The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018677	Acinetobacter baumannii strain LAC4 chromosome, complete genome	3974606	1438327	1480028	3974606	tail,integrase,terminase,transposase	Acinetobacter_phage(35.0%)	58	1434998:1435012	1475730:1475744
1434998:1435012	attL	CAGCAAGAAATTGCA	NA	NA	NA	NA
WP_032003042.1|1438327_1439485_+|integrase	site-specific integrase	integrase	A0A2H4J339	uncultured_Caudovirales_phage	62.7	1.1e-133
WP_001076477.1|1439481_1440366_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000549863.1|1440356_1440812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000527288.1|1440926_1441919_+	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_000119264.1|1441925_1442096_-	hypothetical protein	NA	A0A2H4JBW6	uncultured_Caudovirales_phage	69.2	2.4e-13
WP_001292077.1|1442096_1442312_-	hypothetical protein	NA	I2GUB6	Acinetobacter_phage	92.9	8.5e-32
WP_000028957.1|1442308_1442518_-	hypothetical protein	NA	A0A0P0IRG7	Acinetobacter_phage	94.2	6.3e-32
WP_000578497.1|1442514_1443024_-	phage protein	NA	A0A0P0I8H3	Acinetobacter_phage	87.8	1.6e-33
WP_032003041.1|1443020_1443557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000464381.1|1443549_1443729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000986115.1|1443729_1444020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032003040.1|1444160_1445189_-	ead/Ea22-like family protein	NA	A0A2I7QY11	Vibrio_phage	29.0	3.8e-13
WP_023060560.1|1445201_1445882_-	DNA polymerase III subunit epsilon	NA	NA	NA	NA	NA
WP_032003039.1|1446052_1446424_-	hypothetical protein	NA	A0A0D4DCB5	Acinetobacter_phage	40.0	1.1e-10
WP_032003037.1|1446420_1446750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032003036.1|1446830_1447163_-	hypothetical protein	NA	A0A0P0ZGH3	Escherichia_phage	41.6	1.5e-14
WP_000440996.1|1447374_1447662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000660939.1|1447672_1448371_-	LexA family transcriptional regulator	NA	A0A0P0IYD9	Acinetobacter_phage	35.8	7.8e-26
WP_000335916.1|1448507_1448741_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000818521.1|1448773_1449148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000290738.1|1449181_1449382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200037.1|1449378_1449564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032003035.1|1449560_1450016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001205618.1|1450012_1450651_+	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	46.2	1.1e-47
WP_001092750.1|1450656_1452327_+	DNA cytosine methyltransferase	NA	Q5QF27	Pseudomonas_virus	46.2	2.4e-153
WP_001033655.1|1452323_1453394_+	site-specific DNA-methyltransferase	NA	A0A1B0VM49	Pseudomonas_phage	59.3	2.3e-109
WP_031944289.1|1453470_1454514_+	hypothetical protein	NA	A0A2H4J580	uncultured_Caudovirales_phage	52.8	4.3e-28
WP_000994861.1|1454510_1455275_+	ATP-binding protein	NA	A0A0D4DBZ2	Acinetobacter_phage	48.8	1.0e-63
WP_000991088.1|1455271_1455805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000836736.1|1455801_1456533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032003033.1|1456529_1456901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021511152.1|1456897_1457305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032003032.1|1457301_1457586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000172116.1|1457664_1458444_+	hypothetical protein	NA	A0A0P0J0C5	Acinetobacter_phage	32.4	3.8e-29
WP_021511154.1|1458492_1458708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000592660.1|1458967_1459666_+	RusA family crossover junction endodeoxyribonuclease	NA	NA	NA	NA	NA
WP_001085641.1|1459666_1460353_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000101391.1|1460366_1461209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000142836.1|1461352_1461616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023187832.1|1461697_1463941_+|tail	lambda family phage tail tape measure protein	tail	Q4L1H3	Burkholderia_phage	36.8	5.6e-09
WP_000175172.1|1463948_1464770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551741.1|1465170_1465581_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_000904390.1|1466204_1466945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001043692.1|1467083_1468016_-|transposase	IS5-like element ISAba13 family transposase	transposase	Q1MVF0	Enterobacteria_phage	39.6	9.7e-56
WP_000842716.1|1468083_1469028_+	Abi family protein	NA	NA	NA	NA	NA
WP_000535151.1|1469265_1470207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001166851.1|1470406_1470763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000633139.1|1470762_1471101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032003161.1|1471081_1472527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000371258.1|1472514_1473129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001183519.1|1473207_1473666_+	hypothetical protein	NA	A0A143FJ28	Bacillus_phage	38.5	1.8e-10
WP_001237356.1|1473677_1473905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004886737.1|1473977_1474883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004886741.1|1474885_1475689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000130707.1|1475681_1475882_+	TraR/DksA C4-type zinc finger protein	NA	G3EN77	Psychrobacter_phage	42.4	1.7e-05
1475730:1475744	attR	CAGCAAGAAATTGCA	NA	NA	NA	NA
WP_000014220.1|1475893_1476406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032003159.1|1476425_1478417_+|terminase	terminase	terminase	A0A077SK57	Escherichia_phage	54.9	3.6e-07
WP_000996675.1|1478489_1480028_+|tail	phage tail protein	tail	NA	NA	NA	NA
>prophage 2
NZ_CP018677	Acinetobacter baumannii strain LAC4 chromosome, complete genome	3974606	1491938	1530750	3974606	transposase	uncultured_virus(25.0%)	31	NA	NA
WP_000343018.1|1491938_1493147_+|transposase	IS256-like element ISAba26 family transposase	transposase	A0A218MNI5	uncultured_virus	46.5	3.1e-46
WP_032002730.1|1501734_1502172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032002731.1|1502171_1502930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032002733.1|1502972_1503170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032002734.1|1503328_1504864_+	hypothetical protein	NA	A0A222YXQ7	Escherichia_phage	26.2	1.2e-31
WP_010326927.1|1505255_1506281_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.7	8.8e-26
WP_032002737.1|1506631_1507003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044099071.1|1507131_1509084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032002740.1|1509083_1510529_+	hypothetical protein	NA	A0A222YY44	Escherichia_phage	42.6	5.5e-82
WP_032002741.1|1510685_1511315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148307302.1|1511311_1512391_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0U4JD08	Gordonia_phage	31.0	2.4e-34
WP_032002743.1|1512612_1513326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032002746.1|1513538_1514303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000030336.1|1514378_1515191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000627452.1|1515190_1515886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000894311.1|1515878_1516097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001279705.1|1516218_1516497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032002747.1|1516493_1517264_+	TIGR02594 family protein	NA	A0A0B5L5G5	Acinetobacter_phage	92.6	7.8e-144
WP_000343018.1|1517463_1518672_+|transposase	IS256-like element ISAba26 family transposase	transposase	A0A218MNI5	uncultured_virus	46.5	3.1e-46
WP_032002748.1|1518716_1519358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032002750.1|1519354_1520197_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_050437491.1|1520358_1521066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001043692.1|1521073_1522006_+|transposase	IS5-like element ISAba13 family transposase	transposase	Q1MVF0	Enterobacteria_phage	39.6	9.7e-56
WP_032002754.1|1522045_1522867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050437492.1|1522956_1524039_-	DUF4935 domain-containing protein	NA	NA	NA	NA	NA
WP_032002756.1|1524080_1525379_-	Y-family DNA polymerase	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	61.4	1.9e-158
WP_032002757.1|1525382_1525877_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	57.7	5.9e-44
WP_001043692.1|1527227_1528160_+|transposase	IS5-like element ISAba13 family transposase	transposase	Q1MVF0	Enterobacteria_phage	39.6	9.7e-56
WP_001055585.1|1528376_1528760_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_000618091.1|1528756_1529092_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005080579.1|1529166_1530750_+|transposase	IS66-like element ISAba25 family transposase	transposase	A0A218MNE7	uncultured_virus	54.0	7.2e-144
>prophage 3
NZ_CP018677	Acinetobacter baumannii strain LAC4 chromosome, complete genome	3974606	2444481	2522463	3974606	protease,transposase	Faecalibacterium_phage(33.33%)	55	NA	NA
WP_094190431.1|2444481_2445571_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_000769552.1|2445776_2447462_+	arylsulfatase	NA	NA	NA	NA	NA
WP_080746777.1|2447487_2448441_+	formylglycine-generating enzyme family protein	NA	NA	NA	NA	NA
WP_000680441.1|2448453_2449641_+	outer membrane porin, OprD family	NA	NA	NA	NA	NA
WP_000470077.1|2449873_2450950_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_000351364.1|2450962_2451907_+	oxidoreductase	NA	NA	NA	NA	NA
WP_086225923.1|2451950_2452643_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000252463.1|2452749_2453208_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000411710.1|2453278_2454511_-	3-(3-hydroxy-phenyl)propionate transporter MhpT	NA	NA	NA	NA	NA
WP_170628398.1|2454758_2455598_+	p-hydroxycinnamoyl CoA hydratase/lyase	NA	NA	NA	NA	NA
WP_001181819.1|2455635_2457087_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_170628401.1|2457170_2459057_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_001119798.1|2459130_2460270_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_020752951.1|2460381_2461602_+	OprD family porin	NA	NA	NA	NA	NA
WP_000758288.1|2461658_2462195_+	DUF3237 domain-containing protein	NA	NA	NA	NA	NA
WP_000372406.1|2462235_2462625_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_001110014.1|2462657_2464409_+	tannase/feruloyl esterase family alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000092890.1|2464473_2465187_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000042108.1|2465430_2467017_-	aldehyde dehydrogenase (NADP(+))	NA	NA	NA	NA	NA
WP_000339251.1|2467047_2467959_-	5-dehydro-4-deoxyglucarate dehydratase	NA	NA	NA	NA	NA
WP_000235918.1|2468121_2469456_-	glucarate dehydratase	NA	NA	NA	NA	NA
WP_000369465.1|2469740_2471099_+	MFS transporter	NA	NA	NA	NA	NA
WP_001181021.1|2472842_2473739_+	DMT family transporter	NA	NA	NA	NA	NA
WP_001125645.1|2473754_2474825_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000442405.1|2474954_2476415_+	coniferyl aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_025469910.1|2476589_2476928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001048417.1|2477107_2477428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001043692.1|2477720_2478653_+|transposase	IS5-like element ISAba13 family transposase	transposase	Q1MVF0	Enterobacteria_phage	39.6	9.7e-56
WP_000138943.1|2478761_2480168_-	amino acid permease	NA	NA	NA	NA	NA
WP_000972691.1|2480623_2481718_-	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_005120336.1|2481714_2482950_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.6	2.2e-23
WP_002001056.1|2483085_2483508_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001140777.1|2483826_2485257_+	gamma-aminobutyraldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001041177.1|2485285_2486056_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_001277428.1|2486115_2486835_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000191923.1|2486900_2487608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000428073.1|2487803_2489135_+	APC family permease	NA	NA	NA	NA	NA
WP_000691957.1|2489154_2490600_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_079344381.1|2490746_2492105_+	amino acid permease	NA	NA	NA	NA	NA
WP_005080579.1|2492288_2493872_-|transposase	IS66-like element ISAba25 family transposase	transposase	A0A218MNE7	uncultured_virus	54.0	7.2e-144
WP_000618091.1|2493946_2494282_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_001055585.1|2494278_2494662_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_000416092.1|2494985_2495345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000368995.1|2495462_2498699_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_000773510.1|2498890_2499331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010326927.1|2499725_2500751_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.7	8.8e-26
WP_001224549.1|2501169_2501610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010326927.1|2506139_2507165_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.7	8.8e-26
WP_000732875.1|2509136_2510012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032002822.1|2510856_2511945_+	DUF898 domain-containing protein	NA	NA	NA	NA	NA
WP_086222338.1|2512004_2513057_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000622036.1|2513565_2514651_-	macro domain-containing protein	NA	B0FIJ9	Escherichia_phage	41.5	8.4e-19
WP_000233088.1|2514650_2515307_-	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_000653917.1|2515629_2520360_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000443163.1|2520423_2522463_-|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
>prophage 4
NZ_CP018677	Acinetobacter baumannii strain LAC4 chromosome, complete genome	3974606	2552575	2614869	3974606	integrase,transposase	Acinetobacter_phage(38.89%)	58	2598887:2598946	2616071:2616133
WP_001043692.1|2552575_2553508_+|transposase	IS5-like element ISAba13 family transposase	transposase	Q1MVF0	Enterobacteria_phage	39.6	9.7e-56
WP_000261481.1|2553818_2555042_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_001101792.1|2555038_2556067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000570798.1|2556063_2556330_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001165438.1|2556683_2556947_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_000824257.1|2556930_2557194_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_001055585.1|2557562_2557946_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_000618091.1|2557942_2558278_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005080579.1|2558352_2559936_+|transposase	IS66-like element ISAba25 family transposase	transposase	A0A218MNE7	uncultured_virus	54.0	7.2e-144
WP_002036368.1|2560008_2561196_-	DUF4268 domain-containing protein	NA	NA	NA	NA	NA
WP_025466770.1|2561295_2562504_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	37.5	1.2e-61
WP_000205099.1|2562847_2564878_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_001986427.1|2565143_2566502_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	81.0	2.0e-54
WP_000013369.1|2566560_2567823_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_001084867.1|2567972_2569007_+	dihydroorotase	NA	NA	NA	NA	NA
WP_001982681.1|2568991_2569654_+	ribonuclease T	NA	L0N5X9	Acaryochloris_phage	35.4	2.0e-07
WP_000364479.1|2569931_2572046_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000077961.1|2572104_2573349_-	NADH:flavin oxidoreductase/NADH oxidase family protein	NA	NA	NA	NA	NA
WP_000550799.1|2573534_2575124_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	4.2e-19
WP_000008511.1|2575101_2576112_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000536102.1|2576111_2577164_-	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_086225925.1|2577193_2578906_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000277812.1|2579044_2582260_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A7NU10	Lactobacillus_phage	37.8	3.4e-15
WP_002036374.1|2582492_2583872_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.6	7.9e-38
WP_001289238.1|2584004_2585648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001292948.1|2585647_2586391_+	NAD(+) diphosphatase	NA	NA	NA	NA	NA
WP_001048903.1|2586413_2587277_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000919365.1|2587280_2587988_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_000959396.1|2588068_2588470_-	YraN family protein	NA	NA	NA	NA	NA
WP_001275992.1|2588663_2589500_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	39.9	5.3e-45
WP_000147963.1|2589592_2589979_+	hemin receptor	NA	NA	NA	NA	NA
WP_000887355.1|2589981_2590872_-	LysR family transcriptional regulator ArgP	NA	NA	NA	NA	NA
WP_005120377.1|2590978_2591581_+	amino acid transporter	NA	NA	NA	NA	NA
WP_000896583.1|2591638_2592280_-	cation transporter	NA	NA	NA	NA	NA
WP_000058917.1|2592345_2592747_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000129799.1|2592801_2593053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000005667.1|2593262_2594495_-	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_001187369.1|2594491_2595700_-	2-octaprenyl-6-methoxyphenyl hydroxylase	NA	NA	NA	NA	NA
WP_000775473.1|2595731_2597054_-	Xaa-Pro aminopeptidase	NA	NA	NA	NA	NA
WP_001150153.1|2597121_2597754_-	UPF0149 family protein	NA	NA	NA	NA	NA
WP_000893185.1|2597818_2598379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000003719.1|2598375_2598660_+	cell division protein ZapA	NA	NA	NA	NA	NA
2598887:2598946	attL	TGAACTTTAGGGTTCAAGGGTAACGACATGCAGCGGCATCTTCGGAGCATTTATTTTTAA	NA	NA	NA	NA
WP_002067557.1|2599088_2600441_+|integrase	integrase family protein	integrase	A0A0R6PGY7	Moraxella_phage	39.5	1.6e-75
WP_000343018.1|2600793_2602002_+|transposase	IS256-like element ISAba26 family transposase	transposase	A0A218MNI5	uncultured_virus	46.5	3.1e-46
WP_005120384.1|2602184_2603831_-	phosphoethanolamine--lipid A transferase	NA	NA	NA	NA	NA
WP_000803003.1|2604112_2606431_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_001019745.1|2606920_2607466_-	N-acetylmuramidase	NA	A0A0B5L5G7	Acinetobacter_phage	92.3	2.1e-95
WP_001076396.1|2607564_2607747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001138125.1|2608110_2608389_-	hypothetical protein	NA	J7I481	Acinetobacter_phage	100.0	9.9e-49
WP_032002826.1|2608408_2608924_-	hypothetical protein	NA	A0A0D4DBX8	Acinetobacter_phage	93.2	1.1e-74
WP_000729387.1|2609352_2609868_-	DUF2280 domain-containing protein	NA	A0A1B1P9C2	Acinetobacter_phage	61.3	3.2e-45
WP_000435241.1|2609926_2610568_-	hypothetical protein	NA	A0A0D4DBV4	Acinetobacter_phage	96.2	1.1e-122
WP_000378525.1|2610536_2610971_-	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	88.2	6.0e-69
WP_001136775.1|2611030_2611486_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	98.7	3.5e-83
WP_000152665.1|2612147_2612384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001039309.1|2612592_2612937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000861102.1|2613399_2613654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085940648.1|2613779_2614869_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
2616071:2616133	attR	TGAACTTTAGGGTTCAAGGGTAACGACATGCAGCGGCATCTTCGGAGCATTTATTTTTAAATA	NA	NA	NA	NA
>prophage 5
NZ_CP018677	Acinetobacter baumannii strain LAC4 chromosome, complete genome	3974606	2667442	2733905	3974606	protease,holin,transposase	Faecalibacterium_phage(15.38%)	56	NA	NA
WP_000195944.1|2667442_2668252_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_001245168.1|2668253_2670713_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_001136091.1|2670716_2671409_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.0	3.6e-31
WP_002036590.1|2671453_2672077_+	arylesterase	NA	NA	NA	NA	NA
WP_001987747.1|2672109_2672748_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_000197530.1|2673008_2674034_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000107250.1|2674060_2675068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000044175.1|2675090_2677355_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_000102721.1|2677524_2678163_-	Fe-S biogenesis protein NfuA	NA	NA	NA	NA	NA
WP_000902942.1|2678320_2678938_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_000875356.1|2679108_2680785_+	arylsulfatase	NA	NA	NA	NA	NA
WP_086225841.1|2680889_2681789_+	formylglycine-generating enzyme family protein	NA	NA	NA	NA	NA
WP_000854552.1|2681898_2682063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000098361.1|2682601_2684149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000859892.1|2684192_2685527_-	D-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_115423553.1|2685689_2687219_-	inorganic phosphate transporter	NA	NA	NA	NA	NA
WP_000105327.1|2687783_2691470_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	60.0	3.3e-14
WP_010326927.1|2691665_2692691_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.7	8.8e-26
WP_000422634.1|2693080_2693860_-	APH(3')-VI family aminoglycoside O-phosphotransferase	NA	E4ZFP6	Streptococcus_phage	34.3	5.8e-30
WP_010326927.1|2693960_2694986_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.7	8.8e-26
WP_000350749.1|2695023_2696409_-	SIR2 family protein	NA	Q38324	Lactococcus_phage	27.1	3.0e-29
WP_001016325.1|2696994_2697441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000731762.1|2697632_2698778_+	galactose mutarotase	NA	NA	NA	NA	NA
WP_001043692.1|2699465_2700398_-|transposase	IS5-like element ISAba13 family transposase	transposase	Q1MVF0	Enterobacteria_phage	39.6	9.7e-56
WP_032002835.1|2701220_2702009_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000856719.1|2702003_2703299_-	glutaminase	NA	NA	NA	NA	NA
WP_000117817.1|2703477_2703960_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	44.4	2.9e-19
WP_000371873.1|2704194_2705493_+	MFS transporter	NA	NA	NA	NA	NA
WP_086225840.1|2705555_2706731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032002836.1|2706907_2708548_-	thiamine pyrophosphate-binding protein	NA	E5EQ70	Micromonas_sp._RCC1109_virus	23.9	7.0e-25
WP_001040550.1|2708586_2710053_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000735779.1|2710066_2710858_-	aspartate dehydrogenase	NA	NA	NA	NA	NA
WP_000009973.1|2710873_2711668_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.6	8.6e-13
WP_000988617.1|2711683_2712508_-	alpha/beta hydrolase	NA	A0A249XPN5	Mycobacterium_phage	31.7	6.2e-14
WP_000211626.1|2712544_2713066_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000064049.1|2713089_2714313_-	MFS transporter	NA	NA	NA	NA	NA
WP_000411885.1|2714355_2715567_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000627772.1|2715596_2716526_-	VOC family protein	NA	NA	NA	NA	NA
WP_000991785.1|2717294_2718362_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_000847099.1|2718378_2718678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000118514.1|2718705_2719011_-	non-heme iron oxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_000051057.1|2719284_2720097_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000927114.1|2720143_2720443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000074694.1|2720457_2721039_-	nicotinamide mononucleotide transporter	NA	A0A2H4YHF9	Raoultella_phage	29.1	8.0e-08
WP_000070467.1|2721285_2722074_+	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_002000370.1|2722175_2722580_-	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_000151613.1|2722676_2723936_-	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_000632828.1|2723949_2725944_-	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_000627259.1|2726180_2726522_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_001185269.1|2726608_2727139_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000267730.1|2727327_2728590_+	C4-dicarboxylate transporter DctA	NA	NA	NA	NA	NA
WP_032002838.1|2728627_2729626_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_000761577.1|2730124_2730325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001142469.1|2730435_2730951_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_000254582.1|2731212_2731827_-	MarC family protein	NA	NA	NA	NA	NA
WP_000179784.1|2731838_2733905_-|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	25.1	2.0e-16
>prophage 6
NZ_CP018677	Acinetobacter baumannii strain LAC4 chromosome, complete genome	3974606	2768246	2829802	3974606	tail,integrase,terminase,transposase	Escherichia_phage(22.22%)	55	2759059:2759075	2790089:2790105
2759059:2759075	attL	ATTGATGGTGTGAAAGG	NA	NA	NA	NA
WP_000831314.1|2768246_2769473_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JAT5	uncultured_Caudovirales_phage	40.2	7.2e-75
WP_001050367.1|2769847_2770513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000332614.1|2770661_2771297_+	SOS response-associated peptidase family protein	NA	A0A218MNF5	uncultured_virus	57.4	3.0e-69
WP_000022554.1|2771438_2771939_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	57.8	6.3e-46
WP_001215499.1|2771935_2773234_+	DNA polymerase V subunit UmuC	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	62.4	2.3e-156
WP_001072150.1|2773387_2774086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000602528.1|2774469_2774829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000766533.1|2774954_2775725_-	TIGR02594 family protein	NA	A0A0B5L5G5	Acinetobacter_phage	98.4	1.7e-151
WP_001279704.1|2775721_2776009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000894311.1|2776130_2776349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004743501.1|2776341_2777037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004743499.1|2777036_2777849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004743497.1|2777923_2778373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032002839.1|2778498_2782329_-	DEAD/DEAH box helicase family protein	NA	A0A1Y0T2N3	Pseudomonas_phage	43.3	5.9e-200
WP_000209679.1|2782404_2783916_-	hypothetical protein	NA	A0A222YY44	Escherichia_phage	43.1	3.0e-83
WP_023060547.1|2783915_2785868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000863709.1|2785941_2786595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000098517.1|2786594_2788130_-	hypothetical protein	NA	A0A222YXQ7	Escherichia_phage	26.2	3.6e-31
WP_000852568.1|2788288_2788483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000852828.1|2788510_2789281_-	hypothetical protein	NA	G4WT79	Acinetobacter_phage	80.0	3.8e-82
WP_000190166.1|2789280_2789679_-	hypothetical protein	NA	G4WT78	Acinetobacter_phage	69.7	7.8e-47
WP_005080579.1|2796031_2797615_-|transposase	IS66-like element ISAba25 family transposase	transposase	A0A218MNE7	uncultured_virus	54.0	7.2e-144
2790089:2790105	attR	CCTTTCACACCATCAAT	NA	NA	NA	NA
WP_000618091.1|2797689_2798025_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_001055585.1|2798021_2798405_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_023060549.1|2802543_2803437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240940.1|2803436_2803886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001187722.1|2803885_2804533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001098598.1|2804649_2804928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067778.1|2804989_2805757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001022847.1|2805778_2807074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000151778.1|2807192_2807480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000718477.1|2807484_2808111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000217480.1|2808174_2809953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000120881.1|2810107_2810410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000934750.1|2810406_2810955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001272161.1|2810944_2812075_-	hypothetical protein	NA	A0A222YXT1	Escherichia_phage	35.2	1.3e-22
WP_001243269.1|2812076_2812355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000996675.1|2812369_2813908_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_032003159.1|2813980_2815972_-|terminase	terminase	terminase	A0A077SK57	Escherichia_phage	54.9	3.6e-07
WP_000014220.1|2815991_2816504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000130707.1|2816515_2816716_-	TraR/DksA C4-type zinc finger protein	NA	G3EN77	Psychrobacter_phage	42.4	1.7e-05
WP_004886741.1|2816708_2817512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004886737.1|2817514_2818420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001237356.1|2818492_2818720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001183519.1|2818731_2819190_-	hypothetical protein	NA	A0A143FJ28	Bacillus_phage	38.5	1.8e-10
WP_000371258.1|2819268_2819883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032003161.1|2819870_2821316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044099005.1|2821296_2821635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032003019.1|2821634_2821991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032003021.1|2822137_2822851_-	recombinase	NA	A0A0R6PHM5	Moraxella_phage	42.1	1.1e-40
WP_032003017.1|2823725_2824142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032003016.1|2824294_2824501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001043692.1|2824523_2825456_-|transposase	IS5-like element ISAba13 family transposase	transposase	Q1MVF0	Enterobacteria_phage	39.6	9.7e-56
WP_032003013.1|2827155_2827554_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_032003012.1|2827546_2829802_-|tail	tail tape measure protein	tail	I6NLI9	Burkholderia_phage	49.6	1.6e-27
>prophage 7
NZ_CP018677	Acinetobacter baumannii strain LAC4 chromosome, complete genome	3974606	2896076	2959431	3974606	holin,protease,terminase,capsid,transposase	Acinetobacter_phage(76.6%)	75	NA	NA
WP_032002999.1|2896076_2896706_+	SOS response-associated peptidase family protein	NA	A0A218MNF5	uncultured_virus	56.7	1.4e-66
WP_032002998.1|2897526_2898021_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	59.6	2.0e-44
WP_032002997.1|2898024_2899323_+	Y-family DNA polymerase	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	61.4	1.3e-159
WP_032002995.1|2899400_2900348_+	restriction endonuclease	NA	Q858R6	Enterobacteria_phage	34.6	1.2e-37
WP_001043692.1|2900741_2901674_-|transposase	IS5-like element ISAba13 family transposase	transposase	Q1MVF0	Enterobacteria_phage	39.6	9.7e-56
WP_032002994.1|2901715_2902159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032002993.1|2902174_2902375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031993495.1|2902322_2902691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031993494.1|2902691_2903006_-	hypothetical protein	NA	E5KY21	Escherichia_phage	58.9	6.0e-26
WP_032002992.1|2903006_2903552_-	N-acetylmuramidase	NA	J7I0Y1	Acinetobacter_phage	95.0	1.5e-96
WP_000433918.1|2903595_2903985_-	hypothetical protein	NA	J7I481	Acinetobacter_phage	100.0	2.5e-66
WP_032002990.1|2904053_2907479_-	bacteriophage protein	NA	A0A0P0HSH9	Acinetobacter_phage	92.8	0.0e+00
WP_000835161.1|2907471_2907834_-	hypothetical protein	NA	A0A0P0J0A2	Acinetobacter_phage	79.2	6.2e-51
WP_000368369.1|2907830_2908337_-	DUF1833 family protein	NA	J7HXQ5	Acinetobacter_phage	97.6	2.5e-90
WP_032002989.1|2908336_2908735_-	hypothetical protein	NA	J7I0X8	Acinetobacter_phage	97.7	7.0e-72
WP_032002988.1|2908795_2909272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032002987.1|2909307_2909895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079344403.1|2909985_2912319_-	hypothetical protein	NA	A0A0D4DC37	Acinetobacter_phage	93.0	0.0e+00
WP_001277696.1|2912656_2912875_-	hypothetical protein	NA	A0A0P0I8C2	Acinetobacter_phage	94.2	1.2e-28
WP_032002983.1|2912876_2913275_-	hypothetical protein	NA	A0A0P0IRA6	Acinetobacter_phage	96.2	2.2e-70
WP_000539743.1|2913276_2913645_-	hypothetical protein	NA	A0A0P0IDX0	Acinetobacter_phage	98.1	1.1e-55
WP_170825905.1|2913616_2914054_-	hypothetical protein	NA	J7I0W8	Acinetobacter_phage	91.0	4.7e-69
WP_000524217.1|2914032_2914401_-	glutamate 5-kinase	NA	A0A0P0I456	Acinetobacter_phage	100.0	2.6e-65
WP_000008494.1|2914402_2914792_-	hypothetical protein	NA	A0A0D4DC24	Acinetobacter_phage	100.0	6.6e-67
WP_000692546.1|2914796_2915462_-	stress-responsive nuclear envelope protein	NA	A0A0D4DBW4	Acinetobacter_phage	100.0	1.9e-114
WP_000214189.1|2915528_2916485_-	hypothetical protein	NA	A0A0D4DBM4	Acinetobacter_phage	100.0	2.1e-178
WP_002062129.1|2916512_2917280_-	hypothetical protein	NA	J7I0W4	Acinetobacter_phage	92.5	2.3e-119
WP_001139861.1|2917393_2917585_-	hypothetical protein	NA	A0A0P0IKM2	Acinetobacter_phage	100.0	1.7e-28
WP_000004367.1|2917808_2918045_-	hypothetical protein	NA	A0A0D4DC19	Acinetobacter_phage	93.6	1.1e-35
WP_002154920.1|2918143_2918572_-	hypothetical protein	NA	A0A0D4DBV9	Acinetobacter_phage	98.6	1.7e-71
WP_032002981.1|2918580_2919684_-|capsid	minor capsid protein	capsid	A0A0D4DBL9	Acinetobacter_phage	98.9	1.5e-204
WP_032002980.1|2919685_2921137_-	DUF4055 domain-containing protein	NA	A0A0D4DCP1	Acinetobacter_phage	99.0	7.2e-284
WP_032002979.1|2921133_2922561_-|terminase	phage terminase large subunit	terminase	J7I460	Acinetobacter_phage	96.2	8.2e-264
WP_032002978.1|2922550_2923021_-	DUF2280 domain-containing protein	NA	A0A0D4DC15	Acinetobacter_phage	99.4	3.0e-82
WP_032002977.1|2923079_2923721_-	hypothetical protein	NA	J7I4N9	Acinetobacter_phage	97.7	2.6e-124
WP_032002976.1|2923689_2924124_-	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	95.1	1.5e-75
WP_000134358.1|2924136_2924328_-	hypothetical protein	NA	J7I0V8	Acinetobacter_phage	85.7	2.6e-24
WP_000527469.1|2924405_2924618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002053026.1|2924790_2925543_-	hypothetical protein	NA	A0A0P0J081	Acinetobacter_phage	94.8	8.7e-132
WP_002120863.1|2925553_2925955_-	DUF559 domain-containing protein	NA	A0A0P0IKL1	Acinetobacter_phage	96.2	1.8e-67
WP_000378367.1|2925954_2926278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001039748.1|2926267_2926447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024436719.1|2926443_2926842_-	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	48.5	2.0e-26
WP_000017854.1|2926838_2927246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000137332.1|2927242_2928043_-	hypothetical protein	NA	A0A0P0IDV1	Acinetobacter_phage	93.6	7.6e-142
WP_032002975.1|2928045_2928927_-	replication protein	NA	A0A0P0IKQ2	Acinetobacter_phage	93.9	8.9e-136
WP_079344408.1|2928919_2929144_-	hypothetical protein	NA	A0A0P0I444	Acinetobacter_phage	97.3	1.9e-34
WP_024435837.1|2929215_2929491_-	hypothetical protein	NA	A0A0P0IVP2	Acinetobacter_phage	95.6	3.2e-39
WP_032002972.1|2929546_2929903_-	hypothetical protein	NA	J7I452	Acinetobacter_phage	97.5	1.5e-57
WP_001102751.1|2929911_2930100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032002970.1|2930205_2930892_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032002968.1|2931002_2931380_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001043692.1|2931402_2932335_-|transposase	IS5-like element ISAba13 family transposase	transposase	Q1MVF0	Enterobacteria_phage	39.6	9.7e-56
WP_153564233.1|2932347_2933769_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_032002966.1|2933799_2934660_+	DNA adenine methylase	NA	A0A0P0YLW3	Yellowstone_lake_mimivirus	25.3	2.9e-14
WP_032002964.1|2934964_2935405_+	hypothetical protein	NA	A0A0N7IRE9	Acinetobacter_phage	97.9	4.4e-75
WP_032002963.1|2935407_2935731_+	hypothetical protein	NA	A0A0P0IRC4	Acinetobacter_phage	98.1	7.4e-56
WP_032002961.1|2935742_2936846_+	ATP-binding protein	NA	A0A1B1P9H8	Acinetobacter_phage	55.9	4.1e-53
WP_001043692.1|2938115_2939048_+|transposase	IS5-like element ISAba13 family transposase	transposase	Q1MVF0	Enterobacteria_phage	39.6	9.7e-56
WP_000037347.1|2939539_2940403_-	iron-containing redox enzyme family protein	NA	NA	NA	NA	NA
WP_000043926.1|2940726_2941299_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000075452.1|2941910_2943251_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_000509752.1|2943668_2945087_+	glutamate synthase	NA	NA	NA	NA	NA
WP_000474098.1|2945297_2946353_+	linear amide C-N hydrolase	NA	NA	NA	NA	NA
WP_086225912.1|2946409_2946913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001290023.1|2946973_2948002_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001127143.1|2948001_2949132_-	YdcF family protein	NA	NA	NA	NA	NA
WP_005119988.1|2949136_2950171_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_000388070.1|2950190_2950694_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_086225914.1|2950994_2952233_-	lactonase family protein	NA	NA	NA	NA	NA
WP_032002959.1|2952464_2953622_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000165805.1|2953621_2954056_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_000632984.1|2954104_2956333_-|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_032002958.1|2956656_2958693_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	31.6	1.7e-41
WP_000739695.1|2958816_2959431_-|protease	metalloprotease secretion chaperone CpaB	protease	NA	NA	NA	NA
>prophage 8
NZ_CP018677	Acinetobacter baumannii strain LAC4 chromosome, complete genome	3974606	2982501	3036237	3974606	tRNA,coat,transposase	Enterobacteria_phage(28.57%)	46	NA	NA
WP_001043692.1|2982501_2983434_+|transposase	IS5-like element ISAba13 family transposase	transposase	Q1MVF0	Enterobacteria_phage	39.6	9.7e-56
WP_000720299.1|2983490_2983922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001043692.1|2984009_2984942_+|transposase	IS5-like element ISAba13 family transposase	transposase	Q1MVF0	Enterobacteria_phage	39.6	9.7e-56
WP_000161254.1|2985400_2985532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001989301.1|2985711_2986824_-	OmpW family protein	NA	NA	NA	NA	NA
WP_005119979.1|2987131_2989288_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_001019944.1|2989481_2989988_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_000825554.1|2990020_2990404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005080579.1|2990550_2992134_-|transposase	IS66-like element ISAba25 family transposase	transposase	A0A218MNE7	uncultured_virus	54.0	7.2e-144
WP_000618091.1|2992208_2992544_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_001055585.1|2992540_2992924_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_000650375.1|2993077_2993359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001123841.1|2993547_2994018_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	45.4	1.4e-31
WP_000179474.1|2994430_2994682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000345332.1|2994980_2996216_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_000527031.1|2996665_2998903_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_001133114.1|2998965_2999520_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001243511.1|3000459_3000798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000262548.1|3001393_3001891_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000920706.1|3002553_3003237_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001279982.1|3004016_3004703_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_000055764.1|3004929_3005949_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_000873967.1|3005939_3008399_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_029777014.1|3008408_3009101_-	molecular chaperone	NA	NA	NA	NA	NA
WP_001017238.1|3010265_3012872_-	aminopeptidase N	NA	NA	NA	NA	NA
WP_000420541.1|3013190_3013448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160948611.1|3013665_3014757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000204873.1|3014790_3015618_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_086378869.1|3015739_3016105_-	5-carboxymethyl-2-hydroxymuconate Delta-isomerase	NA	NA	NA	NA	NA
WP_000808302.1|3016142_3017855_-	AAA family ATPase	NA	A0A172Q090	Acinetobacter_phage	40.0	1.3e-77
WP_000874704.1|3018085_3019258_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_001097900.1|3019453_3020422_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000494374.1|3020418_3021609_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001269055.1|3021752_3023264_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_001075435.1|3023485_3024922_+	ethanolamine permease	NA	NA	NA	NA	NA
WP_000122150.1|3024938_3026324_+	ethanolamine ammonia-lyase subunit EutB	NA	NA	NA	NA	NA
WP_000774014.1|3026334_3027150_+	ethanolamine ammonia-lyase subunit EutC	NA	NA	NA	NA	NA
WP_001098471.1|3027314_3028037_+	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000803936.1|3028494_3030222_-|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	57.2	1.5e-187
WP_000009660.1|3030390_3030900_+	peptidyl-prolyl cis-trans isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	34.0	9.4e-13
WP_000221682.1|3030915_3031635_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000462397.1|3031642_3031873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000365042.1|3032012_3032666_+	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_094190431.1|3033007_3034098_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_000854009.1|3034231_3035062_-	OXA-134 family carbapenem-hydrolyzing class D beta-lactamase OXA-235	NA	NA	NA	NA	NA
WP_094190431.1|3035147_3036237_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP018677	Acinetobacter baumannii strain LAC4 chromosome, complete genome	3974606	3271016	3283528	3974606	tail,head	Acinetobacter_phage(40.0%)	22	NA	NA
WP_032002913.1|3271016_3271577_-	hypothetical protein	NA	A0A1B1IRI7	uncultured_Mediterranean_phage	36.8	2.0e-24
WP_032002912.1|3271637_3272165_-	DUF2829 domain-containing protein	NA	A0A1B0VMG3	Pseudomonas_phage	47.9	4.1e-35
WP_032002910.1|3272240_3273140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032002909.1|3273151_3273775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032002907.1|3273767_3274253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032002905.1|3274249_3275893_-|head,tail	head-tail connector protein	head,tail	A0A2H4J3N6	uncultured_Caudovirales_phage	45.0	1.5e-123
WP_032002903.1|3275894_3276125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032002902.1|3276124_3276448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032002901.1|3276514_3276694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032002899.1|3276788_3277013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032002898.1|3277009_3277327_-	hypothetical protein	NA	A0A068CBJ8	Acinetobacter_phage	45.6	3.3e-08
WP_032002897.1|3277328_3277631_-	hypothetical protein	NA	A0A1B1P9J7	Acinetobacter_phage	59.3	3.9e-14
WP_032002895.1|3277623_3277839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032002893.1|3277831_3278149_-	hypothetical protein	NA	A0A1J0MGQ3	Acinetobacter_phage	96.2	4.9e-52
WP_001261846.1|3278145_3278550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032002892.1|3278567_3278987_-	hypothetical protein	NA	H2DE79	Erwinia_phage	51.6	4.2e-27
WP_001106885.1|3278983_3279136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017724812.1|3279132_3279321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032002891.1|3279317_3280052_-	ATP-binding protein	NA	A0A0D4DBZ2	Acinetobacter_phage	52.4	4.4e-64
WP_000128669.1|3281013_3281949_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.0	8.3e-23
WP_001010537.1|3281945_3282719_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000110166.1|3282715_3283528_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A126HHM5	Vibrio_phage	37.2	5.0e-40
>prophage 10
NZ_CP018677	Acinetobacter baumannii strain LAC4 chromosome, complete genome	3974606	3328286	3343084	3974606		Acinetobacter_phage(100.0%)	9	NA	NA
WP_000566785.1|3328286_3328862_+	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	A0A0P0IKJ1	Acinetobacter_phage	99.5	1.2e-109
WP_000281148.1|3331737_3334470_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	98.2	0.0e+00
WP_001982145.1|3334825_3335875_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	100.0	9.8e-190
WP_000608310.1|3335884_3336691_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	99.3	3.9e-146
WP_000066126.1|3336700_3337396_+	Smr/MutS family protein	NA	A0A0P0IDT4	Acinetobacter_phage	100.0	5.8e-122
WP_001164242.1|3337406_3338390_-	xanthine dehydrogenase accessory protein XdhC	NA	A0A0P0IKN7	Acinetobacter_phage	96.3	2.9e-183
WP_001076827.1|3338396_3340772_-	xanthine dehydrogenase molybdopterin binding subunit	NA	A0A0P0I429	Acinetobacter_phage	97.9	0.0e+00
WP_000893694.1|3340773_3342273_-	xanthine dehydrogenase small subunit	NA	A0A0P0IVM8	Acinetobacter_phage	97.0	2.1e-278
WP_001187844.1|3342535_3343084_+	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	100.0	1.7e-97
>prophage 11
NZ_CP018677	Acinetobacter baumannii strain LAC4 chromosome, complete genome	3974606	3663126	3721320	3974606	tRNA,protease,transposase	uncultured_virus(25.0%)	49	NA	NA
WP_000722324.1|3663126_3663843_+|protease	metalloprotease	protease	NA	NA	NA	NA
WP_000231479.1|3665560_3666868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010326927.1|3667870_3668896_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.7	8.8e-26
WP_000526261.1|3668966_3670469_-	cation:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	32.2	2.6e-18
WP_001267349.1|3670706_3671606_-	neutral zinc metallopeptidase	NA	NA	NA	NA	NA
WP_000146247.1|3671635_3672559_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_000072945.1|3672766_3673780_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_094190431.1|3673868_3674958_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_000114637.1|3675383_3676274_-	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	31.6	2.9e-17
WP_001048573.1|3676288_3677455_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_000082610.1|3677602_3679036_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.7	9.4e-42
WP_000179879.1|3679098_3680295_-	2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_000529161.1|3680294_3683147_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_001986360.1|3683137_3683272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000086385.1|3683705_3684416_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000500957.1|3684430_3686266_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_000833672.1|3686278_3686644_-	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_001984863.1|3686643_3687045_-	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_001287579.1|3687999_3689274_+	citrate (Si)-synthase	NA	NA	NA	NA	NA
WP_001981983.1|3689343_3689829_-	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_000994655.1|3689940_3690873_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_001274941.1|3690996_3691521_-	YecA family protein	NA	NA	NA	NA	NA
WP_000099358.1|3691596_3691803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001281941.1|3692161_3694048_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.3	1.3e-38
WP_000887099.1|3694145_3694433_+	DUF493 domain-containing protein	NA	NA	NA	NA	NA
WP_000050856.1|3694616_3695270_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_000626048.1|3695350_3695884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001118410.1|3695885_3697070_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000183443.1|3697335_3698721_+	APC family permease	NA	NA	NA	NA	NA
WP_000071875.1|3698761_3699322_-	flavodoxin family protein	NA	NA	NA	NA	NA
WP_001002019.1|3699439_3699820_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000582212.1|3699869_3700343_-|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_000350911.1|3700419_3701793_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_000566834.1|3701860_3703132_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	54.9	2.0e-96
WP_001177773.1|3703250_3704039_-	DUF3298 domain-containing protein	NA	NA	NA	NA	NA
WP_088766618.1|3704166_3704814_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000201632.1|3705102_3705360_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_000271409.1|3705378_3705690_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_000667118.1|3705786_3706086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000234081.1|3706133_3707111_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_000547887.1|3707125_3709186_+	site-specific recombinase	NA	NA	NA	NA	NA
WP_001055585.1|3709389_3709773_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_000618091.1|3709769_3710105_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005080579.1|3710179_3711763_+|transposase	IS66-like element ISAba25 family transposase	transposase	A0A218MNE7	uncultured_virus	54.0	7.2e-144
WP_094190431.1|3712118_3713209_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_000986589.1|3713709_3714960_+	multidrug efflux RND transporter periplasmic adaptor subunit AdeI	NA	NA	NA	NA	NA
WP_000046678.1|3714972_3718149_+	multidrug efflux RND transporter permease subunit AdeJ	NA	NA	NA	NA	NA
WP_001174793.1|3718148_3719603_+	multidrug efflux RND transporter outer membrane channel subunit AdeK	NA	NA	NA	NA	NA
WP_005080579.1|3719736_3721320_-|transposase	IS66-like element ISAba25 family transposase	transposase	A0A218MNE7	uncultured_virus	54.0	7.2e-144
