The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018356	Klebsiella pneumoniae strain CAV1453 chromosome, complete genome	5327855	306689	318343	5327855	integrase	Enterobacteria_phage(70.0%)	13	294823:294837	317880:317894
294823:294837	attL	AGCGCGGAGAGATTG	NA	NA	NA	NA
WP_002889890.1|306689_309023_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
WP_002889897.1|309034_309355_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889911.1|309351_309579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024940872.1|309575_310133_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889915.1|310129_310396_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_002889917.1|310937_311675_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
WP_002889919.1|311671_311917_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_002889930.1|311934_312501_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
WP_004152979.1|313069_313495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152029.1|313494_314445_-	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_002889938.1|314432_315623_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_002889940.1|315975_317229_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_004144574.1|317239_318343_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
317880:317894	attR	AGCGCGGAGAGATTG	NA	NA	NA	NA
>prophage 2
NZ_CP018356	Klebsiella pneumoniae strain CAV1453 chromosome, complete genome	5327855	969132	1006468	5327855	portal,head,lysis,plate,integrase,tail,capsid,terminase	Salmonella_phage(87.18%)	46	969040:969058	1006540:1006558
969040:969058	attL	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_014342959.1|969132_970113_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.2	1.4e-97
WP_004178082.1|970600_972088_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004150866.1|972186_973131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152885.1|973142_974021_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
WP_000188448.1|974166_974388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460893.1|974420_974930_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000956179.1|974937_975138_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000963473.1|975101_975443_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_004150864.1|975510_975744_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000752622.1|975743_975971_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150863.1|975967_976825_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_004150862.1|976821_979236_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_001154434.1|979389_979578_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217575.1|979588_979822_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_000700647.1|979936_980614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002895959.1|982693_983719_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004150858.1|983718_985485_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895967.1|985627_986461_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_002895972.1|986477_987536_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_000059191.1|987539_988190_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002896151.1|988285_988750_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_002896155.1|988749_988953_+|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896158.1|988956_989172_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896161.1|989152_989662_+	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896163.1|989666_990050_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896168.1|990046_990475_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896170.1|990461_990608_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	76.1	6.0e-13
WP_002896172.1|990570_991002_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896175.1|990994_991441_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_004150857.1|991437_992130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896177.1|992224_992797_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_002896179.1|992793_993156_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	84.7	5.8e-49
WP_002896182.1|993142_994051_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_004150856.1|994043_994643_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_019724930.1|996861_997596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896186.1|997599_998331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896188.1|998327_998531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896191.1|998560_999637_+|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896193.1|999775_1000948_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896201.1|1000957_1001473_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896204.1|1001525_1001825_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896220.1|1001839_1001959_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896222.1|1001951_1004579_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
WP_002896224.1|1004575_1005061_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_002896225.1|1005057_1006158_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_000972391.1|1006249_1006468_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
1006540:1006558	attR	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
>prophage 3
NZ_CP018356	Klebsiella pneumoniae strain CAV1453 chromosome, complete genome	5327855	1040884	1050348	5327855	tRNA,protease	Dickeya_phage(16.67%)	8	NA	NA
WP_002896440.1|1040884_1042000_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_004150848.1|1041996_1043937_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896516.1|1044013_1044235_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|1044560_1044878_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896522.1|1044908_1047188_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_001040187.1|1047308_1047527_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002898014.1|1047880_1048582_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_004150847.1|1048626_1050348_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
>prophage 4
NZ_CP018356	Klebsiella pneumoniae strain CAV1453 chromosome, complete genome	5327855	1149732	1172388	5327855	integrase,tail,head	Pectobacterium_phage(28.57%)	33	1148635:1148649	1181595:1181609
1148635:1148649	attL	TCAGTTTGCGCAGTT	NA	NA	NA	NA
WP_016197576.1|1149732_1150761_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	54.1	4.4e-94
WP_004199480.1|1150764_1150989_-	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	68.1	4.5e-20
WP_022644592.1|1151385_1151952_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	61.5	2.5e-51
WP_022644593.1|1151951_1154081_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.6	8.0e-98
WP_022644594.1|1154110_1154356_-	hypothetical protein	NA	A0A1B1W282	Salmonella_phage	59.5	3.7e-15
WP_024623105.1|1154363_1154597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025712912.1|1155538_1155925_-	helix-turn-helix domain-containing protein	NA	A5VW98	Enterobacteria_phage	57.8	3.4e-15
WP_022644596.1|1156005_1156200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644597.1|1156260_1156707_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	56.1	5.7e-30
WP_016197573.1|1156790_1156949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032409672.1|1156951_1157935_+	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	73.8	1.3e-39
WP_022644599.1|1157931_1159320_+	AAA family ATPase	NA	Q8HA30	Enterobacteria_phage	46.6	7.5e-105
WP_022644600.1|1159358_1160009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644601.1|1160012_1160246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644602.1|1160285_1161071_+	chromosome partitioning protein ParB	NA	C7BGF1	Burkholderia_phage	54.9	7.8e-67
WP_004141582.1|1161790_1162021_+	hypothetical protein	NA	A0A2H4JCC5	uncultured_Caudovirales_phage	37.3	5.0e-06
WP_022644604.1|1162017_1162635_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_032409673.1|1162647_1162986_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	82.0	8.6e-47
WP_029499143.1|1163166_1163358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199500.1|1163426_1164020_+	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	72.1	7.2e-81
WP_071570746.1|1164009_1164333_+	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	55.8	6.8e-25
WP_022644607.1|1164320_1164668_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004199525.1|1164673_1165114_+	phage family protein	NA	R9TRJ4	Aeromonas_phage	43.8	4.3e-14
WP_004199492.1|1165154_1165679_+	DUF2829 domain-containing protein	NA	A0A1B0VMG3	Pseudomonas_phage	54.1	2.5e-45
WP_004199520.1|1165740_1165974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199477.1|1165957_1166218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199526.1|1166224_1166677_+	DNA-packaging protein	NA	A3EYX3	Salmonella_phage	66.4	1.1e-49
WP_004199513.1|1166761_1168156_+	hypothetical protein	NA	A0A0E3JIA1	Rhodoferax_phage	36.4	2.4e-58
WP_004141558.1|1168155_1169820_+|head,tail	head-tail connector protein	head,tail	A0A221SAN2	Ralstonia_phage	39.4	3.1e-105
WP_004199528.1|1169822_1170146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199538.1|1170132_1170870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004191051.1|1170880_1171876_+	hypothetical protein	NA	W6MW28	Pseudomonas_phage	60.2	2.7e-104
WP_004191050.1|1171914_1172388_+	hypothetical protein	NA	K4NYY6	Pseudomonas_phage	46.3	1.8e-26
1181595:1181609	attR	TCAGTTTGCGCAGTT	NA	NA	NA	NA
>prophage 5
NZ_CP018356	Klebsiella pneumoniae strain CAV1453 chromosome, complete genome	5327855	1177504	1193584	5327855	holin	Salmonella_phage(50.0%)	14	NA	NA
WP_022644615.1|1177504_1180012_+	transglycosylase SLT domain-containing protein	NA	Q858G0	Salmonella_phage	26.4	7.6e-55
WP_022644616.1|1180011_1181853_+	hypothetical protein	NA	Q858F9	Salmonella_phage	33.4	9.4e-79
WP_022644617.1|1181852_1184570_+	hypothetical protein	NA	Q858F8	Salmonella_phage	51.2	8.5e-262
WP_127897200.1|1184566_1184890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644619.1|1185337_1186588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004191041.1|1186800_1187016_+|holin	class II holin family protein	holin	A5LH82	Enterobacteria_phage	55.9	1.4e-10
WP_004191039.1|1187017_1187557_+	lysozyme	NA	H6WRZ4	Salmonella_phage	78.1	1.0e-81
WP_009308366.1|1187553_1188084_+	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	48.9	2.4e-35
WP_004199504.1|1188080_1188233_+	DUF1378 family protein	NA	NA	NA	NA	NA
WP_022644698.1|1188324_1190742_+	hypothetical protein	NA	A0A193GYU1	Enterobacter_phage	46.6	5.8e-60
WP_022644621.1|1190752_1190947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071784388.1|1191145_1192642_-	hypothetical protein	NA	A0A0A8J9V7	Klebsiella_phage	34.5	7.9e-68
WP_004199521.1|1192765_1193335_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	86.8	3.9e-84
WP_004199491.1|1193308_1193584_-	hypothetical protein	NA	A0A0M3ULK3	Salmonella_phage	60.9	1.9e-23
>prophage 6
NZ_CP018356	Klebsiella pneumoniae strain CAV1453 chromosome, complete genome	5327855	1517959	1589713	5327855	transposase,integrase,terminase,holin,plate	uncultured_Caudovirales_phage(35.29%)	83	1516040:1516054	1524980:1524994
1516040:1516054	attL	AGTTGATCCTCTGGC	NA	NA	NA	NA
WP_004152144.1|1517959_1518721_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
WP_004152145.1|1518937_1520470_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_016197745.1|1520668_1521217_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_004152147.1|1521413_1522595_+|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_004152148.1|1522575_1522818_-	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004198245.1|1522777_1522924_-	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	70.8	2.9e-15
WP_014343018.1|1522996_1523230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152150.1|1523472_1523685_-	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_004152151.1|1523681_1523906_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004154298.1|1523895_1524606_-	Rha family transcriptional regulator	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152153.1|1524611_1525130_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
1524980:1524994	attR	GCCAGAGGATCAACT	NA	NA	NA	NA
WP_004152154.1|1525234_1526062_-	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152155.1|1526058_1526253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152156.1|1526249_1526675_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004177208.1|1526671_1526890_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
WP_004152157.1|1526861_1527116_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004152158.1|1527108_1527474_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152159.1|1527643_1527832_-	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152160.1|1527824_1528139_-	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152161.1|1528309_1528978_-	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152162.1|1529075_1529297_+	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004198228.1|1529873_1531532_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004198233.1|1531533_1532496_+	toprim domain-containing protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198239.1|1532492_1532969_+	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004152167.1|1532965_1533748_+	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004146526.1|1534153_1534402_+|holin	class II holin family protein	holin	NA	NA	NA	NA
WP_004152169.1|1534404_1534935_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004153952.1|1534931_1535321_+	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152170.1|1535555_1535876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004218030.1|1536241_1536730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152172.1|1536680_1538081_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004152173.1|1538318_1539770_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152174.1|1539825_1540374_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004199270.1|1540425_1541628_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_000528476.1|1541631_1542126_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_001132269.1|1542137_1543079_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000725700.1|1543118_1543400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|1543368_1543788_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000834982.1|1543784_1544291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001116156.1|1544290_1544677_+	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_004152176.1|1544771_1545212_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_004152177.1|1545215_1546361_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004152178.1|1546371_1546662_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	85.5	2.6e-23
WP_085955245.1|1546602_1547795_-|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
WP_004152564.1|1548121_1548547_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_004152565.1|1548582_1548735_+	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152566.1|1548724_1550728_+	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152567.1|1550727_1551327_+	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_004217362.1|1551402_1551630_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	56.0	4.6e-20
WP_004152569.1|1551632_1552655_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004152570.1|1552654_1552996_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004199301.1|1553045_1553228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152571.1|1553270_1553837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152572.1|1553890_1554544_+	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152573.1|1554545_1554899_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152574.1|1554898_1556095_+|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152575.1|1556091_1556865_+	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152576.1|1556864_1557731_+	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
WP_004152577.1|1557730_1557928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004218487.1|1560278_1561007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002902128.1|1561017_1561749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002902131.1|1561745_1561955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002902133.1|1562059_1562344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002902136.1|1562566_1562815_-	DinI-like family protein	NA	S5MQI1	Escherichia_phage	70.4	1.4e-25
WP_002902144.1|1563660_1564152_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002902148.1|1564194_1565739_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004218490.1|1565748_1567092_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004151603.1|1567088_1567778_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004151602.1|1567774_1569481_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002902160.1|1569485_1569977_+	type VI secretion system effector Hcp	NA	NA	NA	NA	NA
WP_002902163.1|1570241_1572896_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	2.5e-96
WP_004228410.1|1572897_1575267_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.8	9.1e-18
WP_002902169.1|1575267_1576047_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_002902172.1|1576110_1576641_+	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902174.1|1576709_1577240_+	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902176.1|1577307_1577838_+	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902178.1|1577906_1578437_+	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902180.1|1578504_1579035_+	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_004151601.1|1579022_1581440_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_002902252.1|1581484_1581742_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_002902254.1|1581738_1582878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151599.1|1582861_1586287_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_004151598.1|1587958_1589713_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 7
NZ_CP018356	Klebsiella pneumoniae strain CAV1453 chromosome, complete genome	5327855	1785227	1796114	5327855		Escherichia_phage(87.5%)	9	NA	NA
WP_002210516.1|1785227_1785848_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_004151609.1|1785840_1787106_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_004151610.1|1787117_1788020_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_002210513.1|1788280_1789042_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004176269.1|1789062_1789923_-	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002904006.1|1790220_1790481_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_001620097.1|1790567_1791656_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004151612.1|1791686_1792952_-	MFS transporter	NA	NA	NA	NA	NA
WP_004151613.1|1793006_1796114_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
>prophage 8
NZ_CP018356	Klebsiella pneumoniae strain CAV1453 chromosome, complete genome	5327855	2445095	2488195	5327855	tRNA,transposase,plate	Microcystis_virus(25.0%)	41	NA	NA
WP_002910404.1|2445095_2446352_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_002910405.1|2446622_2447234_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_004217879.1|2447233_2448082_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_002910407.1|2448265_2449213_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.5	2.3e-44
WP_004152259.1|2449337_2451017_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.4	7.9e-24
WP_002910436.1|2451017_2452064_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910437.1|2452286_2452562_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_002910438.1|2452834_2453419_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_002910443.1|2453536_2454628_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_002910446.1|2454710_2454920_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_002910453.1|2455121_2456036_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152260.1|2456167_2457583_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004152261.1|2457602_2458046_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_002910493.1|2458048_2458585_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004152910.1|2458565_2459582_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002910495.1|2459611_2461375_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004152262.1|2461508_2464919_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_004198077.1|2464902_2466060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910497.1|2466063_2466330_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_072093174.1|2466627_2466813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171815252.1|2467073_2467376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019473.1|2467433_2468414_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004152632.1|2468750_2469641_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	29.8	4.1e-11
WP_002910539.1|2469816_2470710_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.1	2.8e-12
WP_038435084.1|2470731_2470860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152633.1|2470885_2471779_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.3	1.7e-12
WP_004217423.1|2471800_2471917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910544.1|2471962_2472856_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	30.5	6.7e-14
WP_002910547.1|2472877_2473183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910551.1|2474698_2475205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153085.1|2475201_2475531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199326.1|2475527_2475710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644641.1|2475851_2476820_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.3	6.5e-180
WP_002910586.1|2478425_2478935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910589.1|2478924_2479077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910591.1|2479171_2479678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910593.1|2479674_2480184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152319.1|2480184_2481540_-	S-type pyocin domain-containing protein	NA	NA	NA	NA	NA
WP_004152317.1|2484503_2486201_-	OmpA family protein	NA	NA	NA	NA	NA
WP_004152316.1|2486204_2486858_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_002910645.1|2486854_2488195_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 9
NZ_CP018356	Klebsiella pneumoniae strain CAV1453 chromosome, complete genome	5327855	2795396	2802303	5327855	tRNA	Bacillus_phage(33.33%)	6	NA	NA
WP_004151135.1|2795396_2796875_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.1e-29
WP_002912634.1|2796871_2797594_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	6.4e-31
WP_002912635.1|2797912_2799274_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.5	2.5e-206
WP_004151134.1|2799516_2800413_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_002912638.1|2800655_2801429_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	1.5e-25
WP_004175147.1|2801439_2802303_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
>prophage 10
NZ_CP018356	Klebsiella pneumoniae strain CAV1453 chromosome, complete genome	5327855	3102065	3176210	5327855	tRNA,transposase,integrase,tail,holin,protease,terminase	Salmonella_phage(43.14%)	82	3107707:3107724	3175199:3175216
WP_004152006.1|3102065_3104069_-|tRNA	tRNA(Met) cytidine acetyltransferase	tRNA	NA	NA	NA	NA
WP_002913800.1|3104078_3104954_-	neutral zinc metallopeptidase	NA	NA	NA	NA	NA
WP_002913801.1|3105073_3105787_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	35.7	1.1e-38
WP_002913802.1|3106002_3107037_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_002913803.1|3107053_3107932_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
3107707:3107724	attL	CAGCGATAACCGGAATAC	NA	NA	NA	NA
WP_002913804.1|3108085_3108652_+	glycine cleavage system transcriptional repressor	NA	NA	NA	NA	NA
WP_002913805.1|3108655_3109126_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_002913806.1|3109187_3110249_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_004221267.1|3110303_3110420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002913807.1|3110471_3111935_+|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
WP_002913810.1|3111944_3112304_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_002913812.1|3112431_3113343_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	58.8	3.5e-74
WP_020947395.1|3113339_3114041_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_002913824.1|3114139_3115426_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.1	1.9e-65
WP_002913827.1|3115521_3116148_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_002913829.1|3116365_3117799_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002913833.1|3117808_3118702_-	ROK family protein	NA	NA	NA	NA	NA
WP_002913836.1|3118965_3120003_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.5	8.2e-72
WP_004152007.1|3119999_3120641_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.1	1.2e-28
WP_002913838.1|3120821_3122882_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_002913839.1|3122885_3124418_+	exopolyphosphatase	NA	NA	NA	NA	NA
WP_002913841.1|3124471_3126700_-	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
WP_004174861.1|3127070_3127244_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	78.8	1.4e-16
WP_004221278.1|3127340_3128252_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002913847.1|3128325_3129558_+	MFS transporter	NA	NA	NA	NA	NA
WP_004162150.1|3129851_3131030_+	anaerobic sulfatase maturase	NA	NA	NA	NA	NA
WP_004152009.1|3131013_3132882_+	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
WP_073520381.1|3133101_3133584_-	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	88.8	1.3e-67
WP_073520382.1|3133580_3134210_-	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	76.4	1.5e-89
WP_002913854.1|3134199_3134505_-|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	82.4	1.6e-39
WP_073520383.1|3134491_3134896_-	hypothetical protein	NA	T1SA79	Salmonella_phage	83.3	1.2e-55
WP_164488131.1|3134986_3135157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073520384.1|3135158_3137420_-|tail	phage tail protein	tail	A0A0A8J9V7	Klebsiella_phage	36.4	1.4e-71
WP_004141317.1|3138255_3138801_+	DUF2335 domain-containing protein	NA	NA	NA	NA	NA
WP_073520387.1|3139401_3142176_-	hypothetical protein	NA	Q858F8	Salmonella_phage	78.8	0.0e+00
WP_073520388.1|3142175_3144053_-	hypothetical protein	NA	Q858F9	Salmonella_phage	59.2	1.2e-198
WP_073520389.1|3144052_3146569_-	hypothetical protein	NA	Q858G0	Salmonella_phage	52.8	9.4e-247
WP_024622833.1|3146581_3147079_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	41.7	5.2e-24
WP_049139501.1|3147071_3147542_-	hypothetical protein	NA	Q858G2	Salmonella_phage	55.3	7.3e-44
WP_073520390.1|3147543_3150021_-	hypothetical protein	NA	G9L6D0	Escherichia_phage	56.5	8.0e-267
WP_073520391.1|3150020_3150632_-	hypothetical protein	NA	T1SAQ2	Salmonella_phage	48.3	2.7e-46
WP_073520392.1|3150680_3150959_-	hypothetical protein	NA	T1SA01	Salmonella_phage	58.9	1.1e-20
WP_004152466.1|3150951_3151344_-	hypothetical protein	NA	T1SA71	Salmonella_phage	89.9	1.5e-55
WP_004197367.1|3151353_3152361_-	bbp17	NA	T1S9H9	Salmonella_phage	92.8	2.1e-181
WP_181404411.1|3152373_3153051_-	peptidase	NA	T1SAP9	Salmonella_phage	65.7	3.2e-48
WP_004152470.1|3153053_3153359_-	hypothetical protein	NA	Q2A090	Sodalis_phage	51.3	1.1e-16
WP_004149313.1|3153355_3155035_-|tail	tail protein	tail	T1S9Z7	Salmonella_phage	59.3	3.6e-194
WP_004152472.1|3155038_3155242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148721725.1|3155688_3155991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148721726.1|3156063_3156474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073520394.1|3156470_3157946_-|terminase	terminase	terminase	Q858H3	Salmonella_phage	92.4	9.3e-279
WP_004152523.1|3157942_3158527_-|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.1	2.4e-89
WP_004152524.1|3158604_3158862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152525.1|3158936_3159275_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	4.7e-45
WP_004152526.1|3159274_3159514_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	48.0	4.6e-10
WP_004152527.1|3159506_3160175_-	DUF551 domain-containing protein	NA	Q6UAT8	Klebsiella_phage	52.5	1.5e-05
WP_004141386.1|3160171_3160384_-	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	8.1e-11
WP_004152528.1|3160384_3160555_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	69.6	2.5e-15
WP_004152529.1|3160554_3161298_-	hypothetical protein	NA	A6N3G8	Burkholderia_virus	59.5	1.5e-19
WP_004152530.1|3161294_3161720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152531.1|3161716_3161908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152532.1|3161891_3162302_-	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	42.2	3.1e-14
WP_004152534.1|3162494_3162842_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	82.6	5.0e-50
WP_004152535.1|3162961_3163747_-	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.4	8.2e-133
WP_004207253.1|3163743_3164511_-	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
WP_004152537.1|3164510_3164720_-	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_004152538.1|3164866_3165100_-	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_004144290.1|3165253_3165835_+	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	7.1e-65
WP_004164037.1|3166053_3166203_+	hypothetical protein	NA	G9L6A5	Escherichia_phage	84.2	7.9e-13
WP_048981781.1|3166199_3167267_+	hypothetical protein	NA	A0A2H4JIB1	uncultured_Caudovirales_phage	76.5	2.9e-40
WP_047718663.1|3167274_3167574_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	4.7e-20
WP_059065285.1|3167570_3168470_+	YqaJ viral recombinase family protein	NA	Q858E0	Salmonella_phage	91.0	1.9e-157
WP_004152542.1|3168479_3169502_+	recombination protein RecT	NA	Q858E1	Salmonella_phage	95.3	2.4e-180
WP_004144294.1|3169552_3169801_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	78.0	2.8e-31
WP_040025490.1|3169910_3170204_+	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	70.1	8.9e-32
WP_073520395.1|3170196_3170355_+	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	76.9	4.3e-17
WP_073520396.1|3170351_3170858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073520397.1|3170854_3171451_+	adenine methylase	NA	T1SA14	Salmonella_phage	92.3	4.1e-108
WP_073520398.1|3171447_3171639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073520399.1|3171656_3172907_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	85.1	6.8e-206
WP_004151979.1|3173098_3174676_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_004151980.1|3174743_3176210_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
3175199:3175216	attR	CAGCGATAACCGGAATAC	NA	NA	NA	NA
>prophage 11
NZ_CP018356	Klebsiella pneumoniae strain CAV1453 chromosome, complete genome	5327855	4010978	4059820	5327855	tRNA,portal,head,tail,capsid,protease,terminase	uncultured_Caudovirales_phage(68.75%)	56	NA	NA
WP_002918465.1|4010978_4011473_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
WP_002918467.1|4011476_4012115_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_135801240.1|4012084_4012369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000829818.1|4012426_4012819_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002918559.1|4012834_4013263_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_004144945.1|4013528_4014656_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_002918565.1|4014846_4015245_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_002918566.1|4015418_4016786_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
WP_002918568.1|4016873_4017932_+	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_002918570.1|4018068_4019007_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_002918625.1|4019421_4019892_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_002918626.1|4020267_4020531_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918627.1|4020629_4020896_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918629.1|4020946_4021222_-	barstar family protein	NA	NA	NA	NA	NA
WP_002918632.1|4021301_4023269_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_002918639.1|4023274_4024207_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_002918640.1|4024214_4024418_-	AaeX family protein	NA	NA	NA	NA	NA
WP_002918641.1|4024549_4025479_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_002918642.1|4025514_4026960_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_004150952.1|4027048_4030846_-	AsmA2 domain-containing protein YhdP	NA	NA	NA	NA	NA
WP_002918644.1|4030883_4032353_-	ribonuclease G	NA	NA	NA	NA	NA
WP_002918646.1|4032355_4032937_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_002918648.1|4032944_4033433_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_004149974.1|4033432_4034425_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_002918653.1|4034495_4035539_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_002918686.1|4035844_4037785_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_002918687.1|4037864_4038056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002918688.1|4038284_4039286_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_002918689.1|4039285_4039894_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_002918732.1|4040117_4040570_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_002918736.1|4040592_4041060_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_002918738.1|4041070_4042420_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_002918740.1|4042530_4042773_+	YhdT family protein	NA	NA	NA	NA	NA
WP_002918742.1|4042762_4044214_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_002918745.1|4044225_4045107_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_004144972.1|4045464_4046430_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_000462905.1|4046454_4046751_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_004150954.1|4046904_4047096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150955.1|4047098_4048760_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
WP_000113647.1|4048743_4049100_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150957.1|4049230_4049383_-	hypothetical protein	NA	A0A2H4JCY9	uncultured_Caudovirales_phage	88.0	2.4e-17
WP_004150959.1|4049375_4049819_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_001547824.1|4049818_4050118_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150961.1|4050114_4050450_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_004150962.1|4050446_4051688_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_001547826.1|4051689_4052250_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_001549743.1|4052301_4053468_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_004150963.1|4053731_4054244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150964.1|4054291_4054627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|4054969_4057105_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_001549749.1|4057104_4057470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|4057466_4057835_-	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_004150967.1|4057831_4058146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549752.1|4058138_4058327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106918304.1|4058319_4058589_-	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_004150969.1|4059040_4059820_-	phage antirepressor KilAC domain-containing protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
>prophage 12
NZ_CP018356	Klebsiella pneumoniae strain CAV1453 chromosome, complete genome	5327855	5160481	5166306	5327855		Enterobacteria_phage(100.0%)	8	NA	NA
WP_004152202.1|5160481_5161048_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
WP_004152203.1|5161065_5161311_-	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_004152204.1|5161307_5162045_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
WP_000556592.1|5162605_5162872_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.0e-30
WP_004153681.1|5162868_5163417_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
WP_004152205.1|5163413_5163641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152206.1|5163637_5163958_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_004152207.1|5163972_5166306_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
>prophage 1
NZ_CP018355	Klebsiella pneumoniae strain CAV1453 plasmid pCAV1453-208, complete sequence	207543	0	12606	207543		uncultured_Caudovirales_phage(33.33%)	10	NA	NA
WP_004118344.1|310_1240_-	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_000025662.1|1244_1625_-	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_001378118.1|1664_2555_-	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_004152083.1|2560_4378_-	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001023257.1|4611_5061_+	copper resistance protein	NA	NA	NA	NA	NA
WP_004118669.1|5349_6087_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_000843497.1|6120_6318_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004098955.1|6358_8806_-	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
WP_000758228.1|8932_9373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004098958.1|9459_12606_-	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
>prophage 2
NZ_CP018355	Klebsiella pneumoniae strain CAV1453 plasmid pCAV1453-208, complete sequence	207543	15979	24483	207543	holin,transposase	Bacillus_phage(50.0%)	5	NA	NA
WP_001572351.1|15979_16660_+	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
WP_003032875.1|16652_18128_+	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_004178091.1|18378_18810_+	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_085955172.1|20238_21445_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
WP_004178088.1|22485_24483_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
>prophage 3
NZ_CP018355	Klebsiella pneumoniae strain CAV1453 plasmid pCAV1453-208, complete sequence	207543	29791	47004	207543	transposase,integrase	Macacine_betaherpesvirus(30.0%)	13	19541:19557	50602:50618
19541:19557	attL	CTCCAGCGCCTTTTGCT	NA	NA	NA	NA
WP_011977741.1|29791_30760_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.1	2.5e-184
WP_071527918.1|30779_31091_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152065.1|31117_32065_-	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	1.8e-12
WP_001515717.1|33208_33949_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_004152063.1|34665_35676_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	55.9	8.8e-87
WP_000523813.1|36427_37594_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	1.4e-224
WP_004152062.1|37593_38565_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.6	4.1e-150
WP_004152715.1|41516_42788_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	5.6e-155
WP_004178083.1|42787_43213_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	49.6	8.3e-31
WP_004178082.1|43615_45103_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004152753.1|45336_45567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118478.1|46087_46513_+	antirestriction protein	NA	NA	NA	NA	NA
WP_004152754.1|46749_47004_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	50.0	1.2e-11
50602:50618	attR	AGCAAAAGGCGCTGGAG	NA	NA	NA	NA
>prophage 4
NZ_CP018355	Klebsiella pneumoniae strain CAV1453 plasmid pCAV1453-208, complete sequence	207543	50141	54426	207543		Thalassomonas_phage(33.33%)	4	NA	NA
WP_004152645.1|50141_50705_+	methyltransferase	NA	A8HNV9	Thalassomonas_phage	34.1	1.3e-18
WP_004152644.1|51480_52023_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	76.7	6.0e-50
WP_004152643.1|52071_52320_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_004178066.1|52389_54426_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.0	9.0e-22
>prophage 5
NZ_CP018355	Klebsiella pneumoniae strain CAV1453 plasmid pCAV1453-208, complete sequence	207543	59846	63449	207543		Klebsiella_phage(25.0%)	7	NA	NA
WP_004152717.1|59846_60203_+	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	58.1	2.6e-25
WP_004152718.1|60263_60476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152719.1|60486_60711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152720.1|60791_61112_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	39.5	6.8e-09
WP_004152721.1|61101_61380_+	helix-turn-helix transcriptional regulator	NA	O64356	Escherichia_phage	39.4	2.5e-07
WP_004152722.1|61380_61794_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004178064.1|62627_63449_+	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	40.4	2.6e-44
>prophage 6
NZ_CP018355	Klebsiella pneumoniae strain CAV1453 plasmid pCAV1453-208, complete sequence	207543	97602	162176	207543	transposase,bacteriocin,integrase	Stx2-converting_phage(15.79%)	56	105608:105624	164626:164642
WP_004152303.1|97602_98328_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A1D6ZIU7	Xanthomonas_phage	29.4	5.5e-06
WP_004178053.1|98485_99082_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_004152301.1|99101_99449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152300.1|99663_100209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004178051.1|100565_102887_+|bacteriocin	klebicin B-related nuclease bacteriocin	bacteriocin	NA	NA	NA	NA
WP_004152296.1|102888_103167_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_009485932.1|103507_103987_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	35.2	9.8e-20
WP_004199332.1|104307_104586_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_004171457.1|104802_104880_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_004152292.1|104872_105730_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
105608:105624	attL	GCCACCGGCCGCTTCAT	NA	NA	NA	NA
WP_000093087.1|107176_109372_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_004152291.1|109368_110685_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_004152290.1|110688_112998_-	TerB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003846917.1|114703_115957_-	lactose permease	NA	NA	NA	NA	NA
WP_004152287.1|116008_119083_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.7	0.0e+00
WP_004152286.1|119204_120287_-	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	96.4	6.8e-186
WP_004152284.1|120747_121758_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_165765869.1|122091_122379_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004118251.1|122709_123003_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	96.9	2.7e-49
WP_004152282.1|123101_123869_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
WP_004152281.1|123869_124826_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	NA	NA	NA	NA
WP_004118243.1|124822_125821_-	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_004118241.1|125817_126720_-	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_004152280.1|126764_129089_-	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_004118237.1|129174_130128_-	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_004118235.1|130124_130646_-	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_161989521.1|131607_131820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118231.1|131748_131916_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_004118840.1|132200_133328_+	transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118229.1|133324_133918_+	ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_004152279.1|133914_134763_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004118227.1|134762_135683_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004152278.1|135695_137300_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118225.1|137344_138292_+	acetamidase/formamidase family protein	NA	A0A1V0S8X7	Catovirus	22.7	9.6e-11
WP_004118832.1|138299_140033_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	6.9e-15
WP_004152557.1|143855_144203_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.0e-59
WP_020956879.1|144199_144586_-|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	90.7	1.1e-58
WP_004118217.1|145133_145769_-	His-Xaa-Ser repeat protein HxsA	NA	NA	NA	NA	NA
WP_000005560.1|145765_146878_-	His-Xaa-Ser system radical SAM maturase HxsC	NA	S5WIP3	Leptospira_phage	33.8	1.5e-47
WP_004118216.1|146870_148259_-	His-Xaa-Ser system radical SAM maturase HxsB	NA	S5VT21	Leptospira_phage	29.0	6.3e-51
WP_176716597.1|148258_148498_-	His-Xaa-Ser system protein HxsD	NA	NA	NA	NA	NA
WP_000412211.1|149466_150126_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_000656305.1|150326_150704_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001138064.1|150770_153737_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000147567.1|153739_154300_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000454193.1|154425_154776_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|154978_155992_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001083725.1|156136_156634_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001336345.1|156745_157036_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001206356.1|157041_157833_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000679427.1|157996_158344_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|158337_159177_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376616.1|159304_159508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000184001.1|159663_160869_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|160879_161185_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|161411_162176_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
164626:164642	attR	GCCACCGGCCGCTTCAT	NA	NA	NA	NA
>prophage 7
NZ_CP018355	Klebsiella pneumoniae strain CAV1453 plasmid pCAV1453-208, complete sequence	207543	165514	183283	207543	transposase	Escherichia_phage(44.44%)	15	NA	NA
WP_004217321.1|165514_166219_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000018329.1|166369_167185_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_044117068.1|167374_168043_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	1.9e-130
WP_004217321.1|169346_170051_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_004153729.1|170906_171734_+	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	2.6e-20
WP_004152695.1|171730_172594_+	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152694.1|172602_173430_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_004152693.1|173438_174449_+	phosphonate dehydrogenase PtxD	NA	A0A1V0SBV6	Catovirus	25.1	1.4e-15
WP_004152692.1|174442_175312_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000019473.1|176520_177501_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004118209.1|178702_178966_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_004118208.1|178980_179244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152118.1|179487_179769_+	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
WP_004152117.1|179803_180373_+	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_004152116.1|180487_183283_+	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
>prophage 8
NZ_CP018355	Klebsiella pneumoniae strain CAV1453 plasmid pCAV1453-208, complete sequence	207543	192728	197035	207543		uncultured_Caudovirales_phage(100.0%)	5	NA	NA
WP_004152101.1|192728_193079_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
WP_004152100.1|193128_193491_+	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_004152099.1|193508_195260_+	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_004152098.1|195307_196597_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
WP_004152097.1|196609_197035_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
>prophage 9
NZ_CP018355	Klebsiella pneumoniae strain CAV1453 plasmid pCAV1453-208, complete sequence	207543	200492	201206	207543		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_004152093.1|200492_201206_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
>prophage 10
NZ_CP018355	Klebsiella pneumoniae strain CAV1453 plasmid pCAV1453-208, complete sequence	207543	205721	207122	207543		Bacillus_phage(100.0%)	1	NA	NA
WP_004152084.1|205721_207122_-	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
>prophage 1
NZ_CP018354	Klebsiella pneumoniae strain CAV1453 plasmid pCAV1453-46, complete sequence	45742	0	9663	45742	integrase,transposase	Escherichia_phage(40.0%)	8	2198:2212	13802:13816
WP_000339857.1|518_788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118283.1|964_1831_-	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
2198:2212	attL	GAGTCGCTCTCCAGA	NA	NA	NA	NA
WP_032409716.1|2360_2465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|3047_3752_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063840280.1|4102_4657_-	AAC(6')-Ib family aminoglycoside 6'-N-acetyltransferase	NA	NA	NA	NA	NA
WP_001217881.1|4890_5448_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_001143775.1|5609_8615_+|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	99.3	0.0e+00
WP_000015958.1|8886_9663_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
13802:13816	attR	GAGTCGCTCTCCAGA	NA	NA	NA	NA
>prophage 2
NZ_CP018354	Klebsiella pneumoniae strain CAV1453 plasmid pCAV1453-46, complete sequence	45742	16268	44641	45742	integrase,transposase	Salmonella_phage(28.57%)	25	15165:15224	36396:36523
15165:15224	attL	GGCTTTGTTGAATAAATCAGATTTCGGGTAAGTCTCCCCCGTAGCGGGTTGTGTTTTCAG	NA	NA	NA	NA
WP_000602738.1|16268_17021_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
WP_000742814.1|17442_18468_-	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
WP_001199192.1|18696_19473_-	aminoglycoside N-acetyltransferase AAC(3)-IVa	NA	NA	NA	NA	NA
WP_001067858.1|19588_20293_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_011264039.1|20365_20605_+	macrolide transporter	NA	A0A2K5B2B5	Erysipelothrix_phage	46.2	9.5e-08
WP_000612791.1|20750_21614_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
WP_001354008.1|21651_21897_+	GrpB family protein	NA	NA	NA	NA	NA
WP_000034420.1|22365_23157_+	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
WP_109023896.1|23159_23435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000800531.1|24336_24669_-	quaternary ammonium compound efflux SMR transporter QacL	NA	NA	NA	NA	NA
WP_001206316.1|24838_25630_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000095725.1|25722_26982_-	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
WP_001261740.1|27243_28035_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000050382.1|28092_28701_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_001456218.1|28796_29639_-	alpha/beta fold putative hydrolase EstX	NA	NA	NA	NA	NA
WP_000845048.1|29805_30819_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|31021_31372_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001161490.1|31547_32108_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_001138014.1|32111_35078_+|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
WP_001039464.1|35925_36312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_030005799.1|36451_37420_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	95.7	5.5e-179
36396:36523	attR	GGCTTTGTTGAATAAATCAGATTTCGGGTAAGTCTCCCCCGTAGCGGGTTGTGTTTTCAGGCAATACGCACGCTTTCAGGCATACCTGCTTTCGTCATTTTGTTCAGCGCTCGTACCAGGGCCATAGC	NA	NA	NA	NA
WP_004178082.1|39989_41477_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_000776034.1|41882_42314_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
WP_001754953.1|42313_43585_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	5.4e-150
WP_000064119.1|43666_44641_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.1	5.0e-87
