The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	0	6554	5103562	transposase	Stx2-converting_phage(60.0%)	6	NA	NA
WP_000826005.1|909_1143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073519403.1|2246_3818_-|transposase	IS66-like element ISCro1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.3	1.2e-167
WP_012904570.1|3837_4185_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	3.4e-46
WP_073519844.1|4184_4832_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.1e-21
WP_123006594.1|4899_6244_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.3	4.6e-75
WP_077897958.1|6326_6554_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	51.4	2.8e-17
>prophage 2
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	11316	12479	5103562	transposase	Acinetobacter_phage(100.0%)	1	NA	NA
WP_149025688.1|11316_12479_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
>prophage 3
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	19465	23074	5103562		Stx2-converting_phage(66.67%)	3	NA	NA
WP_001300609.1|19465_20248_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	2.0e-139
WP_061892120.1|22349_22697_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	8.2e-61
WP_073519847.1|22693_23074_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	90.5	1.9e-58
>prophage 4
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	26935	32355	5103562		Escherichia_phage(50.0%)	2	NA	NA
WP_077897956.1|26935_31717_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	39.7	9.4e-155
WP_073542044.1|32004_32355_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	86.1	4.7e-48
>prophage 5
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	39201	43265	5103562	integrase	Enterobacteria_phage(100.0%)	3	28949:28964	55461:55476
28949:28964	attL	TCCGGTGCTGGCGAAA	NA	NA	NA	NA
WP_061892127.1|39201_39426_+	hypothetical protein	NA	Q8W609	Enterobacteria_phage	86.2	4.1e-21
WP_073519419.1|39711_40548_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_021537648.1|42083_43265_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	69.7	1.1e-162
55461:55476	attR	TTTCGCCAGCACCGGA	NA	NA	NA	NA
>prophage 6
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	49544	50936	5103562		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|49544_50936_-	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 7
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	56057	62808	5103562		Bordetella_phage(25.0%)	6	NA	NA
WP_000280488.1|56057_58166_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
WP_000135058.1|58184_58460_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_001295237.1|58514_59138_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000870052.1|59395_61078_+	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.3	2.5e-22
WP_000924289.1|61074_61692_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_001297374.1|61983_62808_-	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	77.0	6.3e-91
>prophage 8
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	66181	70744	5103562		Xanthomonas_phage(25.0%)	7	NA	NA
WP_001298007.1|66181_66637_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	7.3e-49
WP_073519422.1|66617_67838_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.2	1.0e-44
WP_001297375.1|68009_68678_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_000091955.1|68894_69131_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001051798.1|69151_69319_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_001114533.1|69416_70226_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001171866.1|70264_70744_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	4.8e-27
>prophage 9
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	82675	93404	5103562		Synechococcus_phage(16.67%)	10	NA	NA
WP_000587764.1|82675_83608_-	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	1.1e-35
WP_001307464.1|83896_84769_+	protein YibB	NA	NA	NA	NA	NA
WP_001213855.1|85043_86240_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.1	7.1e-35
WP_000646014.1|86249_87275_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_000982078.1|87513_88548_+	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	7.5e-09
WP_000483860.1|88534_89494_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001214147.1|89497_90781_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000116565.1|90790_92335_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001156181.1|92579_93011_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000024392.1|93152_93404_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
>prophage 10
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	115500	126191	5103562	tRNA	uncultured_Caudovirales_phage(66.67%)	7	NA	NA
WP_001346013.1|115500_116334_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	47.0	3.3e-23
WP_000072850.1|116486_117329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001271686.1|117433_117817_-	protein YhhH	NA	NA	NA	NA	NA
WP_073519424.1|117788_122024_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	31.9	2.1e-25
WP_000779792.1|122252_122861_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_000206275.1|122958_124350_+|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_000582482.1|124346_126191_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.2	1.5e-15
>prophage 11
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	154615	156157	5103562		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146482.1|154615_156157_-	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	2.5e-16
>prophage 12
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	161475	162471	5103562		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182653.1|161475_162471_-	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.7	9.1e-12
>prophage 13
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	166695	166908	5103562		Morganella_phage(100.0%)	1	NA	NA
WP_000014594.1|166695_166908_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 14
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	170562	172896	5103562		Escherichia_phage(100.0%)	1	NA	NA
WP_000024005.1|170562_172896_+	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	29.2	7.0e-71
>prophage 15
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	188803	190788	5103562		Planktothrix_phage(50.0%)	2	NA	NA
WP_001196496.1|188803_189787_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	8.7e-15
WP_000107031.1|189783_190788_+	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	6.6e-18
>prophage 16
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	237768	238416	5103562		Bacillus_virus(100.0%)	1	NA	NA
WP_001296814.1|237768_238416_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 17
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	243297	245432	5103562		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_000065769.1|243297_243723_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.5e-51
WP_000922639.1|243735_245025_-	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	4.6e-173
WP_000008957.1|245078_245432_-	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	9.7e-25
>prophage 18
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	248777	250820	5103562		Indivirus(100.0%)	1	NA	NA
WP_001298719.1|248777_250820_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.1	6.8e-46
>prophage 19
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	264250	270133	5103562		Staphylococcus_phage(50.0%)	5	NA	NA
WP_000149132.1|264250_266986_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.1e-22
WP_001314210.1|266985_268110_+	ABC-2 transporter permease	NA	NA	NA	NA	NA
WP_000593555.1|268440_268800_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_001190062.1|268919_269321_-	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_000173666.1|269326_270133_-	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	4.5e-17
>prophage 20
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	278026	282158	5103562		Dickeya_phage(50.0%)	4	NA	NA
WP_001100467.1|278026_278692_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	5.6e-58
WP_000130621.1|278912_279158_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_000106527.1|279259_281458_-	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.3	5.0e-119
WP_073519431.1|281531_282158_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
>prophage 21
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	285161	287980	5103562		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000617723.1|285161_285830_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
WP_001042003.1|285822_286881_+	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000130217.1|287125_287980_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
>prophage 22
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	293713	295196	5103562		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_000082110.1|293713_294481_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
WP_073519432.1|294482_295196_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	7.0e-14
>prophage 23
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	299565	305126	5103562	transposase	Planktothrix_phage(33.33%)	6	NA	NA
WP_000907790.1|299565_300636_+	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
WP_000073609.1|300632_301376_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	8.3e-10
WP_000825996.1|301362_301803_-	DUF2756 family protein	NA	NA	NA	NA	NA
WP_000595084.1|301922_303665_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_032163276.1|303702_303951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947598.1|303963_305126_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
>prophage 24
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	322648	325096	5103562		Dickeya_phage(100.0%)	1	NA	NA
WP_000993455.1|322648_325096_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 25
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	334325	335552	5103562		Ralstonia_phage(100.0%)	1	NA	NA
WP_001105436.1|334325_335552_+	RtcB family protein	NA	A0A1L7N133	Ralstonia_phage	59.5	1.3e-132
>prophage 26
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	339931	342325	5103562		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081909.1|339931_342325_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 27
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	355736	359504	5103562		Bacillus_phage(66.67%)	3	NA	NA
WP_001157751.1|355736_356456_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
WP_001253696.1|356452_357805_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_001298201.1|357881_359504_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
>prophage 28
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	376479	377316	5103562		Vibrio_phage(100.0%)	1	NA	NA
WP_000742143.1|376479_377316_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	4.9e-67
>prophage 29
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	401544	411085	5103562		Acinetobacter_phage(25.0%)	9	NA	NA
WP_000601847.1|401544_402108_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	55.8	1.2e-61
WP_000963785.1|402193_403414_+	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_001295162.1|403480_405571_-	membrane protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_000242755.1|405621_406254_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001148908.1|406555_406960_+	OsmC family protein	NA	NA	NA	NA	NA
WP_001274680.1|407014_407884_-	phosphoribulokinase	NA	NA	NA	NA	NA
WP_000907085.1|407937_408156_-	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_000057405.1|408149_409172_-	hydrolase	NA	NA	NA	NA	NA
WP_073519439.1|409171_411085_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	5.6e-74
>prophage 30
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	416655	422229	5103562		uncultured_Caudovirales_phage(33.33%)	7	NA	NA
WP_001209711.1|416655_417042_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	38.3	9.6e-18
WP_000820720.1|417041_417401_+	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_000903377.1|417408_417696_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000246815.1|417821_418196_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_001138043.1|418292_418763_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000124700.1|418859_420974_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_000031783.1|421044_422229_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 31
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	442106	443578	5103562	tRNA	Prochlorococcus_phage(50.0%)	2	NA	NA
WP_000004432.1|442106_443054_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
WP_000114984.1|443068_443578_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
>prophage 32
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	453916	458070	5103562		Bacillus_virus(50.0%)	4	NA	NA
WP_000078332.1|453916_454675_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	6.9e-20
WP_001307418.1|454682_455786_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000019674.1|455795_456977_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000738579.1|457044_458070_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	2.4e-71
>prophage 33
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	464574	465459	5103562		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_073519442.1|464574_465459_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	1.4e-24
>prophage 34
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	476024	477068	5103562		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|476024_477068_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 35
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	493844	496369	5103562	protease	uncultured_archaeal_virus(50.0%)	2	NA	NA
WP_000497723.1|493844_494912_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
WP_001295271.1|495001_496369_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
>prophage 36
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	500335	500833	5103562	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366129.1|500335_500833_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
>prophage 37
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	504537	506028	5103562		Burkholderia_virus(100.0%)	1	NA	NA
WP_000108459.1|504537_506028_+	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
>prophage 38
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	515724	530519	5103562		Staphylococcus_phage(25.0%)	17	NA	NA
WP_001176896.1|515724_516654_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
WP_000809774.1|516749_519086_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001299134.1|519315_519969_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000047091.1|519965_520694_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_000620387.1|520690_521323_-	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000216791.1|521536_521809_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000243741.1|521805_522660_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000183676.1|522705_523197_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_001176599.1|523314_523602_-	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000809051.1|523624_525058_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_000224099.1|525105_525831_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000669785.1|525837_526395_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000030537.1|526363_526939_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000030016.1|526935_527502_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_001295557.1|527522_528509_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000922901.1|528522_529500_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_000438245.1|529709_530519_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
>prophage 39
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	534587	536065	5103562		Vibrio_phage(50.0%)	2	NA	NA
WP_000445413.1|534587_534866_-	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
WP_001047348.1|535093_536065_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	3.5e-08
>prophage 40
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	542693	545566	5103562	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_001107467.1|542693_544628_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
WP_000764731.1|544717_545566_+	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
>prophage 41
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	549648	556287	5103562		Dickeya_phage(50.0%)	4	NA	NA
WP_073519446.1|549648_550992_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
WP_001300397.1|551622_552075_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_073519447.1|552102_553590_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000133044.1|553614_556287_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
>prophage 42
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	561768	563658	5103562		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|561768_563658_+	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 43
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	570774	578567	5103562		Diadromus_pulchellus_ascovirus(25.0%)	10	NA	NA
WP_000189315.1|570774_571077_-	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	3.9e-14
WP_000449451.1|571127_571571_+	YhbP family protein	NA	NA	NA	NA	NA
WP_000037608.1|571550_572069_-	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_001351326.1|572196_572832_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000147574.1|572904_573945_+	permease	NA	NA	NA	NA	NA
WP_000646043.1|574058_574634_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_001158034.1|574643_575234_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000246855.1|575253_575649_-	YraN family protein	NA	NA	NA	NA	NA
WP_000249149.1|575606_577643_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_000809264.1|577706_578567_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	44.0	2.5e-50
>prophage 44
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	601576	602722	5103562		Streptococcus_phage(100.0%)	1	NA	NA
WP_001299416.1|601576_602722_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	1.7e-49
>prophage 45
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	611041	613336	5103562		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861734.1|611041_613336_+	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	7.4e-158
>prophage 46
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	639352	640318	5103562		Escherichia_phage(100.0%)	1	NA	NA
WP_001098806.1|639352_640318_-	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 47
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	652739	668924	5103562	tRNA	Herpes_simplex_virus(16.67%)	13	NA	NA
WP_073519454.1|652739_655832_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.1	1.7e-157
WP_000212475.1|656015_656999_-	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_000450589.1|657217_657550_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000627213.1|657591_659082_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	4.8e-33
WP_000094682.1|659388_660909_+	methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	52.2	1.4e-35
WP_000018003.1|661062_661686_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_075262003.1|661756_661939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001065895.1|661962_662727_+	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000228937.1|662980_663487_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_073519455.1|663565_665407_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000918827.1|665601_667347_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_001144069.1|667457_667673_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_073519456.1|667910_668924_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	4.8e-109
>prophage 48
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	675307	676546	5103562	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708500.1|675307_676546_-|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.6	5.9e-93
>prophage 49
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	681683	683117	5103562		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869178.1|681683_683117_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 50
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	692632	703594	5103562		Staphylococcus_phage(20.0%)	11	NA	NA
WP_001076997.1|692632_693286_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
WP_073519457.1|693774_694548_-	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_000188373.1|694663_695479_+	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_000442860.1|695516_696677_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_000831543.1|696682_697354_-	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000735278.1|697501_698983_-	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000917117.1|699187_699817_+	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000833393.1|699817_700240_+	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000444747.1|700264_701092_+	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000105733.1|701091_701673_+	esterase YqiA	NA	NA	NA	NA	NA
WP_000195296.1|701701_703594_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
>prophage 51
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	707421	718245	5103562		Stx_converting_phage(25.0%)	9	NA	NA
WP_000712658.1|707421_707814_+	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
WP_000183494.1|707866_708349_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001281881.1|708894_711153_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.4e-84
WP_000965712.1|711386_712124_+	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_000059395.1|712198_713611_+	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000095187.1|713721_715941_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000848528.1|715983_716241_-	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000691598.1|716291_717218_-	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000013149.1|717417_718245_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
>prophage 52
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	724320	725205	5103562		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018760.1|724320_725205_-	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 53
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	747424	748597	5103562		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000524972.1|747424_748597_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	30.7	4.2e-40
>prophage 54
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	781742	784796	5103562		Pseudomonas_phage(50.0%)	6	NA	NA
WP_073519465.1|781742_782387_-	antitoxin of toxin-antitoxin stability system	NA	A0A2I6PI07	Pseudomonas_phage	33.0	2.1e-25
WP_000692323.1|782405_782627_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_041124171.1|782689_783166_-	RadC family protein	NA	NA	NA	NA	NA
WP_061892567.1|783181_783661_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.7	8.0e-14
WP_077768309.1|783759_783960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061892566.1|783977_784796_-	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	38.7	1.8e-45
>prophage 55
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	798046	815607	5103562	transposase	Moraxella_phage(50.0%)	9	NA	NA
WP_073519850.1|798046_799699_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	28.4	1.3e-39
WP_073519471.1|799708_800236_+	toxin-activating lysine-acyltransferase	NA	NA	NA	NA	NA
WP_073519472.1|800251_809287_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	40.3	1.0e-56
WP_073519473.1|809290_809626_+	DUF596 domain-containing protein	NA	NA	NA	NA	NA
WP_122986564.1|810045_810318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073519852.1|810907_811456_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9LA63	Enterobacterial_phage	32.4	7.5e-16
WP_123006585.1|811633_813379_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_073519475.1|813444_813750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085947772.1|814394_815607_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
>prophage 56
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	819313	821169	5103562		Mycobacterium_phage(50.0%)	2	NA	NA
WP_073519477.1|819313_820546_+	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	33.1	2.9e-60
WP_000502847.1|820530_821169_+	transcriptional regulator	NA	A0A0F7L444	uncultured_marine_virus	52.0	3.3e-55
>prophage 57
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	831789	835936	5103562	integrase	Pseudomonas_phage(50.0%)	4	825203:825217	835273:835287
825203:825217	attL	TTTTCTGCCAGACGC	NA	NA	NA	NA
WP_001218789.1|831789_833055_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.3	1.7e-79
WP_001764947.1|833380_834253_+	ParA family protein	NA	NA	NA	NA	NA
WP_097338977.1|834177_834372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001764949.1|834583_835936_+	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	52.2	2.1e-120
835273:835287	attR	GCGTCTGGCAGAAAA	NA	NA	NA	NA
>prophage 58
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	842096	846477	5103562	transposase	Streptococcus_phage(50.0%)	4	NA	NA
WP_001764957.1|842096_844151_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	28.7	9.0e-38
WP_106426505.1|844827_845046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001764958.1|845017_845485_+	DUF3577 domain-containing protein	NA	NA	NA	NA	NA
WP_001764959.1|845505_846477_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	45.8	2.0e-56
>prophage 59
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	862654	864880	5103562		Yersinia_phage(100.0%)	1	NA	NA
WP_073519481.1|862654_864880_+	trimeric autotransporter adhesin TaaP	NA	A0A1V0DXR3	Yersinia_phage	38.3	1.8e-07
>prophage 60
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	874024	883876	5103562		Moraxella_phage(100.0%)	1	NA	NA
WP_077897951.1|874024_883876_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	36.8	2.1e-52
>prophage 61
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	890120	891329	5103562	transposase	uncultured_virus(100.0%)	1	NA	NA
WP_073519492.1|890120_891329_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.7	1.6e-47
>prophage 62
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	902966	907773	5103562		Tupanvirus(50.0%)	4	NA	NA
WP_077897949.1|902966_904760_+	AMP-binding protein	NA	A0A2K9KZV5	Tupanvirus	33.8	1.6e-62
WP_073519508.1|904827_905286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073519509.1|905282_906695_+	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_073519510.1|906726_907773_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B5IW14	Pandoravirus	48.3	6.1e-75
>prophage 63
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	914716	915691	5103562		Caulobacter_phage(100.0%)	1	NA	NA
WP_073519518.1|914716_915691_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	37.9	1.9e-46
>prophage 64
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	946307	947462	5103562		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|946307_947462_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 65
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	961056	961734	5103562		Bacillus_virus(100.0%)	1	NA	NA
WP_000956871.1|961056_961734_-	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.1	1.1e-08
>prophage 66
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	979740	980973	5103562		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|979740_980973_+	D-3-phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 67
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	989510	994883	5103562		Prochlorococcus_phage(50.0%)	3	NA	NA
WP_073519525.1|989510_992384_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.0	8.2e-263
WP_000951964.1|992649_993393_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_141221849.1|993449_994883_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.7	1.3e-30
>prophage 68
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	998807	1014199	5103562	tRNA	Brevibacillus_phage(14.29%)	14	NA	NA
WP_000806638.1|998807_999704_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
WP_073519527.1|999728_1000439_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000813215.1|1000444_1002178_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.5	3.2e-60
WP_001701073.1|1002268_1003366_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000003068.1|1003376_1004894_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001192814.1|1004936_1005485_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_120795390.1|1005539_1005611_+	protein YqfH	NA	NA	NA	NA	NA
WP_001010156.1|1005607_1005733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295374.1|1005734_1007183_-	purine permease	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_001345944.1|1007618_1009538_+	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_000838428.1|1009537_1010026_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_000012163.1|1010061_1011429_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
WP_001295158.1|1011464_1012781_-	guanine deaminase	NA	NA	NA	NA	NA
WP_001280215.1|1012798_1014199_-	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
>prophage 69
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1038478	1039234	5103562		Clostridium_phage(100.0%)	1	NA	NA
WP_001272558.1|1038478_1039234_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 70
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1047546	1050127	5103562		Enterobacteria_phage(100.0%)	2	NA	NA
WP_073519533.1|1047546_1049379_+	hypothetical protein	NA	I7HJD8	Enterobacteria_phage	29.8	3.3e-31
WP_077897947.1|1049413_1050127_+	hypothetical protein	NA	I7I023	Enterobacteria_phage	48.3	2.2e-47
>prophage 71
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1074066	1076561	5103562		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_000603518.1|1074066_1074828_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
WP_000256438.1|1075142_1076561_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.9	1.8e-24
>prophage 72
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1086192	1092965	5103562		Moraxella_phage(33.33%)	7	NA	NA
WP_000895624.1|1086192_1086906_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
WP_000082188.1|1086974_1087664_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_001453804.1|1087842_1088037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000564489.1|1088348_1088879_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000957914.1|1088891_1091138_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000204658.1|1091288_1092164_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000816232.1|1092170_1092965_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
>prophage 73
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1098442	1113991	5103562	tRNA	Klosneuvirus(16.67%)	9	NA	NA
WP_001138163.1|1098442_1101331_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.6	1.2e-67
WP_001285985.1|1101323_1104866_+	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	21.8	1.5e-08
WP_000775946.1|1104865_1106692_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.6	7.8e-25
WP_000237948.1|1106753_1108085_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000016907.1|1108316_1109570_+	N-acetylmuramoyl-L-alanine amidase	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000678646.1|1110149_1111247_+	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000117728.1|1111485_1112292_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.2e-16
WP_000184249.1|1112342_1112786_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_001299106.1|1112785_1113991_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	37.0	1.7e-73
>prophage 74
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1125517	1126273	5103562		Bacillus_phage(100.0%)	1	NA	NA
WP_000268232.1|1125517_1126273_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	5.0e-10
>prophage 75
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1131131	1131980	5103562		Vibrio_phage(100.0%)	1	NA	NA
WP_000100430.1|1131131_1131980_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	4.7e-41
>prophage 76
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1139514	1143629	5103562		Hokovirus(50.0%)	2	NA	NA
WP_000186450.1|1139514_1142271_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
WP_000046790.1|1142327_1143629_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.7	2.0e-38
>prophage 77
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1147661	1153504	5103562		Only_Syngen_Nebraska_virus(33.33%)	6	NA	NA
WP_000210878.1|1147661_1149299_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
WP_000036723.1|1149386_1150685_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_000034929.1|1150740_1151103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000793004.1|1151138_1152044_-	YgcG family protein	NA	NA	NA	NA	NA
WP_001379137.1|1152057_1152660_-	LemA family protein	NA	NA	NA	NA	NA
WP_001199982.1|1152832_1153504_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
>prophage 78
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1172902	1174935	5103562		Hokovirus(50.0%)	2	NA	NA
WP_001090345.1|1172902_1174330_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	27.6	2.8e-30
WP_001173673.1|1174329_1174935_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
>prophage 79
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1178047	1181763	5103562		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_001295182.1|1178047_1178809_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|1178802_1179429_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272590.1|1179568_1180708_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|1180770_1181763_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
>prophage 80
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1186976	1194116	5103562		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|1186976_1187615_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|1187611_1188874_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|1188870_1189779_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|1189974_1190742_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141314.1|1190792_1191449_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	47.9	1.1e-50
WP_001272898.1|1191554_1194116_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
>prophage 81
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1213184	1214198	5103562		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001355855.1|1213184_1214198_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.0	2.3e-26
>prophage 82
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1221965	1222931	5103562		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287415.1|1221965_1222931_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	1.8e-36
>prophage 83
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1228397	1233957	5103562	tRNA	Pseudomonas_phage(25.0%)	5	NA	NA
WP_000132231.1|1228397_1228895_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
WP_000963143.1|1228974_1230036_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000140506.1|1230278_1230779_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000047176.1|1230906_1233537_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000906486.1|1233771_1233957_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 84
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1246591	1251887	5103562		Bacillus_virus(20.0%)	5	NA	NA
WP_000985494.1|1246591_1247794_-	proline/glycine betaine ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
WP_000777969.1|1248148_1249108_-	ribonucleoside-diphosphate reductase 2 subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	3.5e-133
WP_000246509.1|1249117_1251262_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.0	1.6e-194
WP_000080944.1|1251234_1251645_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	2.7e-18
WP_001223227.1|1251641_1251887_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
>prophage 85
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1255822	1259947	5103562		Clostridium_phage(50.0%)	4	NA	NA
WP_000522424.1|1255822_1256272_+	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
WP_000156811.1|1256272_1256935_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_001325764.1|1256955_1258356_-	GABA permease	NA	NA	NA	NA	NA
WP_000097641.1|1258666_1259947_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	2.4e-33
>prophage 86
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1269427	1272333	5103562	transposase	Salmonella_phage(33.33%)	5	NA	NA
WP_000340075.1|1269427_1269685_+	hypothetical protein	NA	A0A1S6L009	Salmonella_phage	69.2	1.2e-05
WP_000927517.1|1269770_1269890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095374745.1|1270394_1271608_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	1.4e-99
WP_001283984.1|1271628_1271928_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_001367084.1|1272093_1272333_-	AlpA family phage regulatory protein	NA	A0A1V0E8E5	Vibrio_phage	49.2	2.5e-08
>prophage 87
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1282757	1285264	5103562	integrase	Escherichia_phage(50.0%)	2	1277467:1277479	1284282:1284294
1277467:1277479	attL	GCTGGCAAGCGAA	NA	NA	NA	NA
WP_000113815.1|1282757_1283999_-|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	47.3	4.5e-101
WP_000162574.1|1284781_1285264_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
1284282:1284294	attR	TTCGCTTGCCAGC	NA	NA	NA	NA
>prophage 88
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1298898	1299969	5103562		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001168044.1|1298898_1299969_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
>prophage 89
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1305875	1308449	5103562		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001235102.1|1305875_1308449_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 90
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1314322	1315621	5103562		Burkholderia_virus(100.0%)	1	NA	NA
WP_000230376.1|1314322_1315621_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
>prophage 91
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1320914	1324003	5103562	tRNA	Achromobacter_phage(33.33%)	4	NA	NA
WP_001098726.1|1320914_1321334_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997403.1|1321540_1322578_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001262723.1|1322625_1323315_-	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.1e-55
WP_000627807.1|1323619_1324003_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
>prophage 92
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1327117	1328452	5103562		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
WP_000219193.1|1327117_1328452_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
>prophage 93
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1334223	1337966	5103562		Tupanvirus(50.0%)	3	NA	NA
WP_000790168.1|1334223_1336023_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000002542.1|1336038_1337013_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068343.1|1337285_1337966_+	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
>prophage 94
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1341424	1341685	5103562		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196283.1|1341424_1341685_-	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
>prophage 95
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1345804	1357094	5103562		Bacillus_phage(50.0%)	7	NA	NA
WP_000970116.1|1345804_1349692_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.4	1.2e-131
WP_073519550.1|1350249_1351677_+	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.9e-16
WP_001345753.1|1351841_1352555_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001298983.1|1352544_1353879_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_000717694.1|1353939_1354278_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000883122.1|1354322_1355513_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000919159.1|1355840_1357094_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
>prophage 96
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1362852	1364364	5103562		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000493471.1|1362852_1364364_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	3.3e-13
>prophage 97
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1379528	1385985	5103562		Faustovirus(20.0%)	8	NA	NA
WP_001295373.1|1379528_1380743_+	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
WP_000331707.1|1380770_1381157_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_000028953.1|1381173_1381497_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000384411.1|1381592_1382108_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_001196613.1|1382124_1383975_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_001124469.1|1383976_1384312_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_000523616.1|1384323_1384524_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_000133591.1|1384701_1385985_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	2.9e-34
>prophage 98
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1395819	1396251	5103562		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963837.1|1395819_1396251_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 99
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1405080	1411377	5103562		Escherichia_phage(60.0%)	6	NA	NA
WP_073519557.1|1405080_1406451_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	2.4e-42
WP_001299507.1|1406612_1408079_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000138282.1|1408147_1409725_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_000755173.1|1409819_1410359_-	hypothetical protein	NA	G9L6F0	Escherichia_phage	100.0	3.4e-45
WP_000669403.1|1410374_1410890_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	6.5e-62
WP_001344399.1|1411203_1411377_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
>prophage 100
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1417811	1421813	5103562		Prochlorococcus_phage(33.33%)	4	NA	NA
WP_001028614.1|1417811_1418450_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
WP_001295474.1|1418449_1419487_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
WP_001295473.1|1419811_1420438_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000198328.1|1420523_1421813_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
>prophage 101
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1443103	1443817	5103562		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|1443103_1443817_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 102
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1461864	1462815	5103562		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|1461864_1462815_-	transaldolase A	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 103
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1481369	1486307	5103562		Deep-sea_thermophilic_phage(33.33%)	6	NA	NA
WP_000102891.1|1481369_1482239_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
WP_000406000.1|1482452_1482878_+	acetyltransferase YpeA	NA	NA	NA	NA	NA
WP_001307326.1|1482864_1483314_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000838945.1|1483374_1483950_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_000084590.1|1484045_1484945_+	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_001315775.1|1485002_1486307_-	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	26.2	1.6e-08
>prophage 104
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1489785	1505155	5103562		Streptococcus_phage(33.33%)	15	NA	NA
WP_000517431.1|1489785_1490577_+	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	8.9e-18
WP_000290231.1|1490747_1491764_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000458406.1|1491763_1492597_+	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000852686.1|1492596_1493472_+	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000021040.1|1493461_1494559_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
WP_001297645.1|1494692_1495604_+	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	3.5e-58
WP_000719963.1|1495606_1495975_-	YfeK family protein	NA	NA	NA	NA	NA
WP_000096644.1|1496079_1496931_+	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000522247.1|1496972_1497482_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000623136.1|1497522_1499250_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000487600.1|1499294_1499552_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000034402.1|1499935_1500907_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000254839.1|1501091_1501853_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_001300494.1|1502082_1503069_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000443665.1|1503139_1505155_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	6.5e-150
>prophage 105
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1526700	1527435	5103562		Clostridioides_phage(100.0%)	1	NA	NA
WP_001295458.1|1526700_1527435_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 106
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1531253	1532174	5103562		Morganella_phage(100.0%)	1	NA	NA
WP_000484404.1|1531253_1532174_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
>prophage 107
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1535864	1543441	5103562		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_001283499.1|1535864_1537559_+	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.0e-23
WP_000955028.1|1537628_1538573_+	transporter YfdV	NA	NA	NA	NA	NA
WP_001296867.1|1538646_1539792_+	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_001348569.1|1539847_1543441_-	acid-sensing system histidine kinase EvgS	NA	A0A1V0SGX0	Hokovirus	32.1	1.7e-36
>prophage 108
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1550082	1551516	5103562		Bacillus_phage(100.0%)	1	NA	NA
WP_000194515.1|1550082_1551516_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
>prophage 109
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1554556	1555489	5103562		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000368131.1|1554556_1555489_-	transporter	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
>prophage 110
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1573358	1634189	5103562	portal,integrase,plate,head,tRNA,transposase,tail,holin,capsid,terminase	Enterobacteria_phage(81.25%)	75	1580490:1580513	1625818:1625841
WP_001297933.1|1573358_1574444_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
WP_001043814.1|1574447_1575272_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000447356.1|1575271_1576081_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_001089235.1|1576080_1576629_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_073519569.1|1576662_1576941_+	YfcL family protein	NA	NA	NA	NA	NA
WP_000683799.1|1577061_1579068_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000817178.1|1579226_1580447_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
1580490:1580513	attL	GATAAGACGCGCCAGCGTCGCATC	NA	NA	NA	NA
WP_000127781.1|1580739_1581918_+	MFS transporter	NA	NA	NA	NA	NA
WP_000615821.1|1581914_1582910_-	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_042094563.1|1583139_1583931_-	site-specific DNA-methyltransferase	NA	Q775B4	Bordetella_phage	52.1	7.4e-65
WP_042094562.1|1583875_1584073_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000078920.1|1584308_1584449_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_000488107.1|1584640_1584901_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000060706.1|1584985_1586056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000132808.1|1586228_1587338_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.6	4.8e-195
WP_073519570.1|1587495_1588680_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	97.5	6.4e-222
WP_000290450.1|1588679_1589192_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000665308.1|1589246_1589612_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_000763327.1|1589647_1589776_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_071685921.1|1589762_1592570_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	88.2	0.0e+00
WP_000979954.1|1592582_1593071_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.6e-86
WP_001100987.1|1593167_1594346_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_073519571.1|1594440_1595040_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	91.1	5.9e-99
WP_047084517.1|1595039_1597151_-|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	97.7	9.7e-112
WP_021293091.1|1597153_1597684_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	5.1e-94
WP_001512968.1|1597676_1598573_-|plate	baseplate J-like family protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.0	3.9e-155
WP_000213447.1|1598576_1598927_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001271930.1|1598923_1599505_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.9	5.6e-102
WP_001705834.1|1599501_1600137_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.1	9.0e-114
WP_000920594.1|1600129_1600597_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_071529104.1|1600583_1600763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021511916.1|1600734_1601142_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	97.8	7.7e-66
WP_000072335.1|1601138_1601531_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	99.2	9.9e-71
WP_000104350.1|1601527_1601851_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000864897.1|1601853_1602054_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	98.5	6.0e-32
WP_000063094.1|1602053_1602548_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	98.2	3.0e-88
WP_000632362.1|1602649_1603450_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.7	1.3e-130
WP_021533064.1|1603495_1604548_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.1	2.5e-193
WP_001262673.1|1604571_1605408_-|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	100.0	2.7e-150
WP_000613781.1|1605562_1607314_+|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	97.9	0.0e+00
WP_001705841.1|1607313_1608360_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	7.4e-206
WP_001289966.1|1608850_1609441_-	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	51.3	3.6e-32
WP_000211289.1|1609504_1609816_-	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	95.1	1.2e-47
WP_000686499.1|1609820_1610780_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.7	2.0e-181
WP_021579107.1|1610856_1613679_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	96.8	0.0e+00
WP_073519572.1|1613685_1614051_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_000013441.1|1614123_1614354_-	hypothetical protein	NA	A0A0A7NV48	Enterobacteria_phage	96.1	2.6e-31
WP_071529425.1|1614410_1614626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021579106.1|1614676_1614976_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	90.8	6.2e-41
WP_000153674.1|1614972_1615218_-	winged helix-turn-helix domain-containing protein	NA	A0A0A7NV47	Enterobacteria_phage	98.8	3.3e-40
WP_000985161.1|1615214_1615418_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	86.6	2.9e-26
WP_000021652.1|1615503_1615617_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	97.3	3.3e-11
WP_000514277.1|1615613_1615856_-	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_044788547.1|1615867_1616155_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	75.8	3.0e-32
WP_021579104.1|1616165_1616507_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	91.4	2.5e-54
WP_073519573.1|1616759_1616966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000004249.1|1616972_1617260_-	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	52.6	4.3e-23
WP_001390705.1|1617373_1617694_+	helix-turn-helix transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	43.2	1.4e-14
WP_000023402.1|1617790_1618795_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	55.7	4.5e-99
WP_000004833.1|1618953_1620111_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	7.9e-23
WP_001289162.1|1620176_1621190_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001283590.1|1621189_1622002_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_000364331.1|1622084_1622744_+	DedA family protein	NA	NA	NA	NA	NA
WP_000118404.1|1622899_1623814_+	acetyl-CoA carboxylase, carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_073519574.1|1623883_1625152_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_000146992.1|1625141_1625804_+	cell division protein DedD	NA	NA	NA	NA	NA
WP_000262113.1|1626062_1626551_+	colicin V production protein	NA	NA	NA	NA	NA
1625818:1625841	attR	GATGCGACGCTGGCGCGTCTTATC	NA	NA	NA	NA
WP_000334218.1|1626587_1628105_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	1.0e-86
WP_000825689.1|1628199_1628769_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_000748261.1|1629034_1629817_+	lysine/arginine/ornithine ABC transporter substrate-binding protein ArgT	NA	NA	NA	NA	NA
WP_000737621.1|1630037_1630820_+	histidine ABC transporter substrate-binding protein HisJ	NA	NA	NA	NA	NA
WP_000965518.1|1630909_1631596_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000569958.1|1631592_1632309_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001293612.1|1632316_1633090_+	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
WP_000156113.1|1633286_1634189_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	44.5	8.2e-68
>prophage 111
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1644748	1647976	5103562		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_001203389.1|1644748_1645399_+	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	34.3	5.2e-08
WP_001012899.1|1645485_1647318_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_000813860.1|1647376_1647976_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
>prophage 112
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1682392	1687396	5103562		Tupanvirus(50.0%)	4	NA	NA
WP_000860259.1|1682392_1684375_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	1.8e-19
WP_000461661.1|1684374_1685343_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.2	2.0e-35
WP_001342601.1|1685346_1686486_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.8	1.9e-29
WP_001297077.1|1686793_1687396_+	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	3.4e-09
>prophage 113
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1690548	1691451	5103562	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000140553.1|1690548_1691451_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.4	9.6e-69
>prophage 114
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1697344	1711400	5103562		Pseudomonas_phage(33.33%)	8	NA	NA
WP_000768973.1|1697344_1698421_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
WP_000301045.1|1698883_1699534_+	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000135040.1|1699587_1699842_-	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000332036.1|1699841_1700972_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
WP_001075177.1|1701060_1703346_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.1e-283
WP_073519858.1|1704041_1707776_+	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	23.5	7.6e-19
WP_000990754.1|1707903_1708626_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_073519577.1|1708772_1711400_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
>prophage 115
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1726323	1731166	5103562		Bacillus_phage(50.0%)	2	NA	NA
WP_000559125.1|1726323_1728150_-	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	27.3	1.5e-20
WP_000876014.1|1728316_1731166_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
>prophage 116
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1735443	1741221	5103562		Enterobacteria_phage(25.0%)	5	NA	NA
WP_000865564.1|1735443_1736547_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.2	1.5e-119
WP_000406087.1|1736658_1737714_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000710363.1|1737787_1738852_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_000884942.1|1738851_1739502_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000422188.1|1739577_1741221_+	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
>prophage 117
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1749988	1750606	5103562		Bacillus_virus(100.0%)	1	NA	NA
WP_001296826.1|1749988_1750606_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	2.5e-12
>prophage 118
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1762305	1769953	5103562		Vibrio_phage(50.0%)	7	NA	NA
WP_000050789.1|1762305_1763313_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
WP_000494183.1|1763451_1763736_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000578079.1|1763860_1765621_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	3.2e-100
WP_001234850.1|1765769_1766465_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_073519580.1|1766492_1767683_+	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	2.9e-20
WP_000202798.1|1768015_1768360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194940.1|1768363_1769953_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	33.6	3.2e-19
>prophage 119
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1775707	1780008	5103562		Clostridioides_phage(50.0%)	4	NA	NA
WP_000241012.1|1775707_1776274_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
WP_000594599.1|1776685_1777399_-	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000198823.1|1777437_1778424_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_000848214.1|1778541_1780008_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.3	8.7e-43
>prophage 120
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1794506	1795364	5103562		Catovirus(100.0%)	1	NA	NA
WP_000873890.1|1794506_1795364_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	34.0	1.4e-24
>prophage 121
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1799433	1803219	5103562		Acinetobacter_phage(50.0%)	3	NA	NA
WP_073519584.1|1799433_1801425_+	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.0e-13
WP_000425438.1|1801456_1802293_-	S-formylglutathione hydrolase YeiG	NA	NA	NA	NA	NA
WP_001139613.1|1802550_1803219_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
>prophage 122
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1806913	1808434	5103562		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255039.1|1806913_1808434_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 123
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1828747	1838189	5103562		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569329.1|1828747_1829674_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|1829678_1830410_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1830390_1830498_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1830557_1831289_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1831510_1833196_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1833192_1833912_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1833958_1834429_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1834469_1834931_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001317947.1|1835055_1837056_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001292774.1|1837052_1838189_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
>prophage 124
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1850753	1852787	5103562	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001295427.1|1850753_1852787_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 125
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1863459	1867016	5103562		Paenibacillus_phage(50.0%)	4	NA	NA
WP_001437757.1|1863459_1864278_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	2.5e-23
WP_000434038.1|1864329_1865076_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011960.1|1865049_1866015_-	sugar kinase	NA	NA	NA	NA	NA
WP_000846231.1|1866011_1867016_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.0	6.4e-13
>prophage 126
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1877506	1884380	5103562	tRNA	Bacillus_phage(50.0%)	8	NA	NA
WP_073519591.1|1877506_1878406_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000716757.1|1878820_1879138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000476011.1|1879467_1880829_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
WP_001220181.1|1880931_1881228_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001307279.1|1881229_1881526_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_000929408.1|1881734_1882067_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137869.1|1882257_1882980_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.4e-30
WP_000675150.1|1882976_1884380_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
>prophage 127
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1897821	1899174	5103562		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000469759.1|1897821_1899174_-	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.9	1.6e-06
>prophage 128
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1903838	1914314	5103562		Catovirus(20.0%)	8	NA	NA
WP_001295424.1|1903838_1904480_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
WP_001234767.1|1904571_1905153_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_001556113.1|1905174_1907028_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001300971.1|1907301_1908885_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_000978094.1|1909543_1910683_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000482901.1|1910688_1911132_+	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000137102.1|1911134_1913297_+	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_000654503.1|1913474_1914314_+	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	9.7e-07
>prophage 129
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1918557	1925351	5103562		Synechococcus_phage(25.0%)	6	NA	NA
WP_000048188.1|1918557_1919679_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	65.2	9.0e-133
WP_000043623.1|1919681_1920647_+	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	9.9e-88
WP_001298845.1|1920649_1921129_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000699714.1|1921125_1922349_+	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_000079285.1|1922351_1923788_+	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	1.3e-46
WP_001356294.1|1923980_1925351_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.5	1.7e-32
>prophage 130
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1930967	1934651	5103562		Klebsiella_phage(33.33%)	3	NA	NA
WP_024234392.1|1930967_1932362_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	3.7e-19
WP_000999466.1|1932519_1933515_+	N-acetyl-alpha-D-glucosaminyl-diphospho-ditrans, octacis-undecaprenol 4-epimerase	NA	A0A1V0QG29	Shearwaterpox_virus	26.3	1.9e-09
WP_000183060.1|1933757_1934651_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
>prophage 131
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1942333	1945155	5103562		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
WP_000043476.1|1942333_1943740_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.1e-37
WP_000704805.1|1943988_1945155_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.5	1.1e-114
>prophage 132
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1953841	1954741	5103562		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131782.1|1953841_1954741_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 133
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1961944	1963111	5103562		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000830156.1|1961944_1963111_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.2	2.9e-227
>prophage 134
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1980858	1982020	5103562	transposase	Acinetobacter_phage(100.0%)	1	NA	NA
WP_149025685.1|1980858_1982020_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
>prophage 135
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1991324	1991855	5103562		Escherichia_phage(100.0%)	1	NA	NA
WP_001079074.1|1991324_1991855_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
>prophage 136
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	1995399	2007871	5103562		Bacillus_phage(28.57%)	12	NA	NA
WP_001362894.1|1995399_1996071_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.6	3.1e-32
WP_000826741.1|1996070_1997429_+	heavy metal sensor histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.5	8.7e-05
WP_000218204.1|1997536_1998388_-	protein deglycase HchA	NA	NA	NA	NA	NA
WP_021499263.1|1998979_2000143_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	56.2	4.2e-109
WP_001313057.1|2000709_2001075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000365561.1|2001114_2001810_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.8e-07
WP_001157241.1|2001876_2003295_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	4.0e-101
WP_000786004.1|2003275_2003746_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
WP_001212248.1|2003734_2004655_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000922683.1|2004827_2005745_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_000009307.1|2005823_2006006_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_001349973.1|2006176_2007871_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
>prophage 137
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2021885	2022554	5103562		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000334622.1|2021885_2022554_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.9	6.2e-81
>prophage 138
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2034819	2035572	5103562		Bacillus_virus(100.0%)	1	NA	NA
WP_001273007.1|2034819_2035572_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-26
>prophage 139
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2051663	2053967	5103562	integrase,transposase	Ralstonia_phage(50.0%)	2	2045916:2045930	2056537:2056551
2045916:2045930	attL	TATCATTTTTAATAT	NA	NA	NA	NA
WP_073519601.1|2051663_2052788_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A221SAN4	Ralstonia_phage	27.9	1.2e-15
WP_085947772.1|2052753_2053967_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
2056537:2056551	attR	TATCATTTTTAATAT	NA	NA	NA	NA
>prophage 140
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2057374	2064149	5103562		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000998251.1|2057374_2058898_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	38.9	6.4e-89
WP_000248953.1|2058887_2060132_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_000779013.1|2060128_2060812_+	YecA family protein	NA	NA	NA	NA	NA
WP_001077332.1|2060864_2064149_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.6	3.6e-65
>prophage 141
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2069704	2071756	5103562		Synechococcus_phage(100.0%)	1	NA	NA
WP_000555091.1|2069704_2071756_+	sigma-70 family RNA polymerase sigma factor	NA	G8CLC7	Synechococcus_phage	35.3	6.5e-28
>prophage 142
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2086022	2087537	5103562		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001187810.1|2086022_2087537_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
>prophage 143
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2097624	2103268	5103562		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_001358497.1|2097624_2099286_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000483214.1|2099331_2100933_+	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.6	2.0e-16
WP_073519604.1|2100951_2101812_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000036378.1|2101814_2102864_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000763867.1|2102878_2103268_+	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
>prophage 144
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2108520	2110254	5103562	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_073519606.1|2108520_2110254_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
>prophage 145
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2116870	2118921	5103562		Synechococcus_phage(50.0%)	3	NA	NA
WP_000019588.1|2116870_2117614_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252980.1|2117654_2118050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000639274.1|2118102_2118921_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
>prophage 146
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2122939	2130003	5103562		Bacillus_virus(50.0%)	9	NA	NA
WP_001295503.1|2122939_2123461_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_073519607.1|2123462_2124065_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001386853.1|2124135_2124201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580328.1|2124339_2124951_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568519.1|2124959_2125970_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000571465.1|2126116_2126902_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000202996.1|2126898_2127654_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_001342995.1|2127732_2128665_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_001184045.1|2128680_2130003_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
>prophage 147
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2137466	2138594	5103562		Planktothrix_phage(100.0%)	1	NA	NA
WP_000741721.1|2137466_2138594_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	30.5	3.6e-20
>prophage 148
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2152170	2153646	5103562		Cyanophage(100.0%)	1	NA	NA
WP_000301727.1|2152170_2153646_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
>prophage 149
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2161701	2250349	5103562	portal,integrase,head,tRNA,transposase,holin,tail,capsid,terminase,protease,lysis	Escherichia_phage(44.44%)	107	2164900:2164915	2197553:2197568
WP_000944256.1|2161701_2162364_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000011652.1|2162387_2163044_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000916763.1|2163145_2163376_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000204699.1|2163514_2163889_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000879280.1|2163892_2164765_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000976492.1|2164777_2165119_+	YebY family protein	NA	NA	NA	NA	NA
2164900:2164915	attL	CGAAGAGGTGATGCTG	NA	NA	NA	NA
WP_001189091.1|2165511_2166588_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	51.7	5.3e-98
WP_001311878.1|2166553_2166835_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	41.2	1.7e-11
WP_001356607.1|2166941_2167130_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	97.9	1.6e-18
WP_042853000.1|2167122_2167317_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	7.6e-32
WP_000166317.1|2167373_2168183_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	6.8e-106
WP_021527613.1|2168175_2170809_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	58.1	2.9e-206
WP_001452559.1|2170907_2171183_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	92.3	3.7e-40
WP_001359121.1|2171257_2171428_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	92.9	7.9e-25
WP_073519610.1|2171427_2171649_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	93.2	1.3e-35
WP_001419881.1|2172178_2172373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000232638.1|2172338_2172557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000410105.1|2172856_2173276_-	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	60.6	3.1e-14
WP_001033914.1|2173372_2173615_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	62.1	2.3e-17
WP_000702025.1|2173611_2174034_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	94.3	3.4e-69
WP_073519611.1|2174111_2175242_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	65.5	2.5e-42
WP_073519612.1|2175248_2175995_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	80.9	2.1e-114
WP_073519613.1|2176017_2176779_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	2.8e-117
WP_073519614.1|2176794_2177217_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.2	6.3e-63
WP_073519615.1|2177213_2177414_+	hypothetical protein	NA	K7P729	Enterobacteria_phage	71.2	7.9e-16
WP_000797270.1|2177745_2177934_+	hypothetical protein	NA	Q286W7	Escherichia_phage	96.3	5.7e-24
WP_073528026.1|2177935_2178193_+	DUF4014 domain-containing protein	NA	A0A1I9LJM2	Stx_converting_phage	88.9	1.8e-28
WP_073519448.1|2178297_2179317_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_073519617.1|2179597_2180116_+	DUF551 domain-containing protein	NA	V5UT79	Shigella_phage	48.8	6.8e-35
WP_073519618.1|2180112_2180508_+	hypothetical protein	NA	A0A193GYM6	Enterobacter_phage	62.8	2.3e-38
WP_123006590.1|2180523_2180697_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	89.5	4.1e-21
WP_000018421.1|2180741_2180954_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	8.1e-27
WP_000119355.1|2181162_2181342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000818163.1|2181360_2181846_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_073519619.1|2181777_2181957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049281514.1|2182030_2182282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061892354.1|2182353_2182953_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	93.0	1.7e-106
WP_073519620.1|2182952_2183243_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	1.3e-46
WP_073519621.1|2183239_2183782_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	75.7	6.4e-76
WP_073519622.1|2185356_2185785_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_064768310.1|2187251_2187557_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_000284506.1|2187634_2187850_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_073519623.1|2187853_2188405_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	58.9	1.1e-43
WP_073519624.1|2188352_2188613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061892325.1|2188727_2189261_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	94.4	6.4e-97
WP_061892324.1|2189257_2189725_+|lysis	lysis protein	lysis	K7PH77	Enterobacteria_phage	98.7	7.2e-76
WP_061892323.1|2189712_2189865_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	94.0	1.2e-19
WP_073519626.1|2190176_2190656_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_061892169.1|2191284_2191833_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	86.3	6.5e-60
WP_095374683.1|2191762_2193733_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.2	3.2e-258
WP_061892171.1|2193716_2193920_+|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	55.7	9.5e-09
WP_061892172.1|2193916_2195509_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.5	3.4e-186
WP_073519628.1|2195498_2197004_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.4	2.9e-102
WP_061892174.1|2197040_2197388_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	57.0	2.2e-21
WP_073519629.1|2197445_2198474_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	5.9e-115
2197553:2197568	attR	CGAAGAGGTGATGCTG	NA	NA	NA	NA
WP_061892713.1|2198526_2198907_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	70.0	7.2e-34
WP_073519630.1|2198918_2199272_+|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	95.7	2.4e-60
WP_061892715.1|2199283_2199859_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	60.2	9.8e-51
WP_061892716.1|2199855_2200251_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	92.4	1.7e-65
WP_061892718.1|2200258_2200999_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	5.2e-129
WP_053294703.1|2201014_2201437_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.7	1.7e-60
WP_073519631.1|2201418_2201853_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	94.2	2.7e-61
WP_073519632.1|2201845_2204425_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	96.7	0.0e+00
WP_021528540.1|2204421_2204751_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	93.6	2.1e-53
WP_001152619.1|2204750_2205449_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
WP_073519633.1|2205454_2206198_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	1.2e-146
WP_073519634.1|2206828_2210242_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	96.2	0.0e+00
WP_001233071.1|2210312_2210912_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.5	4.4e-110
WP_077897941.1|2210976_2212146_+	hypothetical protein	NA	Q9LA62	Enterobacterial_phage	64.1	1.4e-32
WP_077898153.1|2212129_2212696_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	42.2	1.4e-28
WP_061892726.1|2212688_2213072_+	DUF1353 domain-containing protein	NA	A0A0A8J9K3	Ralstonia_phage	41.1	1.3e-14
WP_077897940.1|2213357_2213540_+	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_000812724.1|2215439_2216096_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
WP_001296140.1|2216096_2216288_-	YebW family protein	NA	NA	NA	NA	NA
WP_001295499.1|2216392_2216629_-	DUF1480 family protein	NA	NA	NA	NA	NA
WP_000057022.1|2216746_2218186_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001299674.1|2218265_2220899_-	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_001207284.1|2220867_2222151_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_073519635.1|2222280_2222778_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_000431370.1|2222874_2223573_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001326055.1|2223592_2225641_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.3	1.2e-85
WP_000984517.1|2225832_2226714_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001127216.1|2226759_2228133_-	MFS transporter	NA	NA	NA	NA	NA
WP_001262174.1|2228309_2229101_+	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_001211011.1|2229243_2229483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000714550.1|2229641_2229785_+	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_001006865.1|2229859_2230147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295496.1|2230816_2230960_+	YobF family protein	NA	NA	NA	NA	NA
WP_001062678.1|2230972_2231182_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_000010129.1|2231347_2232157_+	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_001296134.1|2232153_2232720_-	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_073519636.1|2233149_2233608_-	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_000228655.1|2233662_2234514_-	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_000406926.1|2234526_2235327_-	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_000150543.1|2235389_2236361_-	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_053898130.1|2236823_2238380_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.8	6.0e-42
WP_001295494.1|2238383_2239982_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_000624298.1|2240112_2241477_-	L-serine dehydratase 1	NA	NA	NA	NA	NA
WP_000456725.1|2241660_2242239_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_000854972.1|2242242_2243604_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	3.4e-41
WP_000457334.1|2243677_2243857_+	YoaH family protein	NA	NA	NA	NA	NA
WP_001307845.1|2243976_2244336_-	DUF1889 family protein	NA	NA	NA	NA	NA
WP_001295493.1|2244698_2245043_-	RidA family protein	NA	NA	NA	NA	NA
WP_000128847.1|2245174_2247085_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001220965.1|2247142_2247838_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000290576.1|2247877_2248459_+	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_000758422.1|2248663_2250349_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
>prophage 150
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2259251	2260899	5103562	transposase	Helicobacter_phage(50.0%)	2	NA	NA
WP_049090741.1|2259251_2259683_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	57.7	1.8e-41
WP_073519638.1|2259690_2260899_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.0	1.4e-203
>prophage 151
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2266849	2271426	5103562		Bacillus_phage(100.0%)	3	NA	NA
WP_073519639.1|2266849_2268340_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	1.1e-08
WP_000616424.1|2268520_2269996_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000219686.1|2270142_2271426_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
>prophage 152
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2274744	2275599	5103562		Indivirus(100.0%)	1	NA	NA
WP_001186343.1|2274744_2275599_+	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	1.5e-10
>prophage 153
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2278842	2279484	5103562		Tupanvirus(100.0%)	1	NA	NA
WP_001135062.1|2278842_2279484_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	2.9e-19
>prophage 154
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2284410	2286372	5103562		Streptococcus_phage(100.0%)	1	NA	NA
WP_001235796.1|2284410_2286372_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	4.1e-40
>prophage 155
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2291970	2292624	5103562		Planktothrix_phage(100.0%)	1	NA	NA
WP_001299207.1|2291970_2292624_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.2	8.4e-14
>prophage 156
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2299388	2300609	5103562		Klosneuvirus(100.0%)	1	NA	NA
WP_000081983.1|2299388_2300609_+	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	5.5e-27
>prophage 157
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2308085	2308913	5103562		Bacillus_virus(100.0%)	1	NA	NA
WP_000175037.1|2308085_2308913_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	2.0e-73
>prophage 158
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2328604	2348197	5103562	tRNA	Tupanvirus(22.22%)	19	NA	NA
WP_001144190.1|2328604_2330533_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	5.5e-130
WP_001700733.1|2330536_2331079_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001124225.1|2331175_2331373_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|2331425_2331782_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001299131.1|2331908_2332043_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000018588.1|2332231_2333215_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_000672342.1|2333229_2335617_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229265.1|2335621_2335921_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000956529.1|2336021_2337002_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001154183.1|2337064_2337616_+	glutathione peroxidase	NA	NA	NA	NA	NA
WP_000029466.1|2337615_2338365_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001209785.1|2338442_2338907_+	endopeptidase	NA	S5MM68	Bacillus_phage	36.9	2.1e-11
WP_001299570.1|2339153_2339867_+	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_000175615.1|2339929_2341366_+	YdiU family protein	NA	NA	NA	NA	NA
WP_001270809.1|2341369_2341561_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_001082204.1|2341692_2342739_-	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_000368046.1|2342895_2343729_-	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_000069375.1|2344061_2346440_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	9.4e-172
WP_000553715.1|2346496_2348197_-	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.3	8.0e-32
>prophage 159
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2366788	2371872	5103562		Lake_Baikal_phage(33.33%)	5	NA	NA
WP_000367160.1|2366788_2367157_+	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	4.3e-15
WP_001297388.1|2367165_2368653_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000948878.1|2368662_2369409_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	32.0	2.9e-10
WP_000908012.1|2369383_2370655_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000144575.1|2370651_2371872_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	4.4e-93
>prophage 160
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2380162	2382429	5103562		Escherichia_phage(50.0%)	3	NA	NA
WP_001349911.1|2380162_2380831_+	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	1.0e-22
WP_001069997.1|2380827_2381613_+	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_000587560.1|2381616_2382429_+	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
>prophage 161
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2387933	2396725	5103562		Orpheovirus(20.0%)	9	NA	NA
WP_000493947.1|2387933_2388575_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
WP_000098911.1|2388614_2389763_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.7	4.2e-85
WP_001182362.1|2390053_2391265_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000269501.1|2391377_2392310_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000190982.1|2392306_2393332_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000102278.1|2393630_2393720_+	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000701040.1|2393885_2395055_+	MFS transporter	NA	NA	NA	NA	NA
WP_000007283.1|2395200_2395782_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000101193.1|2395909_2396725_-	C40 family peptidase	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
>prophage 162
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2405528	2407027	5103562		Indivirus(50.0%)	2	NA	NA
WP_000250656.1|2405528_2406425_+	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	4.7e-07
WP_001296937.1|2406505_2407027_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
>prophage 163
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2413938	2415213	5103562	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001378963.1|2413938_2415213_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.1	2.0e-83
>prophage 164
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2435095	2436907	5103562		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945878.1|2435095_2436907_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	100.0	0.0e+00
>prophage 165
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2446802	2448104	5103562		Bacillus_phage(100.0%)	1	NA	NA
WP_000732497.1|2446802_2448104_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	4.2e-17
>prophage 166
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2465864	2481302	5103562		Escherichia_phage(44.44%)	15	NA	NA
WP_000148710.1|2465864_2466479_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526492.1|2466521_2467376_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2467377_2467995_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001433342.1|2468005_2470429_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	2.8e-208
WP_073519650.1|2470489_2472916_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.8	6.5e-213
WP_001307224.1|2473114_2473420_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|2473527_2474238_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2474240_2474801_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|2474835_2475177_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2475311_2475638_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|2475843_2477058_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836054.1|2477069_2478089_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	7.4e-17
WP_000151243.1|2478146_2479514_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527756.1|2479602_2481063_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	30.1	8.6e-43
WP_000214712.1|2481098_2481302_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 167
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2486668	2487559	5103562		Bacillus_phage(100.0%)	1	NA	NA
WP_000592814.1|2486668_2487559_+	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	8.2e-20
>prophage 168
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2495063	2497193	5103562		Pandoravirus(50.0%)	3	NA	NA
WP_073519652.1|2495063_2496503_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	27.1	6.3e-30
WP_000803659.1|2496559_2496778_-	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000091199.1|2496809_2497193_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
>prophage 169
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2504937	2506356	5103562		Bacillus_phage(100.0%)	1	NA	NA
WP_000558050.1|2504937_2506356_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
>prophage 170
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2514237	2515773	5103562		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001194907.1|2514237_2515773_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	9.8e-21
>prophage 171
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2530416	2531442	5103562		Ralstonia_phage(100.0%)	1	NA	NA
WP_001007923.1|2530416_2531442_+	membrane protein	NA	A0A097ZIG6	Ralstonia_phage	27.5	7.2e-12
>prophage 172
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2546362	2553298	5103562		Bacillus_phage(50.0%)	3	NA	NA
WP_001296749.1|2546362_2548048_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.5	1.7e-10
WP_000832441.1|2548085_2550458_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_001307214.1|2550502_2553298_+	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	24.0	3.4e-19
>prophage 173
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2558572	2562379	5103562		Bacillus_virus(50.0%)	2	NA	NA
WP_000426266.1|2558572_2559955_+	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
WP_001307211.1|2559979_2562379_+	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
>prophage 174
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2566695	2568601	5103562		Planktothrix_phage(100.0%)	2	NA	NA
WP_000193562.1|2566695_2567682_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	1.4e-17
WP_000072429.1|2567674_2568601_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.6	1.2e-13
>prophage 175
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2571875	2573317	5103562		Tupanvirus(50.0%)	2	NA	NA
WP_000642407.1|2571875_2572886_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	9.6e-25
WP_000781370.1|2573032_2573317_+	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
>prophage 176
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2579329	2579620	5103562		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001295648.1|2579329_2579620_+	hypothetical protein	NA	Q1MVN1	Enterobacteria_phage	65.1	2.7e-25
>prophage 177
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2586505	2588050	5103562		Escherichia_phage(100.0%)	1	NA	NA
WP_000702560.1|2586505_2588050_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 178
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2594457	2600841	5103562		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_073519661.1|2594457_2598666_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.3	4.1e-21
WP_000103411.1|2598732_2600841_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.0	1.3e-26
>prophage 179
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2605748	2614351	5103562	transposase	Salmonella_phage(33.33%)	10	NA	NA
WP_000689303.1|2605748_2607851_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	66.2	9.6e-136
WP_001296777.1|2607886_2608552_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000531452.1|2608749_2609787_-	NADPH-dependent curcumin/dihydrocurcumin reductase	NA	NA	NA	NA	NA
WP_000027563.1|2609967_2610486_+	L-methionine sulfoximine/L-methionine sulfone acetyltransferase	NA	NA	NA	NA	NA
WP_001076526.1|2610482_2610695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123006594.1|2610739_2612084_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.3	4.6e-75
WP_000018633.1|2612357_2612591_-	YdcY family protein	NA	NA	NA	NA	NA
WP_149025691.1|2612676_2612850_-	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
WP_001303494.1|2613044_2613140_+	stress response membrane protein YncL	NA	NA	NA	NA	NA
WP_073519662.1|2613541_2614351_-	CatB-related O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	40.4	2.2e-16
>prophage 180
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2617732	2627884	5103562	transposase	Mycoplasma_phage(25.0%)	9	NA	NA
WP_000220396.1|2617732_2618746_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
WP_000047424.1|2618763_2619909_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000760591.1|2620150_2621560_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_001270286.1|2621638_2622055_-	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_000494244.1|2622476_2622707_+	YncJ family protein	NA	NA	NA	NA	NA
WP_001307191.1|2622798_2624760_-	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.9	7.1e-24
WP_000429155.1|2624832_2625369_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071608019.1|2625421_2626636_+	BenE family transporter YdcO	NA	NA	NA	NA	NA
WP_000826403.1|2626675_2627884_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.5	1.5e-205
>prophage 181
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2639686	2640635	5103562		Moraxella_phage(50.0%)	2	NA	NA
WP_073519665.1|2639686_2639860_-	hypothetical protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	3.4e-07
WP_001307188.1|2640104_2640635_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
>prophage 182
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2644573	2648476	5103562		Klosneuvirus(100.0%)	1	NA	NA
WP_000139612.1|2644573_2648476_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 183
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2679762	2680752	5103562		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762229.1|2679762_2680752_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 184
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2685712	2692982	5103562	tRNA	Enterobacteria_phage(20.0%)	6	NA	NA
WP_000837924.1|2685712_2686846_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_001082294.1|2686986_2687421_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
WP_000081418.1|2687596_2688532_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.7	1.1e-144
WP_073519666.1|2688660_2690034_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.9	6.6e-53
WP_000387395.1|2690511_2691495_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_073519863.1|2691749_2692982_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 185
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2699308	2699824	5103562		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945013.1|2699308_2699824_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.8e-24
>prophage 186
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2718004	2719087	5103562		Planktothrix_phage(100.0%)	1	NA	NA
WP_000057978.1|2718004_2719087_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	5.6e-23
>prophage 187
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2733091	2734357	5103562		Klosneuvirus(100.0%)	1	NA	NA
WP_000069228.1|2733091_2734357_-	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.0	4.6e-24
>prophage 188
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2747272	2752930	5103562		Bacillus_virus(50.0%)	5	NA	NA
WP_000573407.1|2747272_2748079_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
WP_000968850.1|2748146_2748500_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_000506490.1|2748867_2749656_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_001358441.1|2749800_2750928_+	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_000484982.1|2750995_2752930_+	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.9	3.1e-32
>prophage 189
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2760743	2761334	5103562		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|2760743_2761334_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 190
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2766257	2771549	5103562	protease	Tupanvirus(33.33%)	4	NA	NA
WP_001297122.1|2766257_2768855_-	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.7e-86
WP_001031530.1|2769234_2769486_+	YciN family protein	NA	NA	NA	NA	NA
WP_073519670.1|2769521_2770571_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	30.9	3.9e-21
WP_000559281.1|2770790_2771549_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	24.5	4.4e-06
>prophage 191
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2776481	2779439	5103562		Acinetobacter_phage(100.0%)	2	NA	NA
WP_000763511.1|2776481_2778077_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001344826.1|2778080_2779439_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
>prophage 192
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2791097	2793112	5103562		Bacillus_virus(50.0%)	2	NA	NA
WP_000994905.1|2791097_2792102_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
WP_000110945.1|2792098_2793112_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
>prophage 193
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2801522	2811652	5103562		Citrobacter_phage(25.0%)	10	NA	NA
WP_000068079.1|2801522_2802140_-	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.3e-53
WP_001287378.1|2802744_2803158_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000718995.1|2803301_2804210_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_000193437.1|2804411_2805425_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_001226476.1|2805516_2806422_-	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_001307143.1|2806534_2806993_+	YchJ family protein	NA	NA	NA	NA	NA
WP_000555849.1|2807042_2807885_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001160110.1|2808729_2809407_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000571699.1|2809406_2810117_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_000702660.1|2810113_2811652_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
>prophage 194
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2822783	2829052	5103562		Spodoptera_litura_granulovirus(33.33%)	8	NA	NA
WP_001146444.1|2822783_2823014_-	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	8.5e-06
WP_001295620.1|2823283_2824384_+	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_000170963.1|2824788_2824896_+	small toxic polypeptide LdrB	NA	NA	NA	NA	NA
WP_000811065.1|2825044_2825899_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
WP_001257044.1|2825934_2826744_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_073519672.1|2826747_2827140_-	SirB family protein	NA	NA	NA	NA	NA
WP_000456467.1|2827136_2827970_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000804726.1|2827969_2829052_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
>prophage 195
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2832188	2834940	5103562		Tupanvirus(50.0%)	2	NA	NA
WP_001298109.1|2832188_2833136_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033352.1|2833260_2834940_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
>prophage 196
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2854043	2855388	5103562	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_123006594.1|2854043_2855388_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.3	4.6e-75
>prophage 197
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2863032	2864720	5103562		Salmonella_phage(50.0%)	2	NA	NA
WP_000457616.1|2863032_2864301_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	83.4	7.9e-210
WP_000897378.1|2864300_2864720_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
>prophage 198
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2873254	2875576	5103562		Escherichia_phage(100.0%)	1	NA	NA
WP_001307136.1|2873254_2875576_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	42.8	1.5e-89
>prophage 199
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2881443	2885172	5103562		Enterobacteria_phage(66.67%)	5	NA	NA
WP_000332303.1|2881443_2882175_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
WP_000373101.1|2882395_2882800_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_032141808.1|2882852_2882963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001325741.1|2883495_2883819_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	1.0e-41
WP_000444487.1|2883921_2885172_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
>prophage 200
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2888308	2889679	5103562		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_073519675.1|2888308_2889679_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
>prophage 201
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2894799	2896777	5103562		Mycoplasma_phage(100.0%)	2	NA	NA
WP_000531594.1|2894799_2895936_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799401.1|2895919_2896777_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
>prophage 202
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2900053	2903776	5103562		Vibrio_phage(50.0%)	4	NA	NA
WP_000952736.1|2900053_2900875_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_000291270.1|2900890_2901802_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_001251348.1|2901830_2903075_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_001033694.1|2903074_2903776_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.1e-35
>prophage 203
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2911065	2911323	5103562		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|2911065_2911323_-	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 204
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2923629	2925272	5103562		Streptococcus_virus(50.0%)	2	NA	NA
WP_001267931.1|2923629_2924634_-	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
WP_001257000.1|2924630_2925272_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
>prophage 205
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2928544	2929726	5103562		Ralstonia_phage(50.0%)	2	NA	NA
WP_000103754.1|2928544_2928781_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
WP_001008535.1|2928991_2929726_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
>prophage 206
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2942084	2943026	5103562		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001295441.1|2942084_2943026_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 207
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2958907	2959153	5103562		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|2958907_2959153_+	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 208
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2963815	2964736	5103562		Morganella_phage(100.0%)	1	NA	NA
WP_000183364.1|2963815_2964736_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 209
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2974044	2974578	5103562		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857399.1|2974044_2974578_-	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	7.8e-26
>prophage 210
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2978712	2979546	5103562		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|2978712_2979546_+	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 211
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2984597	2987159	5103562	transposase	Acinetobacter_phage(50.0%)	2	NA	NA
WP_085947598.1|2984597_2985759_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_000409883.1|2985800_2987159_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.2	1.9e-20
>prophage 212
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	2993978	2994902	5103562		Cronobacter_phage(100.0%)	1	NA	NA
WP_001295604.1|2993978_2994902_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.2	4.1e-91
>prophage 213
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3009678	3013311	5103562		Enterobacteria_phage(75.0%)	4	NA	NA
WP_001028105.1|3009678_3010173_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	96.9	4.2e-50
WP_001504154.1|3010193_3011522_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.2	1.4e-230
WP_001273658.1|3011604_3011778_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_073519682.1|3012762_3013311_+	recombinase family protein	NA	G8I4U3	Mycobacterium_phage	36.1	4.5e-21
>prophage 214
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3018641	3023366	5103562		Salmonella_phage(33.33%)	3	NA	NA
WP_073519686.1|3018641_3020765_+	tape measure protein	NA	A0A0D4DAK9	Salmonella_phage	24.5	1.8e-44
WP_073519687.1|3020929_3021703_+	hypothetical protein	NA	A0A0F6TIY9	Escherichia_coli_O157_typing_phage	79.9	2.6e-91
WP_073519688.1|3021722_3023366_-	recombinase family protein	NA	A0A142LP20	Marinitoga_camini_virus	24.1	8.6e-07
>prophage 215
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3027357	3033812	5103562		Klosneuvirus(33.33%)	6	NA	NA
WP_000420629.1|3027357_3028278_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	3.2e-11
WP_000024561.1|3028277_3028583_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000209854.1|3028675_3029275_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_001062102.1|3029271_3031818_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.2	5.9e-71
WP_001230242.1|3031817_3032990_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001120112.1|3033119_3033812_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
>prophage 216
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3039399	3039612	5103562		Morganella_phage(100.0%)	1	NA	NA
WP_000066490.1|3039399_3039612_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
>prophage 217
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3053937	3101270	5103562	portal,integrase,head,protease,tail,capsid,holin,terminase	Escherichia_phage(50.0%)	61	3099124:3099139	3101955:3101970
WP_000003671.1|3053937_3054525_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_073519691.1|3054521_3055229_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_001504149.1|3055247_3057041_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001058323.1|3057037_3058156_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_073519868.1|3059722_3060106_-	DUF1353 domain-containing protein	NA	A0A0A8J9K3	Ralstonia_phage	42.1	3.4e-15
WP_077898154.1|3060098_3060665_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	42.2	2.3e-28
WP_073519693.1|3061883_3062483_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	93.0	9.4e-105
WP_073519694.1|3062550_3065934_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	87.0	0.0e+00
WP_073519695.1|3065994_3066630_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	74.9	1.7e-83
WP_073519869.1|3066527_3067271_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	93.9	6.8e-145
WP_073519696.1|3067276_3067975_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	96.6	2.4e-131
WP_001330090.1|3067974_3068331_-|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_073519697.1|3068308_3071536_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	93.5	0.0e+00
WP_077871790.1|3071582_3071843_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	96.5	7.8e-40
WP_077693997.1|3071884_3072271_-|tail	phage tail protein	tail	A0A1B5FP91	Escherichia_phage	95.9	7.0e-61
WP_059215647.1|3072270_3072975_-	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	95.7	1.9e-117
WP_073519698.1|3073035_3073380_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	96.5	8.8e-55
WP_073519699.1|3073376_3073826_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	79.9	3.0e-63
WP_001147815.1|3073822_3074161_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	91.1	1.2e-51
WP_065228207.1|3074169_3074487_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	51.5	4.8e-23
WP_073519700.1|3074531_3075758_-|capsid	phage major capsid protein	capsid	Q8W627	Enterobacteria_phage	99.1	1.1e-187
WP_001193625.1|3075771_3076422_-|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	100.0	6.0e-121
WP_073519701.1|3076399_3077641_-|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	94.7	3.6e-231
WP_069904030.1|3077640_3077823_-	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	81.7	4.8e-20
WP_001140897.1|3077834_3079592_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.5	0.0e+00
WP_038354741.1|3079591_3080074_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	99.4	2.7e-86
WP_001140099.1|3080220_3080571_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	98.3	1.2e-64
WP_073519702.1|3080578_3080779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073519703.1|3080865_3081168_-	hypothetical protein	NA	Q8HA83	Salmonella_phage	86.0	3.8e-46
WP_001542813.1|3081250_3081547_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	98.0	1.5e-50
WP_073519704.1|3081918_3082296_-	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	96.8	2.5e-63
WP_073519705.1|3082298_3082574_-|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	92.3	1.7e-40
WP_001351476.1|3082563_3082956_-|holin	holin	holin	Q8W636	Enterobacteria_phage	96.9	1.0e-54
WP_073519706.1|3084233_3084923_-	antiterminator	NA	I6PDF8	Cronobacter_phage	50.2	1.4e-59
WP_073519707.1|3084919_3085279_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	68.4	1.4e-39
WP_073519708.1|3085291_3086338_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.0	5.0e-109
WP_073519709.1|3086630_3086891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073519710.1|3087111_3087324_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	84.3	5.1e-21
WP_073519711.1|3087535_3087931_-	hypothetical protein	NA	A0A193GYM6	Enterobacter_phage	60.5	1.6e-36
WP_073519712.1|3087930_3088596_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	48.9	1.0e-51
WP_073519713.1|3088592_3088802_-	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	91.3	3.7e-32
WP_095374666.1|3088803_3089316_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	64.1	1.7e-38
WP_073519714.1|3089317_3089920_-	ead/Ea22-like family protein	NA	A0A0F6R7P8	Escherichia_coli_O157_typing_phage	72.3	3.1e-55
WP_077897935.1|3090360_3090717_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.4e-58
WP_073519871.1|3090774_3091170_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	54.3	2.4e-32
WP_001469653.1|3091199_3091622_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.6	1.2e-77
WP_123006575.1|3091653_3092694_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	1.0e-90
WP_073519717.1|3092665_3093217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476986.1|3093200_3093428_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003379.1|3093505_3093913_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	7.2e-24
WP_123006576.1|3094241_3094442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001171942.1|3094534_3094753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073519719.1|3094775_3095183_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	40.0	3.0e-09
WP_000920491.1|3095160_3095394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123006577.1|3095387_3095555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449196.1|3095955_3096144_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_073519720.1|3096140_3096332_+	YebW family protein	NA	NA	NA	NA	NA
WP_073519721.1|3096425_3098897_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	59.1	2.2e-59
WP_021564129.1|3098963_3099215_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
3099124:3099139	attL	CAGCAATGTCGAAAGT	NA	NA	NA	NA
WP_073519722.1|3099183_3100203_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.4	4.9e-85
WP_000375136.1|3100610_3101270_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
3101955:3101970	attR	ACTTTCGACATTGCTG	NA	NA	NA	NA
>prophage 218
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3105503	3107558	5103562		Bacillus_phage(100.0%)	1	NA	NA
WP_000420533.1|3105503_3107558_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	7.7e-21
>prophage 219
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3120157	3122065	5103562		Tupanvirus(100.0%)	1	NA	NA
WP_000053089.1|3120157_3122065_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.4e-53
>prophage 220
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3137986	3149119	5103562	tRNA	Bacillus_virus(20.0%)	8	NA	NA
WP_073519725.1|3137986_3138754_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	3.4e-30
WP_000193844.1|3138960_3141573_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	7.0e-19
WP_001297200.1|3141838_3143041_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000117881.1|3143209_3144610_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_000977920.1|3145211_3146300_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000462687.1|3146484_3147675_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_001109487.1|3147896_3148544_-	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_001295932.1|3148570_3149119_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
>prophage 221
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3163824	3168365	5103562		Bacillus_phage(100.0%)	3	NA	NA
WP_000551270.1|3163824_3165573_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_000705706.1|3165609_3167874_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|3168080_3168365_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
>prophage 222
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3173451	3174540	5103562		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057149.1|3173451_3174540_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
>prophage 223
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3178638	3181853	5103562		Tetraselmis_virus(100.0%)	2	NA	NA
WP_001292815.1|3178638_3180921_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.3e-162
WP_000111043.1|3181112_3181853_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
>prophage 224
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3188163	3211922	5103562	tRNA,protease	Escherichia_phage(16.67%)	16	NA	NA
WP_000213101.1|3188163_3188781_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000850306.1|3188791_3191236_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000886683.1|3191474_3192767_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_073519730.1|3192857_3194201_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	1.6e-80
WP_001295343.1|3194211_3194823_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077016.1|3194977_3199045_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|3199179_3199674_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|3200218_3201184_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043587.1|3201306_3203073_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001202188.1|3203073_3204795_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	1.9e-20
WP_001241678.1|3204836_3205541_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3205825_3206044_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934053.1|3206728_3209005_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|3209035_3209356_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|3209678_3209903_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188194.1|3209975_3211922_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	5.0e-38
>prophage 225
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3221219	3222938	5103562		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815362.1|3221219_3222938_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	5.2e-31
>prophage 226
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3226525	3229263	5103562		Roseobacter_phage(50.0%)	4	NA	NA
WP_001255144.1|3226525_3227356_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160737.1|3227352_3227676_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270735.1|3227801_3228317_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|3228534_3229263_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
>prophage 227
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3232600	3241751	5103562		Streptococcus_phage(25.0%)	11	NA	NA
WP_001149734.1|3232600_3233728_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.3	4.6e-28
WP_000389260.1|3233768_3234257_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061657.1|3234316_3235162_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_001093858.1|3235158_3236112_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000995994.1|3236121_3237255_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.9e-29
WP_000126072.1|3237349_3238462_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|3238813_3239290_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|3239377_3240280_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000189152.1|3240340_3241063_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201560.1|3241046_3241334_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195240.1|3241493_3241751_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
>prophage 228
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3250317	3251520	5103562		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000195961.1|3250317_3251520_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
>prophage 229
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3262854	3264726	5103562		Planktothrix_phage(100.0%)	1	NA	NA
WP_073519733.1|3262854_3264726_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	4.0e-16
>prophage 230
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3267953	3272084	5103562		Synechococcus_phage(50.0%)	3	NA	NA
WP_001351540.1|3267953_3268616_-	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	33.2	1.6e-25
WP_001307076.1|3268746_3269646_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_000209359.1|3269651_3272084_+	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
>prophage 231
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3275976	3277569	5103562		Tupanvirus(100.0%)	1	NA	NA
WP_000961458.1|3275976_3277569_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
>prophage 232
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3282566	3287791	5103562		Escherichia_phage(33.33%)	6	NA	NA
WP_001295296.1|3282566_3283082_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
WP_120795379.1|3283134_3283200_-	protein YliM	NA	NA	NA	NA	NA
WP_073519734.1|3284620_3285124_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_000843866.1|3285527_3286274_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_001159065.1|3286412_3287072_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000569080.1|3287068_3287791_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
>prophage 233
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3291331	3306143	5103562		Erwinia_phage(14.29%)	13	NA	NA
WP_000710619.1|3291331_3291592_+	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
WP_000430075.1|3291856_3294139_+	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000990177.1|3294180_3294858_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
WP_000146343.1|3294931_3295198_+	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
WP_000849301.1|3295462_3295723_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_073519735.1|3295951_3297037_-	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000386551.1|3297177_3298140_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_001340191.1|3298167_3300318_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	3.7e-42
WP_001145128.1|3300437_3300920_+	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.7	1.5e-36
WP_000007102.1|3301151_3302516_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001296991.1|3302744_3303416_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_001296990.1|3303418_3304414_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_000996099.1|3304406_3306143_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
>prophage 234
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3316740	3317649	5103562		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295302.1|3316740_3317649_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
>prophage 235
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3324130	3325420	5103562		Klosneuvirus(100.0%)	1	NA	NA
WP_001389241.1|3324130_3325420_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.9	3.8e-18
>prophage 236
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3335775	3342351	5103562		Planktothrix_phage(33.33%)	7	NA	NA
WP_000891683.1|3335775_3336834_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.7	2.6e-20
WP_000604032.1|3336836_3337526_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000113005.1|3337525_3338299_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000891515.1|3338465_3338615_-	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_001147439.1|3338743_3339532_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000096903.1|3339599_3341072_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	29.5	3.6e-12
WP_001265443.1|3341334_3342351_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	1.0e-79
>prophage 237
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3346705	3350225	5103562		Klebsiella_phage(33.33%)	4	NA	NA
WP_001109196.1|3346705_3347758_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	3.4e-81
WP_073519738.1|3348073_3348454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000951292.1|3348567_3349509_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	2.2e-23
WP_000345410.1|3349505_3350225_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	9.2e-22
>prophage 238
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3386263	3387055	5103562		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114025.1|3386263_3387055_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	28.8	3.7e-08
>prophage 239
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3390433	3393375	5103562		Acinetobacter_phage(50.0%)	2	NA	NA
WP_001032700.1|3390433_3391915_+	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.0	5.5e-45
WP_000628039.1|3391956_3393375_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.4	6.8e-61
>prophage 240
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3397838	3410560	5103562		uncultured_Caudovirales_phage(25.0%)	8	NA	NA
WP_073519743.1|3397838_3402032_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.9	9.5e-26
WP_000424924.1|3402275_3402482_-	YbfA family protein	NA	NA	NA	NA	NA
WP_001272653.1|3402794_3402884_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000741137.1|3402883_3404557_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_000087969.1|3404579_3406628_+	potassium-transporting ATPase subunit KdpB	NA	E4ZFI9	Streptococcus_phage	28.6	3.4e-37
WP_001324645.1|3406636_3407209_+	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_001324644.1|3407201_3409886_+	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.8	5.0e-12
WP_000186103.1|3409882_3410560_+	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	31.1	8.9e-27
>prophage 241
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3417215	3417980	5103562		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000773279.1|3417215_3417980_+	esterase	NA	A0A1J0GNR5	Mycobacterium_phage	31.5	2.9e-05
>prophage 242
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3422130	3425944	5103562	tRNA	Escherichia_phage(50.0%)	2	NA	NA
WP_001287154.1|3422130_3423795_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.1	0.0e+00
WP_001023104.1|3423997_3425944_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
>prophage 243
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3430570	3432235	5103562		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337066.1|3430570_3432235_+	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.3	6.1e-85
>prophage 244
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3436331	3437411	5103562		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000490838.1|3436331_3437411_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 245
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3445307	3446033	5103562		Planktothrix_phage(100.0%)	1	NA	NA
WP_000631384.1|3445307_3446033_+	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
>prophage 246
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3455778	3458361	5103562	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001157890.1|3455778_3458361_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.3	5.2e-184
>prophage 247
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3465371	3467811	5103562		Synechococcus_phage(50.0%)	2	NA	NA
WP_001231428.1|3465371_3466460_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
WP_001092082.1|3466599_3467811_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
>prophage 248
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3472626	3473274	5103562		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_000939738.1|3472626_3473010_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
WP_000034825.1|3473064_3473274_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
>prophage 249
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3488699	3490814	5103562		Morganella_phage(50.0%)	2	NA	NA
WP_000278505.1|3488699_3489128_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
WP_000887629.1|3489248_3490814_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
>prophage 250
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3493923	3495746	5103562		Streptococcus_phage(50.0%)	2	NA	NA
WP_000029802.1|3493923_3495144_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	33.0	1.2e-58
WP_000502941.1|3495116_3495746_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	2.9e-56
>prophage 251
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3510292	3516335	5103562		Klosneuvirus(50.0%)	3	NA	NA
WP_000140647.1|3510292_3511108_+	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
WP_073519748.1|3511104_3512238_-	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_073519749.1|3512453_3516335_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.2	1.1e-60
>prophage 252
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3527764	3530908	5103562		Leptospira_phage(100.0%)	1	NA	NA
WP_000573951.1|3527764_3530908_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.0	2.2e-59
>prophage 253
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3534053	3544184	5103562		Bacillus_phage(33.33%)	5	NA	NA
WP_000770941.1|3534053_3534737_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	34.7	2.3e-30
WP_000253830.1|3534726_3536175_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	NA	NA	NA	NA
WP_000103231.1|3536911_3538813_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.7	3.0e-27
WP_001160804.1|3538840_3539302_+	DcrB-related protein	NA	NA	NA	NA	NA
WP_047656454.1|3539321_3544184_+	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.0	6.9e-20
>prophage 254
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3560517	3563648	5103562	tRNA	Enterococcus_phage(50.0%)	4	NA	NA
WP_000729160.1|3560517_3561384_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|3561385_3561598_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143552.1|3561705_3562227_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912345.1|3562262_3563648_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 255
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3575068	3576214	5103562		Streptococcus_phage(100.0%)	1	NA	NA
WP_001315307.1|3575068_3576214_-	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.1e-48
>prophage 256
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3583848	3585630	5103562		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_001096878.1|3583848_3585630_-	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.1	2.1e-38
>prophage 257
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3590887	3598617	5103562		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_073519754.1|3590887_3595090_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.0	1.1e-21
WP_073519755.1|3595519_3597934_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001110573.1|3597930_3598617_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
>prophage 258
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3601753	3602431	5103562		Bacillus_virus(100.0%)	1	NA	NA
WP_001157535.1|3601753_3602431_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	2.4e-27
>prophage 259
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3606970	3610031	5103562		uncultured_virus(50.0%)	2	NA	NA
WP_000083962.1|3606970_3609475_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	3.8e-115
WP_001437645.1|3609689_3610031_-	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	73.6	3.9e-39
>prophage 260
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3618275	3626733	5103562		Acanthamoeba_polyphaga_moumouvirus(25.0%)	8	NA	NA
WP_000801838.1|3618275_3619235_+	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.7	2.9e-15
WP_001250120.1|3619231_3620194_-	ferrochelatase	NA	NA	NA	NA	NA
WP_000261609.1|3620325_3621030_-	adenylate kinase	NA	NA	NA	NA	NA
WP_000678201.1|3621150_3623025_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_001195025.1|3623134_3623740_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_000467098.1|3623739_3624069_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_000122008.1|3624121_3626053_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000127356.1|3626181_3626733_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
>prophage 261
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3633741	3636891	5103562		Leptospira_phage(100.0%)	1	NA	NA
WP_001132469.1|3633741_3636891_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 262
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3645726	3649273	5103562		Bacillus_phage(100.0%)	2	NA	NA
WP_073519756.1|3645726_3647508_-	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.3	1.4e-42
WP_001235609.1|3647500_3649273_-	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	2.6e-49
>prophage 263
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3652596	3653292	5103562		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817227.1|3652596_3653292_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
>prophage 264
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3656432	3661479	5103562	protease	Bacillus_phage(25.0%)	4	NA	NA
WP_001043542.1|3656432_3656705_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
WP_001295325.1|3656913_3659268_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_000130305.1|3659455_3660730_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_000122253.1|3660855_3661479_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 265
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3685185	3694166	5103562	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_001021161.1|3685185_3685656_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
WP_001150470.1|3685744_3686848_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.5	6.9e-53
WP_000543535.1|3686851_3687301_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001297136.1|3687451_3687991_+	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_001295328.1|3688289_3689174_+	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_000974813.1|3689350_3689698_-	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_000046637.1|3689826_3690798_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000934822.1|3690808_3692656_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000007629.1|3692683_3693016_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000667319.1|3693038_3694166_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
>prophage 266
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3701118	3711090	5103562		Bacillus_phage(60.0%)	7	NA	NA
WP_000893578.1|3701118_3702414_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.3e-26
WP_073519759.1|3702471_3703161_-	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	5.7e-37
WP_001221319.1|3703350_3704553_+	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_000698907.1|3704549_3707693_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001306939.1|3707818_3709003_+	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_001219320.1|3709145_3710054_-	fructokinase	NA	NA	NA	NA	NA
WP_001298537.1|3710178_3711090_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
>prophage 267
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3715379	3716495	5103562		Bacillus_phage(100.0%)	1	NA	NA
WP_000484048.1|3715379_3716495_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
>prophage 268
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3723900	3725058	5103562		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830741.1|3723900_3725058_+	OXA-12 family class D beta-lactamase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	5.1e-06
>prophage 269
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3731953	3732721	5103562		Planktothrix_phage(100.0%)	1	NA	NA
WP_000939375.1|3731953_3732721_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.3	8.6e-26
>prophage 270
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3738017	3739127	5103562		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000842102.1|3738017_3739127_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
>prophage 271
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3742304	3744265	5103562		Micromonas_sp._RCC1109_virus(100.0%)	2	NA	NA
WP_073519760.1|3742304_3743318_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	1.6e-43
WP_000044315.1|3743314_3744265_-	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	36.3	1.1e-35
>prophage 272
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3749675	3753955	5103562		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000805910.1|3749675_3750758_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	99.4	1.1e-191
WP_073519761.1|3750880_3753955_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	98.7	0.0e+00
>prophage 273
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3758496	3764091	5103562		Lactobacillus_phage(50.0%)	4	NA	NA
WP_000952476.1|3758496_3759396_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	5.5e-16
WP_001299008.1|3759435_3760719_-	cytosine deaminase	NA	NA	NA	NA	NA
WP_000076236.1|3760708_3761968_-	cytosine permease	NA	NA	NA	NA	NA
WP_000010276.1|3762204_3764091_-	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	9.1e-53
>prophage 274
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3772469	3777007	5103562		Acanthamoeba_polyphaga_mimivirus(50.0%)	4	NA	NA
WP_000692754.1|3772469_3773519_-	NADPH-dependent aldehyde reductase YahK	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	42.6	2.8e-72
WP_000750339.1|3773605_3774562_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000818900.1|3774558_3775530_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_073519762.1|3775522_3777007_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.7	1.4e-11
>prophage 275
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3789733	3791767	5103562	holin	Vibrio_phage(100.0%)	1	NA	NA
WP_000131044.1|3789733_3791767_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
>prophage 276
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3802670	3805975	5103562		Erysipelothrix_phage(50.0%)	4	NA	NA
WP_001046293.1|3802670_3803996_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	8.5e-114
WP_000474077.1|3804104_3804341_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|3804352_3804946_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_001299025.1|3805105_3805975_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.7	9.3e-53
>prophage 277
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3824875	3835795	5103562	integrase	Pseudomonas_phage(33.33%)	15	3825234:3825247	3831175:3831188
WP_000667026.1|3824875_3827074_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
3825234:3825247	attL	TCGAACAGGCGCGA	NA	NA	NA	NA
WP_000121330.1|3827083_3828040_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111349.1|3828018_3828429_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_049590185.1|3828766_3830086_+|integrase	site-specific integrase	integrase	A0A2H4J5F8	uncultured_Caudovirales_phage	23.7	5.1e-18
WP_049590184.1|3830178_3831027_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000772024.1|3831123_3831321_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
3831175:3831188	attR	TCGCGCCTGTTCGA	NA	NA	NA	NA
WP_000761700.1|3831340_3831829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049590183.1|3831825_3832203_-	toxin	NA	NA	NA	NA	NA
WP_049590182.1|3832292_3832661_-	antitoxin	NA	NA	NA	NA	NA
WP_049590180.1|3832710_3833358_-	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	34.1	2.7e-25
WP_000692300.1|3833376_3833598_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.1e-10
WP_001186724.1|3833666_3834143_-	RadC family protein	NA	NA	NA	NA	NA
WP_000706981.1|3834158_3834638_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	1.5e-12
WP_024196226.1|3834731_3834977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001234639.1|3834976_3835795_-	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	38.4	1.1e-44
>prophage 278
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3844149	3844575	5103562		Enterobacteria_phage(100.0%)	1	NA	NA
WP_049590561.1|3844149_3844575_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	92.5	7.3e-43
>prophage 279
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3848323	3857250	5103562	protease	Caulobacter_phage(33.33%)	10	NA	NA
WP_000301248.1|3848323_3848899_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.1	2.5e-30
WP_000116680.1|3848967_3849546_-	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_049590558.1|3849594_3850635_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_001562623.1|3850653_3851109_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_049590557.1|3851131_3852289_-	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000254140.1|3852288_3852870_-	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.5	1.7e-13
WP_001035166.1|3853192_3854251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049590556.1|3854260_3855403_+	adenine/guanine phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	1.0e-30
WP_049590555.1|3855395_3856169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049590554.1|3856170_3857250_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	3.6e-38
>prophage 280
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3867072	3872385	5103562	transposase	Stx2-converting_phage(60.0%)	5	NA	NA
WP_073519772.1|3867072_3868644_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	59.1	2.4e-168
WP_000624622.1|3868663_3869011_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_073519873.1|3869010_3869658_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	45.2	3.5e-20
WP_123006594.1|3869725_3871070_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.3	4.6e-75
WP_049590476.1|3871593_3872385_-	BRO family, N-terminal domain protein	NA	Q6J1W3	Lactobacillus_phage	31.3	3.7e-08
>prophage 281
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3875726	3877328	5103562	transposase	uncultured_virus(100.0%)	1	NA	NA
WP_077897931.1|3875726_3877328_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	36.2	4.5e-77
>prophage 282
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3887485	3903863	5103562		Moraxella_phage(50.0%)	4	NA	NA
WP_077898157.1|3887485_3897589_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	33.8	2.0e-29
WP_073519775.1|3897601_3899368_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	25.5	6.0e-22
WP_001367158.1|3899962_3900856_+	DNA-processing protein DprA	NA	S6BFL3	Thermus_phage	38.4	1.2e-31
WP_061892948.1|3901496_3903863_-	DEAD/DEAH box helicase	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.2	1.5e-33
>prophage 283
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3911401	3916219	5103562		Streptococcus_phage(50.0%)	4	NA	NA
WP_049590156.1|3911401_3912007_-	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	88.6	2.1e-96
WP_000893257.1|3912507_3913761_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	1.3e-95
WP_001285288.1|3913772_3914876_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749866.1|3915163_3916219_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	1.6e-118
>prophage 284
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3920896	3922063	5103562		Mycobacterium_phage(100.0%)	1	NA	NA
WP_001325639.1|3920896_3922063_-	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	32.0	5.5e-32
>prophage 285
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3926600	3929923	5103562		Clostridioides_phage(50.0%)	4	NA	NA
WP_000093934.1|3926600_3927350_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.5e-19
WP_001225680.1|3927661_3928402_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001304889.1|3928372_3929140_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|3929344_3929923_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
>prophage 286
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3942202	3944350	5103562		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000835430.1|3942202_3944350_-	type I secretion system permease/ATPase	NA	F2Y2R6	Organic_Lake_phycodnavirus	26.9	4.2e-22
>prophage 287
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3950030	3954146	5103562	protease	Enterobacteria_phage(100.0%)	1	NA	NA
WP_001045652.1|3950030_3954146_+|protease	serine protease autotransporter toxin Pic	protease	Q9LA54	Enterobacteria_phage	45.8	0.0e+00
>prophage 288
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	3958056	3974915	5103562	transposase	Moraxella_phage(50.0%)	9	NA	NA
WP_073519779.1|3958056_3967713_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	36.9	7.2e-29
WP_073519780.1|3967725_3969498_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	25.5	6.0e-22
WP_001332845.1|3969540_3969729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073519781.1|3969719_3970343_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000416158.1|3971097_3972129_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.0	1.4e-18
WP_000916811.1|3972399_3972843_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000705927.1|3972858_3973146_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000345349.1|3973158_3974415_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001533773.1|3974630_3974915_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	62.2	1.0e-24
>prophage 289
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4001372	4002140	5103562		Bacillus_virus(100.0%)	1	NA	NA
WP_000016205.1|4001372_4002140_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.9	1.7e-13
>prophage 290
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4015904	4018977	5103562		Pseudomonas_phage(50.0%)	6	NA	NA
WP_021567056.1|4015904_4016726_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	6.1e-46
WP_001164966.1|4016725_4016971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001313575.1|4017064_4017538_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.2	4.3e-12
WP_001186193.1|4017553_4018030_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692300.1|4018092_4018314_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.1e-10
WP_073519465.1|4018332_4018977_+	antitoxin of toxin-antitoxin stability system	NA	A0A2I6PI07	Pseudomonas_phage	33.0	2.1e-25
>prophage 291
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4023152	4033149	5103562		Stx2-converting_phage(20.0%)	11	NA	NA
WP_000624707.1|4023152_4023503_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	2.8e-40
WP_001313570.1|4023832_4024027_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001308374.1|4025295_4026027_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
WP_016233825.1|4026091_4026559_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	8.0e-51
WP_001295200.1|4026555_4027278_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052743.1|4027311_4028067_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_073519788.1|4028138_4029497_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211720.1|4029545_4030316_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|4030393_4031194_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648576.1|4031434_4032349_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_073519789.1|4032345_4033149_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.1	9.2e-39
>prophage 292
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4039668	4040700	5103562		Planktothrix_phage(100.0%)	1	NA	NA
WP_000593994.1|4039668_4040700_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
>prophage 293
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4054938	4059054	5103562		Saccharomonospora_phage(50.0%)	2	NA	NA
WP_001294757.1|4054938_4058421_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000569430.1|4058457_4059054_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
>prophage 294
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4067882	4068641	5103562		Flavobacterium_phage(100.0%)	1	NA	NA
WP_001295562.1|4067882_4068641_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 295
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4080525	4081950	5103562	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753955.1|4080525_4081950_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 296
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4085879	4086224	5103562		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|4085879_4086224_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 297
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4092135	4092933	5103562		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158929.1|4092135_4092933_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
>prophage 298
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4098176	4104982	5103562	tRNA	Acanthamoeba_polyphaga_mimivirus(50.0%)	6	NA	NA
WP_001437631.1|4098176_4100606_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	28.8	2.3e-40
WP_001294700.1|4100679_4101210_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_000396036.1|4101224_4101929_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001155227.1|4102106_4102562_+	RNA polymerase-binding transcription factor DksA	NA	NA	NA	NA	NA
WP_000937424.1|4102598_4103525_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_073519794.1|4103563_4104982_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
>prophage 299
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4114888	4115791	5103562	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000339944.1|4114888_4115791_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	49.2	5.7e-61
>prophage 300
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4119053	4125676	5103562		Anomala_cuprea_entomopoxvirus(33.33%)	5	NA	NA
WP_073519795.1|4119053_4119980_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
WP_000651599.1|4120088_4120751_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000683335.1|4120791_4121328_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_001349940.1|4121533_4123924_+	membrane-bound PQQ-dependent dehydrogenase, glucose/quinate/shikimate family	NA	NA	NA	NA	NA
WP_001189633.1|4124125_4125676_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
>prophage 301
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4133325	4134750	5103562		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_073519876.1|4133325_4134750_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.3	7.1e-42
>prophage 302
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4143377	4143929	5103562		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923721.1|4143377_4143929_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	32.3	3.0e-12
>prophage 303
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4148174	4149218	5103562		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217338.1|4148174_4149218_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 304
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4175191	4176916	5103562		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_000425657.1|4175191_4176916_-	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	8.3e-37
>prophage 305
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4189618	4190317	5103562		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916291.1|4189618_4190317_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	37.2	2.8e-23
>prophage 306
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4196649	4202072	5103562		Yellowstone_lake_phycodnavirus(50.0%)	2	NA	NA
WP_000035654.1|4196649_4199001_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.3e-37
WP_001117010.1|4199165_4202072_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
>prophage 307
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4209816	4212570	5103562		Microcystis_phage(50.0%)	5	NA	NA
WP_000257193.1|4209816_4210665_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.1e-08
WP_000796358.1|4210689_4211289_+	DUF4291 domain-containing protein	NA	NA	NA	NA	NA
WP_001248982.1|4211324_4211792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000998542.1|4211890_4212070_-	antitoxin	NA	NA	NA	NA	NA
WP_000624375.1|4212090_4212570_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
>prophage 308
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4220465	4221980	5103562		Vibrio_phage(100.0%)	1	NA	NA
WP_000787107.1|4220465_4221980_+	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
>prophage 309
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4231632	4232781	5103562		Halovirus(100.0%)	1	NA	NA
WP_000597260.1|4231632_4232781_-	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 310
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4237187	4240004	5103562	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001286856.1|4237187_4240004_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	2.7e-77
>prophage 311
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4247038	4256107	5103562		uncultured_Caudovirales_phage(20.0%)	9	NA	NA
WP_000681368.1|4247038_4248205_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	53.8	9.2e-88
WP_000935262.1|4248733_4248943_+	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	73.9	8.0e-19
WP_001118470.1|4249046_4250177_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_000516135.1|4250265_4252182_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_000843559.1|4252558_4252963_+	DUF2541 family protein	NA	NA	NA	NA	NA
WP_001102379.1|4252988_4253702_+	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000528538.1|4253850_4254417_+	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001094682.1|4254451_4255039_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000130189.1|4255153_4256107_-	transaldolase	NA	A0A127KNC6	Cyanophage	30.9	4.8e-10
>prophage 312
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4269148	4271262	5103562		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_001219614.1|4269148_4270573_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.4	1.6e-09
WP_001188666.1|4270572_4271262_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	2.0e-29
>prophage 313
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4274494	4279849	5103562		Bacillus_phage(33.33%)	3	NA	NA
WP_000409451.1|4274494_4276432_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000046749.1|4276642_4278310_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000093841.1|4278616_4279849_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
>prophage 314
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4286592	4287915	5103562		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477808.1|4286592_4287915_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	1.4e-79
>prophage 315
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4293550	4296426	5103562		Salmonella_phage(50.0%)	3	NA	NA
WP_000490275.1|4293550_4293712_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001295748.1|4293838_4294444_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000175943.1|4294836_4296426_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
>prophage 316
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4304355	4305635	5103562		Salmonella_phage(50.0%)	2	NA	NA
WP_000098818.1|4304355_4304895_+	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
WP_000799911.1|4304897_4305635_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
>prophage 317
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4308862	4314227	5103562		Tupanvirus(50.0%)	5	NA	NA
WP_000106030.1|4308862_4309885_-	L-galactonate-5-dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	26.3	2.7e-11
WP_073519805.1|4310023_4310203_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001472900.1|4310272_4310938_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000410127.1|4311152_4312514_+	MFS transporter	NA	NA	NA	NA	NA
WP_000919567.1|4312562_4314227_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
>prophage 318
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4334295	4335240	5103562	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000181113.1|4334295_4335240_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	1.3e-60
>prophage 319
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4342741	4343296	5103562		Clostridioides_phage(100.0%)	1	NA	NA
WP_001151861.1|4342741_4343296_-	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.0	6.0e-37
>prophage 320
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4349863	4351324	5103562		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208194.1|4349863_4351324_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	9.5e-50
>prophage 321
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4361520	4363197	5103562		Escherichia_phage(100.0%)	2	NA	NA
WP_000044711.1|4361520_4362117_-	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
WP_000790583.1|4362594_4363197_-	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
>prophage 322
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4366558	4451450	5103562	integrase,transposase,tRNA,protease	Enterobacteria_phage(33.33%)	72	4368095:4368110	4412902:4412917
WP_024185277.1|4366558_4367539_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	56.2	1.4e-102
WP_000168568.1|4367750_4368623_+	HNH endonuclease	NA	NA	NA	NA	NA
4368095:4368110	attL	TTTCGATGAACAGCAC	NA	NA	NA	NA
WP_000177023.1|4368792_4370868_+	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	33.8	4.5e-37
WP_073519812.1|4370860_4372204_+	McrC family protein	NA	NA	NA	NA	NA
WP_000148644.1|4372200_4372587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001040175.1|4372637_4374785_+	N-6 DNA methylase	NA	B3GAM1	uncultured_virus	42.3	5.7e-19
WP_085947598.1|4375305_4376467_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_000377420.1|4377589_4378876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000007262.1|4378872_4383159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000092642.1|4383169_4384018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001004904.1|4384020_4385178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000323666.1|4385167_4386853_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_001358348.1|4386989_4387403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001022619.1|4387399_4388869_+	serine/threonine protein kinase	NA	A0A2K9L5Y0	Tupanvirus	26.5	1.4e-11
WP_001218329.1|4389069_4390335_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	43.1	1.1e-81
WP_137439362.1|4390550_4390745_-|integrase	integrase	integrase	Q38404	Enterobacteria_phage	96.1	8.5e-23
WP_001544037.1|4391100_4393434_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	98.7	0.0e+00
WP_073519814.1|4393448_4393769_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000459291.1|4393904_4394360_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_001244665.1|4394352_4394640_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_032226384.1|4394632_4395187_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	80.2	4.0e-41
WP_001149160.1|4395183_4395450_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_024215847.1|4396002_4396737_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	97.1	7.4e-128
WP_000638629.1|4396733_4397234_+	transactivation protein	NA	NA	NA	NA	NA
WP_000446132.1|4397307_4397880_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
WP_000094232.1|4398081_4398771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000772670.1|4401735_4402992_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.6	2.4e-73
WP_001349988.1|4403435_4404455_+	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	1.1e-44
WP_000896734.1|4404458_4405022_-	gluconokinase	NA	NA	NA	NA	NA
WP_001197416.1|4405238_4406270_+	L-idonate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000998695.1|4406293_4407058_+	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_001128335.1|4407122_4408442_+	gnt-II system L-idonate transporter	NA	NA	NA	NA	NA
WP_001349989.1|4408508_4409507_+	DNA-binding transcriptional regulator IdnR	NA	NA	NA	NA	NA
WP_001294556.1|4409584_4411087_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.6	3.9e-83
WP_001295681.1|4411205_4412288_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000584114.1|4412287_4413388_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
4412902:4412917	attR	TTTCGATGAACAGCAC	NA	NA	NA	NA
WP_000397144.1|4413654_4415166_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_001188289.1|4415260_4415743_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000416382.1|4415742_4418598_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
WP_073519815.1|4418653_4419850_-	DUF898 domain-containing protein	NA	NA	NA	NA	NA
WP_001059422.1|4420042_4420546_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000002953.1|4420591_4421008_-	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_000012907.1|4421169_4422174_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_001309158.1|4422274_4422505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001368705.1|4422491_4423835_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000583470.1|4423957_4424410_-	DUF386 domain-containing protein	NA	NA	NA	NA	NA
WP_000256656.1|4424554_4425148_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000500725.1|4425218_4425932_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000230281.1|4426062_4426458_+	RidA family protein	NA	NA	NA	NA	NA
WP_001296693.1|4426738_4426873_+	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000013042.1|4426876_4427812_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	3.8e-52
WP_000148581.1|4427824_4428286_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000047539.1|4428358_4428745_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_024172218.1|4428766_4429030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000399648.1|4429021_4430002_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000471866.1|4430229_4432926_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_001387276.1|4433066_4433120_-	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_001181332.1|4433304_4434252_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	6.0e-13
WP_001297258.1|4434370_4435792_+	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001358354.1|4435841_4437497_+	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_000187791.1|4437890_4440029_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.6	9.1e-267
WP_001106217.1|4440187_4440652_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	60.4	6.5e-53
WP_001232240.1|4440696_4441083_-	cytochrome b562	NA	NA	NA	NA	NA
WP_001162171.1|4441265_4442618_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166270.1|4442711_4443263_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219792.1|4443413_4444787_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853753.1|4444962_4445961_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_000596015.1|4445993_4446989_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001296689.1|4446975_4447998_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205813.1|4448011_4449514_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.4e-11
WP_000265933.1|4449653_4450610_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055075.1|4450919_4451450_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
>prophage 323
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4471390	4473038	5103562	transposase	Escherichia_phage(50.0%)	2	NA	NA
WP_000826425.1|4471390_4472599_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	9.2e-208
WP_000604912.1|4472606_4473038_+|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.6	1.9e-43
>prophage 324
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4487484	4488648	5103562		Ralstonia_phage(100.0%)	1	NA	NA
WP_000943987.1|4487484_4488648_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.5	1.7e-81
>prophage 325
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4492580	4505611	5103562	tRNA,protease	Lactococcus_phage(20.0%)	11	NA	NA
WP_000076316.1|4492580_4495022_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
WP_001177639.1|4495060_4495486_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|4495690_4496989_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|4497092_4497290_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|4497371_4498376_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|4498378_4499638_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460360.1|4499723_4501004_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|4501079_4501388_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280345.1|4501473_4502424_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001122507.1|4502416_4504264_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_000990320.1|4504273_4505611_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
>prophage 326
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4509526	4510072	5103562		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001358360.1|4509526_4510072_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	1.7e-28
>prophage 327
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4517500	4518478	5103562		Tupanvirus(100.0%)	1	NA	NA
WP_000004771.1|4517500_4518478_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 328
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4523398	4523932	5103562		Morganella_phage(100.0%)	1	NA	NA
WP_001238378.1|4523398_4523932_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 329
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4529729	4531713	5103562		Vibrio_phage(50.0%)	2	NA	NA
WP_000729117.1|4529729_4531376_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|4531419_4531713_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
>prophage 330
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4545989	4549201	5103562	tRNA	Acinetobacter_phage(50.0%)	2	NA	NA
WP_000856832.1|4545989_4547447_+	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.4	4.0e-48
WP_001295074.1|4547683_4549201_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
>prophage 331
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4570403	4571906	5103562		Burkholderia_virus(100.0%)	1	NA	NA
WP_001296882.1|4570403_4571906_-	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.0	7.0e-56
>prophage 332
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4576745	4577534	5103562		Cedratvirus(100.0%)	1	NA	NA
WP_001193391.1|4576745_4577534_+	phosphonate ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.1	8.5e-13
>prophage 333
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4583138	4584688	5103562		Bacillus_virus(50.0%)	2	NA	NA
WP_001075526.1|4583138_4583897_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	27.8	1.0e-15
WP_000611428.1|4584007_4584688_+	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	25.0	8.7e-06
>prophage 334
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4588673	4590659	5103562		Tetraselmis_virus(100.0%)	1	NA	NA
WP_073519820.1|4588673_4590659_+	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.5	9.3e-149
>prophage 335
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4595904	4598052	5103562		Escherichia_phage(100.0%)	1	NA	NA
WP_001300547.1|4595904_4598052_+	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	7.0e-33
>prophage 336
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4607334	4609293	5103562		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078239.1|4607334_4609293_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.9e-90
>prophage 337
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4614876	4616226	5103562		Moraxella_phage(100.0%)	1	NA	NA
WP_000106882.1|4614876_4616226_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 338
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4620043	4623656	5103562		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000168305.1|4620043_4620580_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
WP_000357740.1|4620833_4623656_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
>prophage 339
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4627863	4630411	5103562		Yellowstone_lake_mimivirus(50.0%)	2	NA	NA
WP_001147328.1|4627863_4628943_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
WP_000918363.1|4628995_4630411_-	replicative DNA helicase DnaB	NA	O80281	Escherichia_phage	78.3	4.8e-200
>prophage 340
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4637008	4637617	5103562		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|4637008_4637617_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 341
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4646741	4647857	5103562		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|4646741_4647857_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 342
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4663673	4664465	5103562		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001130529.1|4663673_4664465_-	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	44.2	1.0e-45
>prophage 343
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4670115	4673799	5103562		Dickeya_phage(100.0%)	1	NA	NA
WP_000096011.1|4670115_4673799_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 344
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4689268	4690858	5103562		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187566.1|4689268_4690858_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.3e-68
>prophage 345
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4696226	4697990	5103562		Bacillus_phage(50.0%)	3	NA	NA
WP_001044513.1|4696226_4696499_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
WP_000940106.1|4696685_4697276_-	YjaG family protein	NA	NA	NA	NA	NA
WP_000362392.1|4697318_4697990_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
>prophage 346
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4707206	4715535	5103562		Vibrio_phage(50.0%)	2	NA	NA
WP_000653944.1|4707206_4711430_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
WP_000263098.1|4711506_4715535_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
>prophage 347
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4719651	4722704	5103562		Tupanvirus(50.0%)	2	NA	NA
WP_000031784.1|4719651_4720836_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000023081.1|4721753_4722704_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
>prophage 348
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4731305	4733150	5103562		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000591355.1|4731305_4733150_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	7.1e-10
>prophage 349
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4750185	4757432	5103562		Serratia_phage(33.33%)	5	NA	NA
WP_000184821.1|4750185_4752483_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
WP_000161265.1|4752533_4752854_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_073519825.1|4752868_4753948_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001174093.1|4754256_4756758_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_000424845.1|4756769_4757432_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
>prophage 350
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4770300	4774485	5103562		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_039259195.1|4770300_4774485_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.0	1.0e-24
>prophage 351
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4780122	4784625	5103562		Erwinia_phage(50.0%)	5	NA	NA
WP_001293343.1|4780122_4781454_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000139496.1|4781520_4782447_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|4782539_4783025_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|4783109_4783355_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|4783779_4784625_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
>prophage 352
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4797480	4802341	5103562		Feldmannia_irregularis_virus(33.33%)	5	NA	NA
WP_001033722.1|4797480_4798179_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|4798175_4799549_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001270270.1|4799654_4800329_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_001166062.1|4800477_4801461_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001297064.1|4801720_4802341_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
>prophage 353
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4817104	4820155	5103562		Escherichia_phage(100.0%)	1	NA	NA
WP_011310337.1|4817104_4820155_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 354
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4834176	4838907	5103562		Prochlorococcus_phage(33.33%)	5	NA	NA
WP_000357967.1|4834176_4835187_-	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A0K0KVL7	Prochlorococcus_phage	22.2	1.3e-05
WP_000094544.1|4835219_4836107_-	aldolase	NA	NA	NA	NA	NA
WP_001299483.1|4836131_4837010_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	73.6	2.7e-47
WP_000160872.1|4837182_4838079_+	sugar kinase	NA	NA	NA	NA	NA
WP_000022286.1|4838118_4838907_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	1.3e-21
>prophage 355
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4846078	4848549	5103562		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_000190577.1|4846078_4847128_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
WP_073519879.1|4847139_4848549_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
>prophage 356
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4852627	4855414	5103562		uncultured_virus(100.0%)	1	NA	NA
WP_000250055.1|4852627_4855414_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	1.7e-71
>prophage 357
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4869104	4869719	5103562		Streptococcus_phage(100.0%)	1	NA	NA
WP_073519831.1|4869104_4869719_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	2.1e-19
>prophage 358
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4878509	4881796	5103562		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000109943.1|4878509_4879286_-	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
WP_000459594.1|4879288_4879804_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_001295260.1|4879807_4880077_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000187530.1|4880155_4881796_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	8.2e-42
>prophage 359
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4894208	4896038	5103562		Catovirus(100.0%)	1	NA	NA
WP_001346040.1|4894208_4896038_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	9.7e-84
>prophage 360
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4903524	4907383	5103562		Bacillus_phage(100.0%)	3	NA	NA
WP_000383406.1|4903524_4905687_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
WP_001213584.1|4905770_4906487_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000130691.1|4906486_4907383_-	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
>prophage 361
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4925865	4932009	5103562		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000612044.1|4925865_4926996_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
WP_001145196.1|4927000_4927675_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000676056.1|4927652_4928534_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001226604.1|4928552_4929620_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.7	3.5e-102
WP_000006625.1|4929619_4930882_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
WP_000866670.1|4930878_4932009_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.8	3.0e-27
>prophage 362
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4936051	4941463	5103562		Indivirus(33.33%)	4	NA	NA
WP_001280776.1|4936051_4936381_-	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
WP_000047499.1|4936511_4937777_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_073519833.1|4937910_4939395_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001238869.1|4939441_4941463_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	2.9e-113
>prophage 363
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4949936	4951583	5103562		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012597.1|4949936_4951583_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.6	7.4e-67
>prophage 364
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4965066	4970919	5103562		Enterobacteria_phage(33.33%)	5	NA	NA
WP_001056273.1|4965066_4965957_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
WP_000211858.1|4965981_4966947_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_000387753.1|4966951_4968457_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	4.6e-15
WP_001297694.1|4968464_4968884_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000102319.1|4969050_4970919_-	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
>prophage 365
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4974087	4975080	5103562		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845134.1|4974087_4975080_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.3	6.5e-50
>prophage 366
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4987032	4990394	5103562		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000933736.1|4987032_4988403_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
WP_000334099.1|4988564_4990394_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.4	1.9e-132
>prophage 367
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	4995925	4999766	5103562		Cyanophage(50.0%)	4	NA	NA
WP_000867146.1|4995925_4996966_+	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
WP_000741620.1|4997052_4998012_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_001251991.1|4998011_4998902_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000063125.1|4998992_4999766_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
>prophage 368
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	5010756	5012094	5103562		Moraxella_phage(100.0%)	1	NA	NA
WP_001299598.1|5010756_5012094_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 369
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	5022293	5029662	5103562		Staphylococcus_phage(33.33%)	8	NA	NA
WP_001307474.1|5022293_5022551_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
WP_000239730.1|5022514_5022874_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_000831330.1|5022890_5023031_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_120795392.1|5023260_5023341_-	protein YsdD	NA	NA	NA	NA	NA
WP_073519835.1|5023637_5025041_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_000673464.1|5025045_5026146_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000060112.1|5026145_5027219_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000072067.1|5027247_5029662_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
>prophage 370
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	5034368	5035517	5103562		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705001.1|5034368_5035517_+	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 371
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	5039944	5040898	5103562		Cyanophage(50.0%)	2	NA	NA
WP_001243437.1|5039944_5040358_+	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
WP_001243431.1|5040469_5040898_+	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
>prophage 372
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	5047251	5050457	5103562		Aeromonas_phage(50.0%)	2	NA	NA
WP_073519837.1|5047251_5048967_+	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.6	5.6e-41
WP_000828483.1|5048963_5050457_+	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	25.4	1.1e-29
>prophage 373
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	5054720	5056409	5103562		Micromonas_sp._RCC1109_virus(100.0%)	1	NA	NA
WP_000168480.1|5054720_5056409_+	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	4.2e-57
>prophage 374
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	5063713	5065048	5103562		Moraxella_phage(100.0%)	1	NA	NA
WP_001349999.1|5063713_5065048_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.2	6.6e-66
>prophage 375
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	5073606	5075991	5103562		Klebsiella_phage(33.33%)	5	NA	NA
WP_001546495.1|5073606_5073828_-	DUF987 domain-containing protein	NA	A0A1U8V471	Klebsiella_phage	45.8	1.1e-10
WP_061892568.1|5073884_5074361_-	RadC family protein	NA	NA	NA	NA	NA
WP_061892567.1|5074376_5074856_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.7	8.0e-14
WP_077768309.1|5074954_5075155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061892566.1|5075172_5075991_-	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	38.7	1.8e-45
>prophage 376
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	5083635	5084408	5103562		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000422741.1|5083635_5084061_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_061892734.1|5084057_5084408_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	67.2	7.3e-41
>prophage 377
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	5088120	5089334	5103562	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_085947772.1|5088120_5089334_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
>prophage 378
NZ_CP010213	Escherichia coli strain M15, complete genome	5103562	5092973	5094746	5103562		Moraxella_phage(100.0%)	1	NA	NA
WP_073519780.1|5092973_5094746_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	25.5	6.0e-22
