65823_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_139108882.1|65832_66744_+	fimbrial protein	NA	NA	NA	NA	NA
WP_073535322.1|66825_67134_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_073535323.1|68367_78060_-	contact-dependent inhibition toxin CdiA	NA	A0A0R6PJK4	Moraxella_phage	38.6	2.5e-29
WP_073535324.1|78072_79845_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_073535316.1|80401_80836_+|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	58.8	1.5e-19
