The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016916	Parageobacillus thermoglucosidasius strain TM242 chromosome, complete genome	3872522	266194	305518	3872522	transposase,protease	Catovirus(28.57%)	32	NA	NA
WP_042384667.1|266194_267523_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_042384668.1|267836_269765_-	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_099421472.1|270362_271559_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_042384671.1|271979_272663_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_042384673.1|272682_273051_+	DUF2304 domain-containing protein	NA	NA	NA	NA	NA
WP_041270157.1|273037_273406_+	EamA family transporter	NA	NA	NA	NA	NA
WP_042384675.1|273422_274688_+	membrane protein	NA	NA	NA	NA	NA
WP_042384703.1|275149_276040_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_042384676.1|276231_276618_-	toxin MazF	NA	NA	NA	NA	NA
WP_042384678.1|276617_276926_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003247869.1|277576_278047_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_153017391.1|278183_278336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080695333.1|278381_279104_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	41.5	4.7e-34
WP_042384708.1|279104_280610_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_035501703.1|280795_281035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072000118.1|281391_281706_+	hypothetical protein	NA	U5N3V8	Enterobacteria_phage	39.8	2.5e-08
WP_003247858.1|282798_283827_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	51.1	3.6e-96
WP_003247857.1|283851_284982_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_042384681.1|285226_286381_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_003247854.1|287883_288684_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	47.1	6.4e-16
WP_003247852.1|288694_289741_-	EpsG family protein	NA	NA	NA	NA	NA
WP_003247850.1|290369_291344_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	33.7	1.9e-06
WP_003247848.1|291458_292886_-	flippase	NA	NA	NA	NA	NA
WP_081308685.1|293621_294359_-	exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase	NA	NA	NA	NA	NA
WP_065868237.1|295892_297083_-|transposase	ISL3 family transposase	transposase	A0A0A8WEF4	Clostridium_phage	24.7	1.3e-28
WP_050946910.1|297264_297546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157776782.1|297633_297969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157777052.1|297896_298199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035501701.1|298703_299639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003247843.1|299650_301231_-	O-antigen polymerase	NA	NA	NA	NA	NA
WP_035501699.1|301249_301735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097948914.1|304359_305518_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	43.4	3.2e-32
>prophage 2
NZ_CP016916	Parageobacillus thermoglucosidasius strain TM242 chromosome, complete genome	3872522	946273	956073	3872522		Synechococcus_phage(50.0%)	9	NA	NA
WP_003253332.1|946273_947569_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	35.2	3.5e-19
WP_042384021.1|947645_948368_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	43.0	9.2e-46
WP_013401753.1|948360_948615_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	A0A0E3FKD5	Synechococcus_phage	38.3	1.9e-06
WP_003253326.1|948611_949298_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_013401752.1|949281_951510_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	42.5	5.3e-169
WP_042384018.1|951485_952898_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.6	8.6e-48
WP_042384016.1|952912_953953_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	44.1	2.0e-70
WP_013401749.1|953949_954519_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.2	1.9e-30
WP_042384014.1|954534_956073_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	53.0	3.3e-77
>prophage 3
NZ_CP016916	Parageobacillus thermoglucosidasius strain TM242 chromosome, complete genome	3872522	1523336	1547434	3872522	transposase,integrase	Brevibacillus_phage(40.0%)	29	1519520:1519535	1555477:1555492
1519520:1519535	attL	TATTCGTACAAAAAAC	NA	NA	NA	NA
WP_052518160.1|1523336_1523651_-|integrase	site-specific integrase	integrase	S5MNZ2	Brevibacillus_phage	66.3	2.3e-25
WP_052518158.1|1523634_1524558_-|integrase	tyrosine-type recombinase/integrase	integrase	S5MNZ2	Brevibacillus_phage	37.6	3.2e-43
WP_042383584.1|1525862_1526048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155267339.1|1526157_1526334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042383583.1|1526401_1526611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042383582.1|1526588_1526828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155267338.1|1527284_1527428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042383580.1|1527770_1528238_+	hypothetical protein	NA	A0A0N6W8H7	Bacillus_phage	53.5	1.1e-36
WP_072000104.1|1528398_1528773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042383579.1|1528980_1529172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042383578.1|1529196_1529625_+	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	65.2	1.6e-45
WP_042383572.1|1531254_1531647_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_045844641.1|1531827_1533066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042383568.1|1533648_1534926_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_157777065.1|1535496_1536078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042383719.1|1536228_1536816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052518154.1|1536835_1537570_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_052518151.1|1537563_1538055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042383566.1|1538056_1539316_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_125010315.1|1539558_1539981_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155267337.1|1540088_1540229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003252231.1|1540290_1540530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042383563.1|1540572_1540932_-	response regulator	NA	NA	NA	NA	NA
WP_003252226.1|1541513_1542026_+	DUF3231 family protein	NA	NA	NA	NA	NA
WP_065868249.1|1542402_1543638_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	62.3	2.0e-141
WP_035502272.1|1544381_1544642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042384991.1|1544978_1545899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003252218.1|1546519_1547008_+	DUF1648 domain-containing protein	NA	NA	NA	NA	NA
WP_080561277.1|1547296_1547434_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
1555477:1555492	attR	GTTTTTTGTACGAATA	NA	NA	NA	NA
>prophage 4
NZ_CP016916	Parageobacillus thermoglucosidasius strain TM242 chromosome, complete genome	3872522	3185556	3196363	3872522		Pandoravirus(25.0%)	13	NA	NA
WP_003249589.1|3185556_3186576_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	41.7	8.6e-66
WP_042384049.1|3186568_3188095_-	anthranilate synthase component I	NA	A0A0B5J984	Pandoravirus	29.8	1.0e-30
WP_042384172.1|3188279_3188684_-	chorismate mutase	NA	NA	NA	NA	NA
WP_013876725.1|3188692_3189796_-	3-dehydroquinate synthase	NA	E5ERI4	Ostreococcus_lucimarinus_virus	24.6	4.1e-21
WP_013876724.1|3189795_3190962_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	36.7	1.8e-43
WP_013400511.1|3191080_3191854_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_003249570.1|3191982_3192429_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	45.8	1.4e-28
WP_013400510.1|3192528_3193494_-	heptaprenyl diphosphate synthase component II	NA	A0A1V0SE37	Indivirus	24.4	7.8e-08
WP_013400509.1|3193508_3194213_-	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_003249566.1|3194217_3195033_-	heptaprenyl diphosphate synthase component 1	NA	NA	NA	NA	NA
WP_003249564.1|3195123_3195348_-	trp RNA-binding attenuation protein MtrB	NA	NA	NA	NA	NA
WP_013400508.1|3195382_3195949_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	55.4	2.2e-50
WP_003249561.1|3196090_3196363_-	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	72.2	1.3e-29
>prophage 5
NZ_CP016916	Parageobacillus thermoglucosidasius strain TM242 chromosome, complete genome	3872522	3258826	3268629	3872522		Staphylococcus_phage(44.44%)	13	NA	NA
WP_042384113.1|3258826_3259966_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	34.2	8.5e-22
WP_042384115.1|3260159_3261071_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	43.1	6.2e-39
WP_052518169.1|3261314_3261626_+	DUF2935 domain-containing protein	NA	A0A2I2L551	Orpheovirus	41.7	7.5e-13
WP_013876686.1|3261669_3262149_-	DUF3907 family protein	NA	NA	NA	NA	NA
WP_003249426.1|3262184_3262604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003249425.1|3262667_3263258_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	39.2	3.9e-18
WP_013876685.1|3263244_3264015_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	42.1	3.9e-10
WP_003249423.1|3264131_3264647_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003249422.1|3264659_3265007_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_042384118.1|3265126_3265594_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	63.5	4.2e-44
WP_042384121.1|3265666_3266860_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	53.8	1.6e-116
WP_042384123.1|3266880_3267528_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	48.8	1.3e-43
WP_003249415.1|3267543_3268629_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	37.5	7.0e-58
>prophage 6
NZ_CP016916	Parageobacillus thermoglucosidasius strain TM242 chromosome, complete genome	3872522	3770682	3779093	3872522	holin	Staphylococcus_phage(57.14%)	12	NA	NA
WP_003248519.1|3770682_3772269_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	63.8	9.9e-194
WP_003248518.1|3772297_3772540_-	DUF2584 domain-containing protein	NA	NA	NA	NA	NA
WP_003248515.1|3772569_3773358_-	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	39.4	7.9e-35
WP_003248509.1|3773458_3774457_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003248508.1|3774475_3775249_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.9	1.3e-34
WP_013400212.1|3775232_3776042_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_013400211.1|3776056_3776518_-	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	36.0	1.4e-18
WP_003248503.1|3776612_3776936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013400210.1|3777009_3777405_-|holin	phage holin family protein	holin	A0A0N7GFE6	Paenibacillus_phage	47.5	1.7e-25
WP_003248499.1|3777529_3777970_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	76.0	2.2e-58
WP_003248497.1|3778222_3778696_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_013400209.1|3778862_3779093_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	65.8	4.5e-23
>prophage 1
NZ_CP016917	Parageobacillus thermoglucosidasius strain TM242 plasmid pNCI001, complete sequence	83925	33012	81358	83925	transposase,bacteriocin,integrase	uncultured_virus(30.0%)	44	34824:34845	62271:62292
WP_008880572.1|33012_34182_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	35.6	5.3e-27
34824:34845	attL	AAGAAATAAACGTTGGTTGATT	NA	NA	NA	NA
WP_013401939.1|35035_35323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013401940.1|35306_36104_-	ParA family protein	NA	A0A0K2FLP4	Brevibacillus_phage	48.5	1.8e-66
WP_157777100.1|36167_36320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042385971.1|36346_37750_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_042385973.1|37967_39083_+	DUF917 domain-containing protein	NA	NA	NA	NA	NA
WP_042385974.1|39086_40478_+	hydantoinase	NA	NA	NA	NA	NA
WP_013401944.1|40551_41868_+	cytosine permease	NA	NA	NA	NA	NA
WP_013401945.1|41884_42982_+	DUF917 domain-containing protein	NA	NA	NA	NA	NA
WP_042385977.1|42978_44538_+	hydantoinase/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_013401947.1|44799_45330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013401948.1|45474_45696_+	DUF1659 domain-containing protein	NA	NA	NA	NA	NA
WP_013401949.1|45710_45923_+	DUF2922 domain-containing protein	NA	NA	NA	NA	NA
WP_013401950.1|45975_46125_+	YvrJ family protein	NA	NA	NA	NA	NA
WP_013878200.1|46143_46623_+	M15 family metallopeptidase	NA	A0A0H3V0Q8	Geobacillus_virus	55.3	7.4e-44
WP_042385980.1|47229_47799_+|integrase	site-specific integrase	integrase	A0A1B1P7Y2	Bacillus_phage	46.8	9.2e-33
WP_042385981.1|48996_50157_+	replication initiation protein	NA	A0A218MNI2	uncultured_virus	25.8	1.4e-08
WP_042385984.1|50422_50665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042385990.1|51208_52123_+	catechol 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_042385992.1|52158_52365_+	4-oxalocrotonate tautomerase family protein	NA	NA	NA	NA	NA
WP_042385995.1|52543_53746_+	flavin-dependent monooxygenase	NA	NA	NA	NA	NA
WP_042386002.1|53907_54393_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_042386008.1|54608_54911_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_042386010.1|54922_56851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099092721.1|57190_57982_+	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
WP_042386013.1|58021_58906_+	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	35.0	8.0e-44
WP_042386016.1|58921_59950_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	35.9	1.5e-49
WP_042386025.1|59970_60762_+	4-oxalocrotonate decarboxylase	NA	NA	NA	NA	NA
WP_013401954.1|60825_61506_+	esterase	NA	NA	NA	NA	NA
WP_157777101.1|62062_62203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157777102.1|65495_65648_+	hypothetical protein	NA	NA	NA	NA	NA
62271:62292	attR	AATCAACCAACGTTTATTTCTT	NA	NA	NA	NA
WP_013401956.1|66141_66423_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013401957.1|66443_66866_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_013401958.1|67289_67493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013401959.1|69776_70079_+	DUF2089 family protein	NA	NA	NA	NA	NA
WP_013401960.1|70081_70366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041269328.1|70465_71356_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_013401961.1|71704_71851_-|bacteriocin	aureocin A53 family class IId bacteriocin	bacteriocin	NA	NA	NA	NA
WP_013401962.1|72428_72929_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_013401963.1|72947_74435_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_013401964.1|75497_76451_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	36.4	9.9e-40
WP_013401966.1|77640_78039_+	DUF4064 domain-containing protein	NA	NA	NA	NA	NA
WP_065868250.1|78345_79515_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	35.6	9.1e-27
WP_042386297.1|80170_81358_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	28.3	1.1e-27
