The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018450	Klebsiella pneumoniae strain Kp_Goe_71070 chromosome, complete genome	5497083	1142479	1208946	5497083	integrase,terminase,plate,tail,lysis,tRNA,portal,capsid,head	Salmonella_phage(76.09%)	77	1162280:1162326	1197572:1197618
WP_032418442.1|1142479_1143355_-|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
WP_071844616.1|1144308_1144473_+	type II toxin-antitoxin system CcdA family antitoxin	NA	NA	NA	NA	NA
WP_032418443.1|1145316_1146675_-	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_123836165.1|1146684_1147230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032418444.1|1147251_1147701_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	63.8	1.8e-44
WP_032418445.1|1148074_1148233_-	hypothetical protein	NA	A0A218M4L1	Erwinia_phage	68.0	3.2e-12
WP_071844617.1|1148717_1148924_-	hypothetical protein	NA	A0A1B5FPB7	Escherichia_phage	55.3	7.4e-09
WP_032418447.1|1149364_1150378_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_032418448.1|1150388_1151369_-	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_032418449.1|1151365_1151740_-	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_032418451.1|1151736_1152258_-	PTS glucitol/sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_032418453.1|1152370_1152655_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	64.7	4.6e-17
WP_087757875.1|1152749_1153106_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_073546842.1|1153424_1155494_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	34.6	8.7e-73
WP_032418458.1|1155529_1155745_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_032418459.1|1156226_1160030_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_032418460.1|1160218_1160866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032418461.1|1160867_1162115_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	61.8	8.5e-140
1162280:1162326	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_032418462.1|1162411_1163458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000155498.1|1163447_1164488_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	92.7	1.7e-189
WP_031591564.1|1164491_1165124_-	helix-turn-helix domain-containing protein	NA	A0A1S6KZZ7	Salmonella_phage	57.1	3.8e-64
WP_000102105.1|1165240_1165483_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
WP_031591568.1|1165515_1166025_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	94.7	3.9e-83
WP_000956190.1|1166032_1166233_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	100.0	2.4e-33
WP_031591570.1|1166196_1166538_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	97.3	1.7e-55
WP_016529331.1|1166605_1166839_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	1.2e-31
WP_031591572.1|1166838_1167066_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	97.3	3.0e-35
WP_031591574.1|1167062_1167920_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.1	1.1e-159
WP_031591576.1|1167916_1170331_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.6	0.0e+00
WP_001154434.1|1170484_1170673_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217575.1|1170683_1170917_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_000700647.1|1171031_1171709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000497736.1|1171987_1173139_+	TIGR02391 family protein	NA	NA	NA	NA	NA
WP_032418464.1|1173190_1174225_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	87.3	5.9e-171
WP_031591583.1|1174224_1175991_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.1	0.0e+00
WP_002895967.1|1176133_1176967_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_031591585.1|1176983_1178042_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.9e-180
WP_000059191.1|1178045_1178696_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_031591589.1|1178791_1179256_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	1.1e-76
WP_031591593.1|1179255_1179459_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	91.0	5.2e-31
WP_000171568.1|1179462_1179678_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_031591597.1|1179658_1180174_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.8	4.0e-88
WP_031591599.1|1180170_1180599_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	91.5	1.5e-59
WP_001039947.1|1180694_1181126_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.0	1.3e-71
WP_031591600.1|1181118_1181583_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	83.6	5.5e-60
WP_031591601.1|1181670_1183182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031591602.1|1183308_1183887_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	1.6e-93
WP_031591604.1|1183883_1184243_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	86.6	9.5e-52
WP_031591606.1|1184229_1185138_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	4.6e-143
WP_001086836.1|1185130_1185736_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	1.5e-110
WP_031591609.1|1185732_1187454_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	78.9	3.5e-152
WP_050486392.1|1187453_1187636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077255116.1|1187616_1187769_-|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	71.1	5.8e-11
WP_032418466.1|1188432_1188999_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	85.2	2.1e-85
WP_031591343.1|1189141_1190314_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	89.2	2.5e-202
WP_001504081.1|1190323_1190839_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	94.7	4.8e-89
WP_001281009.1|1190893_1191196_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_000763311.1|1191210_1191330_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_032418469.1|1191322_1194400_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.3	0.0e+00
WP_016529761.1|1194396_1194882_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	4.8e-67
WP_032418471.1|1194878_1195979_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	86.9	4.2e-175
WP_000972389.1|1196069_1196288_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
WP_000380485.1|1196549_1196723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031591352.1|1196691_1197465_+	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_002914164.1|1198079_1198562_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
1197572:1197618	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_071549035.1|1198672_1199149_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_004145682.1|1199138_1199429_+	RnfH family protein	NA	NA	NA	NA	NA
WP_002914160.1|1199495_1199837_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_004174799.1|1199984_1201646_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914158.1|1201732_1202611_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_004174800.1|1202735_1203326_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_004149392.1|1203446_1204733_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914153.1|1204752_1205544_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_002914152.1|1205707_1207072_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914149.1|1207331_1207580_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_004150977.1|1207598_1208147_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_073546843.1|1208178_1208946_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP018450	Klebsiella pneumoniae strain Kp_Goe_71070 chromosome, complete genome	5497083	1310930	1325735	5497083	integrase	Morganella_phage(22.22%)	20	1295793:1295808	1330968:1330983
1295793:1295808	attL	GCGCTGCCGGGGATCC	NA	NA	NA	NA
WP_029602776.1|1310930_1312199_+|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	60.8	3.3e-147
WP_004866318.1|1312206_1313160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004866314.1|1313286_1313505_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_029602778.1|1313504_1313936_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	48.9	3.1e-25
WP_032730932.1|1313949_1314759_+	antA/AntB antirepressor family protein	NA	A0A0R6PJV6	Moraxella_phage	54.5	3.5e-30
WP_073546847.1|1314751_1314931_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_110109932.1|1315577_1315772_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_004213164.1|1315764_1315944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032418506.1|1315940_1316444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032418508.1|1316440_1316650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032418509.1|1316646_1317273_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	37.8	1.8e-26
WP_032418510.1|1317282_1317633_+	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	69.1	8.9e-39
WP_032418512.1|1317625_1320076_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	38.0	1.1e-138
WP_048265897.1|1320383_1320782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032418513.1|1320778_1321225_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_055314482.1|1321238_1321511_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_162900878.1|1321580_1321901_+	superinfection immunity protein	NA	A0A0S2SY85	Pseudomonas_phage	45.4	3.9e-17
WP_032421631.1|1321930_1322308_+	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	44.7	1.1e-21
WP_004140789.1|1322602_1322929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073546849.1|1322936_1325735_+	tape measure protein	NA	A0A1B1W284	Salmonella_phage	32.4	7.7e-48
1330968:1330983	attR	GCGCTGCCGGGGATCC	NA	NA	NA	NA
>prophage 3
NZ_CP018450	Klebsiella pneumoniae strain Kp_Goe_71070 chromosome, complete genome	5497083	1333731	1368243	5497083	integrase,terminase,tail	Salmonella_phage(44.44%)	42	1334197:1334210	1338878:1338891
WP_032418525.1|1333731_1335198_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.5e-87
1334197:1334210	attL	AAAGAGCGTCTGGT	NA	NA	NA	NA
WP_004151979.1|1335265_1336843_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_032418526.1|1337034_1338288_+|integrase	site-specific integrase	integrase	A0A1X9TCT6	Enterobacter_phage	83.6	3.5e-202
WP_032418527.1|1338549_1339212_-	metallophosphoesterase	NA	K7P6H8	Enterobacteria_phage	75.5	4.7e-97
1338878:1338891	attR	ACCAGACGCTCTTT	NA	NA	NA	NA
WP_032418529.1|1339208_1339811_-	adenine methylase	NA	A0A193GYV6	Enterobacter_phage	92.4	4.0e-103
WP_023285452.1|1339807_1340314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009485474.1|1340310_1340469_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	80.8	8.7e-18
WP_009485475.1|1340461_1340755_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	4.0e-32
WP_004144294.1|1340864_1341113_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	78.0	2.8e-31
WP_032418530.1|1341163_1342186_-	recombination protein RecT	NA	Q858E1	Salmonella_phage	95.3	4.0e-180
WP_004144292.1|1342195_1343095_-	YqaJ viral recombinase family protein	NA	Q858E0	Salmonella_phage	91.0	6.5e-158
WP_004164029.1|1343091_1343391_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
WP_004164037.1|1343387_1343537_-	hypothetical protein	NA	G9L6A5	Escherichia_phage	84.2	7.9e-13
WP_004144290.1|1343757_1344339_-	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	7.1e-65
WP_004152538.1|1344493_1344727_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_004152537.1|1344873_1345083_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_004207253.1|1345082_1345850_+	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
WP_032418532.1|1345846_1346632_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.7	3.7e-133
WP_032418534.1|1346751_1347099_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	81.7	1.9e-49
WP_032419436.1|1347291_1347693_+	hypothetical protein	NA	A0A2H4N7F5	Pectobacterium_phage	51.6	8.7e-22
WP_025860565.1|1347764_1347974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032418536.1|1347970_1348225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032419437.1|1348224_1348488_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	65.5	3.5e-27
WP_032418538.1|1349181_1349421_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	51.7	8.6e-09
WP_032418539.1|1349420_1349759_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	79.1	3.1e-44
WP_032418540.1|1349833_1350091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032418541.1|1350168_1350753_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.6	9.9e-91
WP_032418542.1|1350749_1352225_+	hypothetical protein	NA	Q858H3	Salmonella_phage	92.4	2.4e-279
WP_032413826.1|1352267_1352639_-	phage family protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	93.5	6.8e-61
WP_004152472.1|1353436_1353640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004149313.1|1353643_1355323_+|tail	tail protein	tail	T1S9Z7	Salmonella_phage	59.3	3.6e-194
WP_004152470.1|1355319_1355625_+	hypothetical protein	NA	Q2A090	Sodalis_phage	51.3	1.1e-16
WP_004152468.1|1355906_1356305_+	peptidase	NA	T1SAP9	Salmonella_phage	59.5	5.6e-37
WP_004197367.1|1356317_1357325_+	bbp17	NA	T1S9H9	Salmonella_phage	92.8	2.1e-181
WP_004152466.1|1357334_1357727_+	hypothetical protein	NA	T1SA71	Salmonella_phage	89.9	1.5e-55
WP_024622837.1|1357719_1357998_+	hypothetical protein	NA	T1SA01	Salmonella_phage	58.9	1.1e-20
WP_004197381.1|1358046_1358658_+	hypothetical protein	NA	T1SAQ2	Salmonella_phage	48.8	9.2e-47
WP_032418543.1|1358657_1361135_+	hypothetical protein	NA	G9L6D0	Escherichia_phage	56.4	2.3e-266
WP_032418545.1|1361136_1361607_+	hypothetical protein	NA	Q858G2	Salmonella_phage	55.3	9.5e-44
WP_025860587.1|1361599_1362097_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	41.7	8.9e-24
WP_032418548.1|1362109_1364854_+	bacteriophage protein	NA	A0A193GYI3	Enterobacter_phage	39.7	3.9e-97
WP_032418549.1|1364853_1368243_+	hypothetical protein	NA	G9L6D4	Escherichia_phage	42.0	2.4e-120
>prophage 4
NZ_CP018450	Klebsiella pneumoniae strain Kp_Goe_71070 chromosome, complete genome	5497083	1790805	1799184	5497083		Enterobacteria_phage(28.57%)	8	NA	NA
WP_032418677.1|1790805_1792212_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	1.8e-37
WP_032418679.1|1792434_1793499_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	4.4e-105
WP_004175258.1|1793525_1794395_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	5.7e-111
WP_004175259.1|1794426_1795317_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	2.8e-28
WP_021313307.1|1795331_1795886_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	1.9e-51
WP_004175261.1|1796065_1797232_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	4.1e-112
WP_032409012.1|1797657_1797780_-	small membrane protein	NA	NA	NA	NA	NA
WP_004175262.1|1798179_1799184_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	1.8e-31
>prophage 5
NZ_CP018450	Klebsiella pneumoniae strain Kp_Goe_71070 chromosome, complete genome	5497083	1922418	2056487	5497083	integrase,terminase,plate,tail,holin,tRNA,portal,capsid,head,protease	Enterobacteria_phage(22.22%)	149	1975181:1975199	2012929:2012947
WP_000059623.1|1922418_1923681_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	39.3	4.8e-74
WP_002911729.1|1924248_1925166_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_032418726.1|1925272_1926223_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_064147810.1|1926301_1927243_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_004141160.1|1927621_1928542_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002911718.1|1928682_1929072_+	RidA family protein	NA	NA	NA	NA	NA
WP_004227143.1|1929737_1930538_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_004184758.1|1930830_1931823_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	87.2	4.9e-175
WP_032418728.1|1931824_1932052_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	78.4	3.8e-30
WP_050598702.1|1932359_1933268_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	61.6	9.8e-45
WP_055314381.1|1933260_1934337_-	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	74.1	2.1e-147
WP_032418730.1|1934464_1935250_-	hypothetical protein	NA	A4JX52	Burkholderia_virus	50.2	1.4e-60
WP_032418731.1|1935249_1935549_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	46.7	3.8e-14
WP_032418732.1|1935636_1936554_-	recombination-associated protein RdgC	NA	A0A1W6JP69	Morganella_phage	36.9	3.1e-46
WP_016530207.1|1937000_1937660_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	62.7	7.3e-74
WP_016530206.1|1937752_1937950_+	Cro/Cl family transcriptional regulator	NA	H9C161	Pectobacterium_phage	66.1	2.7e-16
WP_004213338.1|1937975_1938437_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.2	1.7e-69
WP_001208720.1|1938674_1938854_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	73.1	4.6e-15
WP_032418734.1|1938843_1939812_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	66.4	1.0e-84
WP_032418735.1|1940017_1940842_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	69.5	2.6e-113
WP_032418736.1|1940851_1941229_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	72.8	3.3e-47
WP_032418737.1|1941241_1942222_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	67.2	8.4e-135
WP_032418738.1|1942235_1942814_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	56.7	1.7e-50
WP_032418739.1|1942965_1943205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057182115.1|1943375_1943675_+|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	84.8	1.5e-39
WP_032418741.1|1943671_1944211_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	2.0e-101
WP_032418742.1|1944207_1944555_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	81.7	2.1e-40
WP_032418743.1|1944551_1944827_+	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	70.3	3.9e-05
WP_032418744.1|1944777_1944972_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	87.3	4.6e-21
WP_022065473.1|1945329_1945575_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	98.8	1.6e-34
WP_032419453.1|1946086_1946437_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	80.7	4.6e-51
WP_004884285.1|1946568_1947063_+|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	92.0	1.2e-81
WP_032418747.1|1947059_1948790_+|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	83.4	9.2e-302
WP_004899640.1|1948984_1950214_+|portal	phage portal protein	portal	U5P411	Shigella_phage	81.5	1.7e-201
WP_004884313.1|1950200_1950854_+|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	87.4	2.1e-105
WP_021313628.1|1950868_1952077_+|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	84.5	9.9e-194
WP_021313627.1|1952115_1952319_+	hypothetical protein	NA	M1FN89	Enterobacteria_phage	42.4	1.4e-07
WP_021313626.1|1952315_1952636_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	43.1	4.8e-15
WP_032408655.1|1952644_1952983_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	74.1	1.4e-41
WP_019705270.1|1952979_1953429_+	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	82.6	6.7e-63
WP_016530186.1|1953425_1953773_+	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	63.7	2.8e-32
WP_021313623.1|1953829_1954534_+	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	66.9	2.5e-80
WP_029497345.1|1954564_1954969_+|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	56.9	3.2e-32
WP_032418748.1|1954971_1955277_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	63.6	1.4e-27
WP_016530182.1|1955350_1955584_+	hypothetical protein	NA	K7PH16	Enterobacteria_phage	47.2	1.9e-08
WP_032418749.1|1955644_1959031_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	57.9	2.5e-303
WP_023301979.1|1959051_1959525_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	60.8	4.6e-54
WP_021313618.1|1959511_1959997_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	66.2	3.0e-53
WP_021313617.1|1960006_1960387_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	80.2	2.1e-57
WP_032418750.1|1960383_1963467_+	kinase	NA	A0A286S259	Klebsiella_phage	71.9	0.0e+00
WP_032419560.1|1965790_1966081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124036758.1|1966291_1968028_-	hypothetical protein	NA	A0A2H5BNQ4	Klebsiella_phage	76.7	7.1e-262
WP_032418751.1|1968151_1968730_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	93.4	2.2e-90
WP_004892499.1|1968780_1969203_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	44.5	1.8e-25
WP_004216505.1|1969614_1969854_+	hypothetical protein	NA	I6PD82	Cronobacter_phage	54.4	7.5e-21
WP_032418752.1|1969856_1970183_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	53.9	1.6e-26
WP_002911596.1|1970786_1971932_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.7	1.1e-117
WP_004151461.1|1972470_1972752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002911594.1|1972794_1973502_+	phosphohydrolase	NA	S4W232	Pandoravirus	27.7	2.8e-07
WP_073546856.1|1973578_1974979_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.7	1.9e-100
WP_032419454.1|1974959_1975454_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	50.7	9.7e-31
1975181:1975199	attL	TCTGTTTAAGGTGCCGGCC	NA	NA	NA	NA
WP_004184683.1|1975428_1976340_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_002911591.1|1976523_1977435_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_032418754.1|1977549_1979229_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	41.1	3.1e-20
WP_002911589.1|1979528_1979750_-	YodD family protein	NA	NA	NA	NA	NA
WP_002911586.1|1979883_1980075_+	protein DsrB	NA	NA	NA	NA	NA
WP_002911561.1|1980107_1980731_-	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_004189223.1|1981103_1981538_+	lipoprotein	NA	NA	NA	NA	NA
WP_004189225.1|1981579_1983067_-	alpha-amylase	NA	NA	NA	NA	NA
WP_004141135.1|1983267_1984068_+	cystine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004180445.1|1984163_1985150_+	D-cysteine desulfhydrase	NA	NA	NA	NA	NA
WP_002911547.1|1985165_1985834_+	cystine ABC transporter permease	NA	NA	NA	NA	NA
WP_004151455.1|1985830_1986583_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.4	2.2e-26
WP_002911542.1|1986900_1987623_+	transcriptional regulator SdiA	NA	NA	NA	NA	NA
WP_002911541.1|1987690_1987915_-	DUF2594 family protein	NA	NA	NA	NA	NA
WP_002911539.1|1988376_1989033_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_002911538.1|1989029_1990862_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_002911537.1|1990919_1991468_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_032418755.1|1992041_1993049_-|integrase	tyrosine-type recombinase/integrase	integrase	Q1I119	Pasteurella_virus	56.5	1.3e-103
WP_050598706.1|1993045_1993912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032418756.1|1993928_1994558_-	membrane protein	NA	NA	NA	NA	NA
WP_077261143.1|1994567_1994996_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JFL3	uncultured_Caudovirales_phage	38.5	1.0e-07
WP_032418759.1|1995268_1995472_+	hypothetical protein	NA	P79674	Haemophilus_phage	37.1	6.4e-05
WP_050598721.1|1995694_1995892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032418760.1|1995908_1996307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032418761.1|1996316_1996589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032418762.1|1996657_1996882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032418763.1|1996878_1997457_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	41.1	3.2e-33
WP_032418764.1|1997465_1997693_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	49.0	5.5e-05
WP_032418765.1|1997689_1997884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032418766.1|1997876_1998830_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	56.3	3.6e-82
WP_162900880.1|1998829_1999003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156851987.1|1999013_1999169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032418767.1|1999144_2000161_+	DNA cytosine methyltransferase	NA	Q6J1P4	Burkholderia_virus	55.1	1.9e-97
WP_032418768.1|2000153_2002748_+	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	52.4	1.2e-196
WP_032418769.1|2002944_2003946_+	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_032418771.1|2004681_2005728_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	69.1	5.8e-142
WP_032418772.1|2005727_2007449_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	66.2	6.2e-226
WP_032418773.1|2007609_2008443_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	65.6	1.1e-95
WP_032418774.1|2008467_2009517_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	55.0	5.7e-105
WP_032418775.1|2009564_2010464_+|terminase	terminase	terminase	B9A7B6	Serratia_phage	77.0	3.5e-87
WP_032418776.1|2010566_2011064_+|head	head completion/stabilization protein	head	B9A7B7	Serratia_phage	71.5	1.2e-60
WP_032418777.1|2011063_2011264_+|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	64.6	6.7e-15
WP_032418778.1|2011254_2011536_+	hypothetical protein	NA	B9A7B8	Serratia_phage	57.1	1.1e-18
WP_032418779.1|2011532_2012084_+	lysozyme	NA	Q1I0Z1	Pasteurella_virus	41.3	9.2e-30
WP_050598707.1|2012080_2012476_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_032418780.1|2012620_2013079_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	48.1	6.2e-32
2012929:2012947	attR	TCTGTTTAAGGTGCCGGCC	NA	NA	NA	NA
WP_032418781.1|2013075_2013717_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	48.3	1.5e-44
WP_032418782.1|2013716_2014295_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	62.6	5.1e-63
WP_032418783.1|2014291_2014660_+	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	58.3	2.3e-29
WP_032418784.1|2014646_2015546_+|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	60.9	6.2e-92
WP_032418785.1|2015538_2016135_+|tail	phage tail protein I	tail	A0A0M4R4W9	Salmonella_phage	46.3	1.5e-41
WP_032418787.1|2019518_2020676_+|tail	phage tail protein	tail	S4TP62	Salmonella_phage	49.8	2.5e-45
WP_032418788.1|2020803_2021292_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	65.0	1.6e-49
WP_032418789.1|2021303_2024243_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	44.2	2.6e-208
WP_101972624.1|2024223_2024400_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	69.8	1.5e-10
WP_032418790.1|2024396_2024696_-	hypothetical protein	NA	B9A7B2	Serratia_phage	73.7	3.1e-32
WP_032418791.1|2024750_2025266_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	70.0	2.6e-63
WP_032418792.1|2025265_2026447_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0A7NV69	Enterobacteria_phage	69.3	1.2e-156
WP_032418793.1|2026600_2027755_+	phage late control D family protein	NA	B9A7A9	Serratia_phage	80.7	4.2e-178
WP_044785060.1|2027799_2028048_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_004180444.1|2028434_2029316_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_023316206.1|2029414_2030083_+	YecA family protein	NA	NA	NA	NA	NA
WP_004151453.1|2030107_2031319_-	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_004175410.1|2031510_2031750_+	YecH family protein	NA	NA	NA	NA	NA
WP_004141101.1|2031785_2032283_-	non-heme ferritin	NA	NA	NA	NA	NA
WP_020956668.1|2032340_2032520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002911524.1|2034383_2034635_+	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_002911522.1|2034672_2036184_-	MFS transporter	NA	NA	NA	NA	NA
WP_004148869.1|2036249_2036408_+	succinate dehydrogenase	NA	NA	NA	NA	NA
WP_004175413.1|2036478_2036988_-	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_160525722.1|2037422_2037521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002911518.1|2037882_2038863_+	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032418795.1|2038925_2040440_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2R8FG22	Brazilian_cedratvirus	30.0	4.1e-11
WP_002911507.1|2040454_2041435_+	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_002911505.1|2041596_2042385_+	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_004175414.1|2042359_2043784_+	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_002911500.1|2043807_2044236_-	universal stress protein UspC	NA	NA	NA	NA	NA
WP_002911499.1|2044589_2046173_+	MFS transporter	NA	NA	NA	NA	NA
WP_004184668.1|2046177_2047317_+	glycoside hydrolase family 105 protein	NA	NA	NA	NA	NA
WP_004151452.1|2047378_2049112_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.8	1.4e-87
WP_002911491.1|2049347_2049917_+	VOC family protein	NA	NA	NA	NA	NA
WP_032418796.1|2049993_2050737_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_023316208.1|2050818_2051823_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_002911486.1|2051819_2052563_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.1e-25
WP_002911484.1|2052602_2052998_-	MAPEG family protein	NA	NA	NA	NA	NA
WP_002911483.1|2053050_2053869_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	82.7	1.1e-60
WP_004145564.1|2053865_2054432_-	hydrolase	NA	NA	NA	NA	NA
WP_002911479.1|2054699_2056487_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	27.2	1.3e-11
>prophage 6
NZ_CP018450	Klebsiella pneumoniae strain Kp_Goe_71070 chromosome, complete genome	5497083	2859649	2870536	5497083		Escherichia_phage(87.5%)	9	NA	NA
WP_032419001.1|2859649_2862757_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_032419002.1|2862811_2864077_+	oligosaccharide MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|2864107_2865196_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004176262.1|2865282_2865543_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_001620095.1|2865840_2866701_+	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
WP_002210513.1|2866721_2867483_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|2867743_2868646_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_004224682.1|2868657_2869923_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.8	7.8e-234
WP_002210516.1|2869915_2870536_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 7
NZ_CP018450	Klebsiella pneumoniae strain Kp_Goe_71070 chromosome, complete genome	5497083	3571160	3580634	5497083	tRNA,protease	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_023158537.1|3571160_3572882_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|3572926_3573628_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3573981_3574200_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3574330_3576610_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3576640_3576958_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3577283_3577505_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_032419142.1|3577581_3579522_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3579518_3580634_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 8
NZ_CP018450	Klebsiella pneumoniae strain Kp_Goe_71070 chromosome, complete genome	5497083	4091527	4139172	5497083	head,terminase,holin	Cronobacter_phage(26.92%)	67	NA	NA
WP_032419291.1|4091527_4094005_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.3	2.6e-196
WP_032419292.1|4093991_4094387_-	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	54.8	3.6e-36
WP_032419293.1|4094383_4094854_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	40.4	9.6e-28
WP_032419294.1|4094853_4095330_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	48.4	8.7e-37
WP_072032582.1|4095443_4095707_+	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
WP_023339093.1|4095686_4095866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032419296.1|4095906_4099320_-	tape measure protein	NA	R9TMK1	Aeromonas_phage	50.0	6.0e-188
WP_050598715.1|4099385_4100414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023342743.1|4100488_4100701_-	hemolysin XhlA family protein	NA	H6WRV2	Salmonella_phage	58.8	1.0e-13
WP_032419298.1|4101263_4101737_-	DUF2335 domain-containing protein	NA	S5WJ01	Leptospira_phage	26.5	5.0e-08
WP_124038561.1|4101705_4101903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032419299.1|4102003_4102282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023297298.1|4102342_4102858_-	KilA-N domain-containing protein	NA	A0A1V0E5P7	Salmonella_phage	70.7	5.0e-62
WP_032419300.1|4103075_4103789_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	55.1	3.3e-64
WP_064767745.1|4103856_4104621_-	immunoglobulin domain-containing protein	NA	G0ZNE6	Cronobacter_phage	44.0	1.2e-40
WP_023341847.1|4104679_4104901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073546890.1|4104903_4105287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073546891.1|4105283_4105652_-	hypothetical protein	NA	F1C5E3	Cronobacter_phage	83.6	2.9e-48
WP_073546892.1|4105703_4106258_-	HNH endonuclease	NA	A0A2I7S010	Vibrio_phage	39.7	4.3e-35
WP_040229587.1|4106355_4106718_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	52.5	4.3e-28
WP_048336937.1|4106717_4106891_-	hypothetical protein	NA	I6R0P9	Salmonella_phage	54.4	4.1e-13
WP_073546893.1|4106890_4107271_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	1.8e-29
WP_064147788.1|4107273_4107576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012967727.1|4107585_4108683_-	hypothetical protein	NA	F1C5E1	Cronobacter_phage	73.6	3.2e-151
WP_047680691.1|4108694_4109126_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.1	1.8e-41
WP_047680688.1|4109129_4110515_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	60.2	2.7e-155
WP_047680685.1|4110527_4110710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159162401.1|4110774_4111362_-	HNH endonuclease	NA	A0A2I7S0H7	Vibrio_phage	43.9	1.5e-30
WP_073546894.1|4111461_4112466_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	66.0	1.8e-108
WP_032419309.1|4112392_4113862_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	56.1	1.2e-148
WP_032419310.1|4113874_4115347_-|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	82.9	6.9e-250
WP_032419311.1|4115346_4115949_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	78.7	3.1e-79
WP_032419312.1|4116386_4116737_-	hypothetical protein	NA	A0A0K2FIW3	Enterobacter_phage	42.9	7.6e-14
WP_032419505.1|4116733_4117231_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	83.0	4.8e-78
WP_012542609.1|4117208_4117478_-|holin	holin	holin	K7P6H9	Enterobacteria_phage	78.3	2.8e-32
WP_032419313.1|4117697_4118237_-	HNH endonuclease	NA	A5PJ37	Escherichia_virus	46.1	2.1e-34
WP_032419314.1|4118674_4119364_-	antiterminator	NA	I6PDF8	Cronobacter_phage	56.2	6.7e-62
WP_009483890.1|4119360_4119501_-	YlcG family protein	NA	NA	NA	NA	NA
WP_032419315.1|4119497_4120136_-	recombination protein NinG	NA	H6WRY9	Salmonella_phage	68.4	7.0e-74
WP_032419316.1|4120128_4120797_-	metallophosphoesterase	NA	K7P6H8	Enterobacteria_phage	77.8	8.9e-104
WP_024264476.1|4120793_4120961_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	7.8e-09
WP_023283341.1|4120966_4121563_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	53.3	3.6e-56
WP_032419317.1|4121721_4122036_-	hypothetical protein	NA	A0A220NQY7	Salmonella_phage	35.6	3.4e-05
WP_009308003.1|4123140_4123317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032419318.1|4123316_4123646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032419320.1|4124333_4124558_-	hypothetical protein	NA	H9C169	Pectobacterium_phage	51.5	8.3e-14
WP_032419321.1|4124554_4124848_-	protein ren	NA	O48423	Enterobacteria_phage	66.7	1.5e-26
WP_073546926.1|4124847_4126263_-	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	67.3	6.3e-184
WP_073546927.1|4126267_4127119_-	DNA replication protein	NA	F1C5C3	Cronobacter_phage	56.0	5.9e-84
WP_032419324.1|4127159_4127306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001548453.1|4127391_4127613_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_001548452.1|4127692_4127884_-	hypothetical protein	NA	A0A2R2Z333	Escherichia_phage	55.4	2.4e-09
WP_032419325.1|4127988_4128699_+	helix-turn-helix domain-containing protein	NA	K7P8B2	Enterobacteria_phage	70.6	3.7e-92
WP_004191592.1|4129071_4130127_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	68.8	1.1e-140
WP_032419508.1|4130315_4130519_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	70.1	4.5e-19
WP_004219883.1|4130828_4130954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008807814.1|4130946_4131153_+	phage encoded cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	94.1	1.4e-31
WP_016529276.1|4131233_4131518_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	8.6e-40
WP_014342891.1|4131927_4132263_+	hypothetical protein	NA	A0A0F7L7F5	uncultured_marine_virus	34.3	1.3e-10
WP_032419327.1|4132259_4132883_+	YqaJ viral recombinase family protein	NA	S0A2A9	Cellulophaga_phage	48.6	6.1e-46
WP_032419328.1|4132879_4133308_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	81.0	5.8e-64
WP_032419329.1|4133304_4133961_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.5	2.1e-113
WP_032419330.1|4133957_4135094_+	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	73.1	7.4e-159
WP_032419331.1|4135309_4135582_+	hypothetical protein	NA	Q716F1	Shigella_phage	63.5	3.7e-24
WP_032419332.1|4135578_4136283_+	hypothetical protein	NA	A0A1W6JP46	Morganella_phage	34.3	1.0e-25
WP_072032585.1|4136498_4136834_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004143017.1|4138305_4139172_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
>prophage 9
NZ_CP018450	Klebsiella pneumoniae strain Kp_Goe_71070 chromosome, complete genome	5497083	5114718	5157665	5497083	integrase,terminase,plate,tail,holin,tRNA,portal,capsid,head,protease	Shigella_phage(48.21%)	59	5110227:5110243	5146221:5146237
5110227:5110243	attL	ACCAGCTGCGCGATCAG	NA	NA	NA	NA
WP_002884942.1|5114718_5116134_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.8	5.7e-201
WP_002884941.1|5116303_5117287_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_032418204.1|5117469_5117712_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_087835996.1|5117851_5118889_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001514812.1|5118977_5120075_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.2	1.4e-210
WP_001514811.1|5120136_5120385_+	DinI family protein	NA	K7PLW4	Enterobacteria_phage	98.8	3.1e-38
WP_073546902.1|5120485_5120875_-	DNA polymerase V	NA	K7P6F7	Enterobacteria_phage	91.4	2.6e-63
WP_136473586.1|5121069_5122572_+	hypothetical protein	NA	E5AGC8	Erwinia_phage	34.6	3.2e-69
WP_073546904.1|5122608_5123013_-|tail	tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	42.0	1.1e-11
WP_073546905.1|5123012_5123975_-	hypothetical protein	NA	U5P0I1	Shigella_phage	82.8	8.7e-52
WP_052924723.1|5123978_5124563_-	YmfQ family protein	NA	O22003	Shigella_phage	99.5	1.8e-113
WP_073546906.1|5124553_5125612_-|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	98.9	1.6e-200
WP_000424732.1|5125598_5126024_-	phage GP46 family protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_073546907.1|5126023_5126572_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	97.3	1.6e-95
WP_000999511.1|5126571_5127651_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	2.6e-206
WP_000219913.1|5127647_5128976_-	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	99.3	8.4e-247
WP_001514801.1|5129039_5129417_-	PH domain-containing protein	NA	A5GZ63	Lactococcus_phage	35.6	2.3e-08
WP_073546908.1|5129469_5131305_-|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	98.5	1.2e-304
WP_000661054.1|5131446_5131716_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_000090993.1|5131715_5132072_-|tail	phage tail tube protein	tail	U5P076	Shigella_phage	99.2	1.2e-62
WP_073546909.1|5132071_5133568_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1FN90	Enterobacteria_phage	98.6	8.5e-272
WP_000497751.1|5133551_5133722_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000779292.1|5133730_5134291_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	100.0	1.0e-105
WP_000224835.1|5134287_5134794_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	92.9	1.3e-83
WP_073546910.1|5134768_5135179_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	97.1	2.5e-72
WP_000927710.1|5135175_5135499_-|head,tail	phage gp6-like head-tail connector protein	head,tail	S5FKK6	Shigella_phage	100.0	5.1e-57
WP_073546911.1|5135501_5135702_-	hypothetical protein	NA	S5FNU1	Shigella_phage	93.9	4.2e-25
WP_073546912.1|5135751_5136957_-|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	99.3	2.7e-223
WP_001193632.1|5136971_5137622_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	99.5	1.6e-118
WP_032252663.1|5137599_5138841_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.3	1.3e-241
WP_000605606.1|5138840_5139023_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_021519685.1|5139034_5140768_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	98.4	0.0e+00
WP_073546913.1|5140764_5141259_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	99.4	5.1e-88
WP_053287456.1|5141384_5141735_-	HNH endonuclease	NA	U5P4L6	Shigella_phage	94.8	8.3e-61
WP_052874970.1|5141918_5142311_-	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	86.9	8.4e-54
WP_016244989.1|5142294_5142771_-	glycoside hydrolase family protein	NA	S5FV07	Shigella_phage	97.5	2.4e-87
WP_001120502.1|5142774_5143110_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	100.0	5.2e-60
WP_000799659.1|5143186_5144239_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	99.1	6.8e-207
WP_001547994.1|5144845_5145598_-	antitermination protein	NA	K7PGU5	Enterobacteria_phage	100.0	2.8e-138
WP_016236817.1|5145611_5146601_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	6.2e-194
5146221:5146237	attR	CTGATCGCGCAGCTGGT	NA	NA	NA	NA
WP_001061444.1|5146608_5147418_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_000767148.1|5147437_5147827_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	96.9	5.1e-67
WP_000210152.1|5147823_5148150_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	98.1	1.3e-52
WP_001433188.1|5148146_5148800_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	5.6e-127
WP_110109894.1|5148799_5149294_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.1e-85
WP_000104943.1|5149290_5150232_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.0	4.9e-140
WP_001250269.1|5150221_5150401_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000514174.1|5150576_5151161_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	60.9	5.5e-57
WP_001231956.1|5151188_5151386_-	Cro/Cl family transcriptional regulator	NA	K7PHB1	Enterobacterial_phage	56.9	1.1e-14
WP_000981537.1|5151481_5152135_+	helix-turn-helix domain-containing protein	NA	K7PLZ5	Enterobacterial_phage	60.8	5.7e-71
WP_073546915.1|5152368_5152644_+	hypothetical protein	NA	Q8SBF7	Shigella_phage	96.7	1.2e-46
WP_001323604.1|5153226_5153607_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	1.3e-62
WP_052870285.1|5153672_5154497_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.3	3.9e-149
WP_000008210.1|5154624_5155161_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	99.4	9.7e-101
WP_001565177.1|5155151_5155514_+	phage protein	NA	U5P092	Shigella_phage	97.5	1.5e-65
WP_073546918.1|5155513_5156323_+	hypothetical protein	NA	Q8HAA7	Salmonella_phage	61.4	7.3e-76
WP_073546919.1|5156322_5156895_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	96.3	4.0e-105
WP_001093909.1|5156931_5157204_+	pyocin activator PrtN family protein	NA	S5MQM5	Escherichia_phage	86.7	5.9e-38
WP_000549966.1|5157230_5157665_-	type II toxin-antitoxin system YafO family toxin	NA	A0A0S2SYH1	Pseudomonas_phage	51.0	5.2e-36
>prophage 1
NZ_CP018451	Klebsiella pneumoniae strain Kp_Goe_71070 plasmid pKp_Goe_070-1, complete sequence	90684	4877	58290	90684	transposase,integrase	Escherichia_phage(33.33%)	53	25522:25536	42380:42394
WP_001776119.1|4877_5405_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	39.5	5.7e-21
WP_001776120.1|5437_5869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001776122.1|6348_7314_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	42.7	1.6e-58
WP_004178082.1|7783_9271_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_000776034.1|9676_10108_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
WP_004118291.1|10107_11379_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.3	4.9e-151
WP_000064120.1|11460_12435_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.4	2.6e-88
WP_000368714.1|12434_13640_-	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
WP_000339857.1|14054_14324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118283.1|14680_15547_-	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
WP_032409716.1|16081_16186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000764642.1|16314_16572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000015958.1|16629_17406_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
WP_000129823.1|17402_18146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000493378.1|18196_18547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072202616.1|18690_19152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261282.1|19108_19339_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001044770.1|19335_19752_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_004152334.1|19825_20536_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001235713.1|23003_23561_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|23743_24604_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
25522:25536	attL	GAACTTCTCGGCCGG	NA	NA	NA	NA
WP_001161490.1|27009_27570_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_000454193.1|27745_28096_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|28298_29312_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001456218.1|29478_30321_+	alpha/beta fold putative hydrolase EstX	NA	NA	NA	NA	NA
WP_000050382.1|30416_31025_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_001261740.1|31082_31874_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000095725.1|32135_33395_+	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
WP_001206315.1|33487_34276_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000722315.1|34335_35160_+	oxacillin-hydrolyzing class D beta-lactamase OXA-9	NA	NA	NA	NA	NA
WP_000027057.1|35859_36720_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001300294.1|38630_39299_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000993386.1|39334_39571_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001067855.1|39643_40348_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000219391.1|40469_41375_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|41371_42610_+	MFS transporter	NA	NA	NA	NA	NA
42380:42394	attR	GAACTTCTCGGCCGG	NA	NA	NA	NA
WP_001137892.1|42609_43194_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001067855.1|43249_43954_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000075580.1|44094_44250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001145103.1|44298_45291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011977825.1|45317_45479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000176305.1|45475_46087_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001568067.1|46140_46422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011977766.1|46594_46930_+	C2H2-type zinc finger protein	NA	NA	NA	NA	NA
WP_000807690.1|48347_49103_-	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	96.0	4.5e-136
WP_000861580.1|50114_50306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001039463.1|50314_50701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|51463_52168_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_023352616.1|52214_52823_-	tetracycline resistance transcriptional repressor TetR(D)	NA	NA	NA	NA	NA
WP_001039466.1|52918_54103_+	tetracycline efflux MFS transporter Tet(D)	NA	NA	NA	NA	NA
WP_000842134.1|54197_55307_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.2	2.8e-33
WP_001067855.1|55796_56501_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000227969.1|57213_58290_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP018451	Klebsiella pneumoniae strain Kp_Goe_71070 plasmid pKp_Goe_070-1, complete sequence	90684	81444	89351	90684	transposase,integrase	Escherichia_phage(28.57%)	8	75336:75350	88274:88288
75336:75350	attL	AAGAAAGCATTGCCC	NA	NA	NA	NA
WP_032441643.1|81444_81924_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.1	3.0e-77
WP_001067855.1|81963_82668_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000845048.1|83402_84416_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_004201280.1|84571_85045_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_001144737.1|85265_85532_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_001389365.1|85674_86439_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_004098817.1|86699_87914_+	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_072094655.1|87947_89351_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	9.0e-106
88274:88288	attR	GGGCAATGCTTTCTT	NA	NA	NA	NA
>prophage 1
NZ_CP018452	Klebsiella pneumoniae strain Kp_Goe_71070 plasmid pKp_Goe_070-2, complete sequence	67100	17558	66668	67100	transposase	Escherichia_phage(18.18%)	48	NA	NA
WP_011790968.1|17558_18809_-|transposase	IS4-like element IS10A family transposase	transposase	Q9E8P4	Bluetongue_virus	71.4	4.2e-171
WP_015586033.1|19069_19981_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015059991.1|20282_21080_-	carbapenem-hydrolyzing class D beta-lactamase OXA-48	NA	NA	NA	NA	NA
WP_024190316.1|24043_25111_-	replication initiation protein	NA	NA	NA	NA	NA
WP_004187496.1|25395_25626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004206935.1|25699_26353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187492.1|26355_28536_-	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_004187488.1|28528_29179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187486.1|29175_30384_-	conjugal transfer protein TraW	NA	NA	NA	NA	NA
WP_011154474.1|30380_33431_-	conjugative transfer protein	NA	NA	NA	NA	NA
WP_004187480.1|33427_33922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011154472.1|33967_34357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187478.1|34373_34904_-	conjugal transfer protein TraQ	NA	NA	NA	NA	NA
WP_004206933.1|34927_35632_-	conjugal transfer protein TraP	NA	NA	NA	NA	NA
WP_036970781.1|35643_36993_-	conjugal transfer protein TraO	NA	NA	NA	NA	NA
WP_015062843.1|37004_38156_-	protein TraN	NA	NA	NA	NA	NA
WP_004206929.1|38164_38947_-	DotI/IcmL/TraM family protein	NA	NA	NA	NA	NA
WP_004187465.1|38945_39356_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_004187464.1|39342_39540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011091071.1|39540_40053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032072104.1|40018_41698_-	primase	NA	NA	NA	NA	NA
WP_004187310.1|43348_43609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004206926.1|43598_44762_-	plasmid transfer ATPase TraJ	NA	NA	NA	NA	NA
WP_004187315.1|44772_45552_-	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_004206925.1|45548_46049_-	DotD/TraH family lipoprotein	NA	NA	NA	NA	NA
WP_004206924.1|46062_48042_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_004206923.1|48028_48346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015586046.1|48621_48987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036970776.1|49487_50024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187333.1|50156_50468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015586044.1|50523_50958_-	single-stranded DNA-binding protein	NA	A0A0U4K5C0	Pseudomonas_phage	48.0	7.5e-27
WP_004206918.1|51029_51251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004206917.1|51405_51690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015586043.1|51733_52174_-	antirestriction protein	NA	NA	NA	NA	NA
WP_073546936.1|52522_53914_-|transposase	ISKra4-like element ISKpn19 family transposase	transposase	NA	NA	NA	NA
WP_001493762.1|53950_54523_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
WP_012477564.1|54659_55250_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_014839983.1|55684_56299_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	47.4	8.1e-35
WP_073546935.1|56617_56890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085950818.1|56975_58095_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_001067855.1|59003_59708_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001082319.1|60125_60929_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_015586042.1|61044_61746_+|transposase	IS1-like element ISPa14 family transposase	transposase	A0A218MNG1	uncultured_virus	55.0	9.9e-37
WP_015586041.1|62400_63180_-	APH(3')-VI family aminoglycoside O-phosphotransferase	NA	E4ZFP6	Streptococcus_phage	35.1	1.1e-31
WP_001082319.1|63407_64211_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_077270329.1|64276_64819_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	46.7	1.2e-29
WP_001067855.1|64854_65559_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001617865.1|65792_66668_+	class A extended-spectrum beta-lactamase CTX-M-14	NA	A0A1B0VBP7	Salmonella_phage	99.6	6.1e-153
