The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016213	Listeria monocytogenes strain CFSAN029793, complete genome	3030827	575899	583322	3030827		Hokovirus(33.33%)	8	NA	NA
WP_003730941.1|575899_576283_+	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	40.7	1.4e-16
WP_069023903.1|576304_577288_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	33.8	2.6e-11
WP_026747136.1|577302_578316_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	31.2	1.8e-10
WP_003721509.1|578524_580015_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	49.7	9.5e-114
WP_023550416.1|580026_580851_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.2	1.3e-67
WP_009929872.1|580863_581172_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_009929871.1|581232_581637_+	PTS lactose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_023550418.1|581765_583322_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	29.2	6.0e-18
>prophage 2
NZ_CP016213	Listeria monocytogenes strain CFSAN029793, complete genome	3030827	679179	780862	3030827	protease,tRNA,terminase,portal,capsid,tail,integrase,holin	Listeria_phage(77.61%)	113	704928:704951	750270:750293
WP_003721619.1|679179_680232_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	34.9	1.3e-29
WP_074046877.1|680231_682640_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003721621.1|682800_683502_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.8	3.0e-33
WP_023550449.1|683515_686926_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_003724750.1|687023_687476_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003724751.1|687491_690692_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_003724752.1|690795_691470_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	47.7	3.4e-50
WP_012681263.1|691507_692434_-	ribonuclease HIII	NA	NA	NA	NA	NA
WP_003740576.1|692587_692851_+	cell division protein ZapA	NA	NA	NA	NA	NA
WP_003726937.1|692850_693393_+	CvpA family protein	NA	NA	NA	NA	NA
WP_003726936.1|693484_695197_+	DNA polymerase/3'-5' exonuclease PolX	NA	A0A2H4UV14	Bodo_saltans_virus	24.5	1.9e-17
WP_003734676.1|695219_697577_+	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	50.4	1.0e-21
WP_003723853.1|697657_697969_+	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	39.6	5.4e-19
WP_003726544.1|698044_699856_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_003726934.1|700036_701251_+	aspartate kinase	NA	NA	NA	NA	NA
WP_074046878.1|701306_701801_-	YslB family protein	NA	NA	NA	NA	NA
WP_003723856.1|701948_702749_+	glutamate racemase	NA	NA	NA	NA	NA
WP_003730987.1|702761_703508_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_009928777.1|703510_704122_+	XTP/dITP diphosphatase	NA	Q66YC8	Euphorbia_ringspot_virus	28.0	8.7e-05
WP_003726034.1|704158_704683_+	metallophosphoesterase	NA	NA	NA	NA	NA
704928:704951	attL	TGAATGTTTTAGAGATTTTTTTAT	NA	NA	NA	NA
WP_031660124.1|704968_706123_-|integrase	site-specific integrase	integrase	A0A059T688	Listeria_phage	94.8	1.1e-207
WP_014930257.1|706252_707116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026747145.1|707167_707620_-	ImmA/IrrE family metallo-endopeptidase	NA	R4IBK9	Listeria_phage	87.3	9.1e-76
WP_046811187.1|707636_707960_-	helix-turn-helix transcriptional regulator	NA	Q8W5Y0	Listeria_phage	72.0	1.2e-37
WP_003730994.1|708360_708564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003730995.1|708630_708822_+	helix-turn-helix transcriptional regulator	NA	A0A059T5F8	Listeria_phage	87.1	5.4e-22
WP_003730996.1|708843_709086_+	hypothetical protein	NA	A8ATD2	Listeria_phage	93.8	3.9e-41
WP_003730997.1|709088_709274_+	hypothetical protein	NA	A8ATD3	Listeria_phage	98.4	3.7e-28
WP_074046879.1|709967_710219_+	hypothetical protein	NA	Q8W5X5	Listeria_phage	90.4	3.4e-32
WP_074046970.1|710239_710953_+	SAM-dependent DNA methyltransferase	NA	A8ATD5	Listeria_phage	97.0	5.5e-128
WP_074046880.1|710963_711908_+|integrase	site-specific integrase	integrase	A8ATD6	Listeria_phage	98.1	5.0e-177
WP_074046881.1|711919_712435_+	hypothetical protein	NA	A8ATD7	Listeria_phage	39.6	1.1e-21
WP_074046883.1|712680_712911_+	hypothetical protein	NA	A0A059T7Z5	Listeria_phage	97.4	4.5e-39
WP_074046884.1|712913_713474_+	DUF1642 domain-containing protein	NA	A8ATY9	Listeria_phage	82.8	1.2e-88
WP_074046885.1|713829_714228_+	hypothetical protein	NA	D2IZL0	Enterococcus_phage	71.4	2.1e-23
WP_070007732.1|714217_714418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014930897.1|714414_714666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074046886.1|714769_714952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074046887.1|714948_715350_+	hypothetical protein	NA	A8ATZ6	Listeria_phage	80.9	2.1e-52
WP_074046888.1|715346_715844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074046889.1|715878_716139_+	hypothetical protein	NA	Q8W5W6	Listeria_phage	49.4	6.0e-16
WP_074046890.1|716141_716366_+	hypothetical protein	NA	A0A288TY32	Enterococcus_phage	53.5	2.0e-15
WP_074046891.1|716532_716916_+	hypothetical protein	NA	Q8W5W2	Listeria_phage	93.7	2.4e-61
WP_074046892.1|716917_717397_+	siphovirus Gp157 family protein	NA	R4IBM0	Listeria_phage	67.7	3.8e-48
WP_074046893.1|717415_718108_+	AAA family ATPase	NA	A8ATF0	Listeria_phage	93.9	3.2e-120
WP_074046894.1|718171_719428_+	DEAD/DEAH box helicase	NA	Q8W5V9	Listeria_phage	96.9	4.4e-237
WP_074046895.1|719452_719938_+	DUF669 domain-containing protein	NA	A0A059T5G4	Listeria_phage	99.4	6.5e-88
WP_074046896.1|719960_722303_+	DNA primase	NA	A0A059T6A4	Listeria_phage	43.4	4.2e-148
WP_014929539.1|722598_722919_+	VRR-NUC domain-containing protein	NA	Q8W5V6	Listeria_phage	98.1	1.2e-53
WP_039389924.1|722915_723185_+	hypothetical protein	NA	W0GBM0	Listeria_phage	73.6	5.3e-15
WP_074046971.1|723295_723826_+	DUF3310 domain-containing protein	NA	A0A059T7T5	Listeria_phage	78.4	3.3e-77
WP_009928014.1|724017_724443_+	DUF722 domain-containing protein	NA	Q8W5V4	Listeria_phage	93.6	2.7e-69
WP_070275360.1|725053_725380_+	hypothetical protein	NA	A0A059T5G5	Listeria_phage	94.4	8.6e-52
WP_074046897.1|725379_725694_+	HNH endonuclease	NA	A8ATF8	Listeria_phage	96.2	7.2e-56
WP_031646261.1|725742_726099_+	hypothetical protein	NA	A8AT94	Listeria_phage	98.0	2.6e-46
WP_023552366.1|726095_727739_+|terminase	terminase large subunit	terminase	A8AT95	Listeria_phage	98.7	0.0e+00
WP_023552368.1|727750_728881_+|portal	phage portal protein	portal	A8AT96	Listeria_phage	93.1	2.2e-203
WP_023548924.1|728877_729675_+|protease	Clp protease ClpP	protease	A0A059T5F2	Listeria_phage	95.1	1.2e-136
WP_003731647.1|729701_730853_+|capsid	phage major capsid protein	capsid	A8AT98	Listeria_phage	93.2	2.7e-201
WP_003731645.1|731039_731339_+	hypothetical protein	NA	A8ATA0	Listeria_phage	100.0	5.3e-48
WP_003731644.1|731322_731688_+	hypothetical protein	NA	A8ATA1	Listeria_phage	100.0	1.3e-64
WP_003731643.1|731684_732086_+	hypothetical protein	NA	A8ATA2	Listeria_phage	100.0	2.1e-68
WP_003731642.1|732082_732466_+	hypothetical protein	NA	A8ATA3	Listeria_phage	99.2	8.5e-67
WP_003731641.1|732487_733075_+|tail	phage tail protein	tail	A8ATA4	Listeria_phage	99.0	9.9e-107
WP_023548918.1|733146_733479_+	hypothetical protein	NA	A8ATA5	Listeria_phage	97.3	4.3e-51
WP_074046898.1|733693_738619_+|tail	phage tail tape measure protein	tail	A0A059T5F4	Listeria_phage	94.0	0.0e+00
WP_023553822.1|738611_740261_+|tail	phage tail protein	tail	A0A059T682	Listeria_phage	99.6	0.0e+00
WP_074046899.1|742556_743651_+	carbohydrate-binding protein CenC	NA	A0A059T7R4	Listeria_phage	97.5	1.4e-199
WP_003722523.1|743689_744055_+	hypothetical protein	NA	Q9T1A0	Listeria_phage	100.0	7.4e-12
WP_003722522.1|744067_744349_+|holin	holin	holin	A8ASL4	Listeria_phage	94.6	3.4e-41
WP_061663760.1|744348_745194_+	peptidase M15	NA	A0A059T7Y8	Listeria_phage	95.1	8.3e-139
WP_031645776.1|745433_745613_+	hypothetical protein	NA	A0A0B5CU31	Listeria_phage	96.6	3.5e-23
WP_031645777.1|745612_746152_+	GNAT family N-acetyltransferase	NA	A0A0B5CYP1	Listeria_phage	79.2	1.5e-77
WP_003731274.1|746244_746742_-	AP2 domain-containing protein	NA	A8ATW6	Listeria_phage	95.8	1.9e-87
WP_003731275.1|746766_747216_-	anti-CRISPR protein AcrIIA1	NA	A8ATW7	Listeria_phage	98.7	2.0e-75
WP_003731276.1|747216_747468_-	hypothetical protein	NA	A8ATW8	Listeria_phage	100.0	2.0e-40
WP_003731277.1|747499_747733_-	hypothetical protein	NA	A8ATW9	Listeria_phage	100.0	4.3e-13
WP_074046900.1|748034_748268_+	hypothetical protein	NA	A8ATC5	Listeria_phage	98.7	4.7e-36
WP_009915668.1|748264_748456_+	hypothetical protein	NA	A8ATC6	Listeria_phage	87.3	8.9e-25
WP_003726035.1|748650_748752_-	hypothetical protein	NA	A0A059T688	Listeria_phage	66.7	2.4e-05
WP_003726037.1|749148_749622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009928186.1|749727_750090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046811197.1|750758_754889_+	LapB repeat-containing protein	NA	NA	NA	NA	NA
750270:750293	attR	TGAATGTTTTAGAGATTTTTTTAT	NA	NA	NA	NA
WP_003726042.1|755011_756370_+	DUF1254 domain-containing protein	NA	NA	NA	NA	NA
WP_003726043.1|756412_757006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003726044.1|757142_757550_-	glyoxalase/bleomycin resistance/extradiol dioxygenase family protein	NA	NA	NA	NA	NA
WP_003726045.1|757714_758314_+	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	41.0	1.3e-29
WP_009928848.1|758345_758606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023550481.1|758729_760142_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	4.9e-51
WP_003726048.1|760166_760430_+	DUF3116 domain-containing protein	NA	NA	NA	NA	NA
WP_003727535.1|760597_761074_+	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_003726050.1|761111_761357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003726051.1|761353_762559_-	MFS transporter	NA	NA	NA	NA	NA
WP_003726058.1|762579_762765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003726052.1|762763_763423_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_003726053.1|763462_763657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003726054.1|763723_764572_-	YitT family protein	NA	NA	NA	NA	NA
WP_003726055.1|765189_765903_+	trehalose operon repressor	NA	NA	NA	NA	NA
WP_014929571.1|765933_767580_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_003727531.1|767598_769083_-	PTS system trehalose-specific EIIBC component	NA	NA	NA	NA	NA
WP_003726723.1|769200_769662_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003726717.1|769700_770165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003726718.1|770353_771268_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_023550483.1|771293_772541_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	51.8	7.2e-107
WP_003726720.1|772524_773355_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.4	3.6e-46
WP_003734523.1|773501_774641_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003723563.1|774720_775116_-	helix-turn-helix transcriptional regulator	NA	A9D9J6	Lactobacillus_prophage	57.4	1.3e-14
WP_003727524.1|775266_775482_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003727523.1|775605_776139_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_003731300.1|776154_776820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003727521.1|777081_778020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003723884.1|778134_779418_+	trigger factor	NA	NA	NA	NA	NA
WP_003723886.1|779602_780862_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.2	1.4e-145
>prophage 3
NZ_CP016213	Listeria monocytogenes strain CFSAN029793, complete genome	3030827	1321430	1329716	3030827		Synechococcus_phage(33.33%)	8	NA	NA
WP_003726209.1|1321430_1321997_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.4	8.3e-26
WP_003726210.1|1321993_1323043_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.4	3.2e-63
WP_003722245.1|1323061_1324489_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.6	1.1e-53
WP_031644866.1|1324473_1326693_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.0	1.7e-159
WP_003726212.1|1326685_1327369_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003722248.1|1327372_1327618_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003726214.1|1327629_1328343_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3F9V5	Synechococcus_phage	38.3	2.0e-40
WP_003729814.1|1328423_1329716_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.0	2.5e-17
>prophage 4
NZ_CP016213	Listeria monocytogenes strain CFSAN029793, complete genome	3030827	1856470	1896917	3030827	terminase,portal,plate,capsid,tail,integrase,holin	Listeria_phage(98.15%)	58	1856638:1856653	1891672:1891687
WP_074046911.1|1856470_1856668_-	hypothetical protein	NA	A8ATC6	Listeria_phage	73.7	7.0e-17
1856638:1856653	attL	ACTTAAAATCATTAAA	NA	NA	NA	NA
WP_074046912.1|1856664_1856898_-	hypothetical protein	NA	A0A059T6E1	Listeria_phage	94.8	6.1e-36
WP_025370597.1|1857457_1858159_-	DUF3800 domain-containing protein	NA	R4IBV1	Listeria_phage	97.8	6.4e-129
WP_061725267.1|1858306_1859158_-	peptidase M15	NA	A0A059T7Y8	Listeria_phage	95.1	4.4e-140
WP_003722522.1|1859157_1859439_-|holin	holin	holin	A8ASL4	Listeria_phage	94.6	3.4e-41
WP_003722523.1|1859451_1859817_-	hypothetical protein	NA	Q9T1A0	Listeria_phage	100.0	7.4e-12
WP_003722524.1|1859844_1860003_-	hypothetical protein	NA	Q9T1A1	Listeria_phage	100.0	6.0e-19
WP_003722525.1|1860007_1860325_-	hypothetical protein	NA	Q9T1A2	Listeria_phage	100.0	6.2e-55
WP_074046913.1|1860336_1861410_-|plate	phage baseplate upper protein	plate	Q9T1A3	Listeria_phage	96.4	1.3e-189
WP_003722527.1|1861409_1862438_-	hypothetical protein	NA	Q9T1A4	Listeria_phage	100.0	4.6e-192
WP_003722528.1|1862438_1863464_-	hypothetical protein	NA	Q9T1A5	Listeria_phage	98.2	4.3e-198
WP_031644600.1|1863472_1864291_-|tail	phage tail family protein	tail	Q9T1A6	Listeria_phage	92.3	3.6e-147
WP_074046914.1|1864292_1869677_-	tape measure protein	NA	Q9T1A7	Listeria_phage	89.4	0.0e+00
WP_031644596.1|1869692_1870292_-	hypothetical protein	NA	A0A0B5CTW0	Listeria_phage	68.0	8.1e-72
WP_031644594.1|1870297_1870720_-	hypothetical protein	NA	Q9T1A9	Listeria_phage	99.3	2.0e-69
WP_031644591.1|1870774_1871107_-	Ig-like virion protein	NA	Q9T1B0	Listeria_phage	98.2	4.1e-49
WP_031644589.1|1871036_1871474_-	hypothetical protein	NA	A0A0B5CYN3	Listeria_phage	99.3	1.2e-77
WP_010679811.1|1871476_1871884_-	hypothetical protein	NA	A0A0B5CU21	Listeria_phage	98.5	1.2e-66
WP_031644586.1|1871883_1872222_-	hypothetical protein	NA	Q9T1B3	Listeria_phage	99.1	8.3e-58
WP_031644585.1|1872221_1872584_-	hypothetical protein	NA	Q9T1B4	Listeria_phage	97.5	4.1e-63
WP_031644583.1|1872583_1872979_-	hypothetical protein	NA	A8ASJ8	Listeria_phage	96.2	8.2e-65
WP_074046915.1|1872980_1873139_-	hypothetical protein	NA	Q9T1B6	Listeria_phage	96.2	5.1e-18
WP_021496950.1|1873138_1874038_-|capsid	phage major capsid protein	capsid	A0A0B5CU19	Listeria_phage	100.0	9.0e-168
WP_010990217.1|1874061_1874631_-	scaffold protein	NA	Q9T1B8	Listeria_phage	97.4	7.4e-91
WP_074046916.1|1875849_1877610_-|portal	phage portal protein	portal	A0A0B5D0F2	Listeria_phage	93.3	2.2e-266
WP_070779510.1|1877622_1878954_-|terminase	PBSX family phage terminase large subunit	terminase	A8ASJ2	Listeria_phage	94.6	6.7e-252
WP_070779502.1|1878922_1879465_-|terminase	terminase small subunit	terminase	A0A0B5CU16	Listeria_phage	95.5	3.4e-85
WP_074046917.1|1879508_1879937_-	hypothetical protein	NA	A8ASQ1	Listeria_phage	38.6	4.6e-13
WP_074046918.1|1880405_1880840_-	hypothetical protein	NA	A8ASQ1	Listeria_phage	91.0	1.4e-70
WP_031644575.1|1880858_1881023_-	hypothetical protein	NA	A8ASQ0	Listeria_phage	94.4	7.4e-20
WP_031644573.1|1881151_1881556_-	endodeoxyribonuclease	NA	A8AU00	Listeria_phage	98.5	2.7e-71
WP_003759675.1|1881521_1881662_-	BH0509 family protein	NA	A8ATZ9	Listeria_phage	87.0	4.7e-15
WP_039382681.1|1881658_1881964_-	hypothetical protein	NA	A8ATZ8	Listeria_phage	83.2	1.9e-37
WP_074046919.1|1881995_1882475_-	single-stranded DNA-binding protein	NA	A8ASP5	Listeria_phage	94.4	7.1e-79
WP_074046920.1|1882531_1882774_-	hypothetical protein	NA	R4ICD9	Listeria_phage	96.2	1.1e-40
WP_074046921.1|1882770_1883295_-	hypothetical protein	NA	A8ASP1	Listeria_phage	83.8	5.5e-32
WP_074046922.1|1883416_1884097_-	hypothetical protein	NA	A8ATD7	Listeria_phage	90.3	3.0e-115
WP_074046923.1|1884109_1885054_-|integrase	site-specific integrase	integrase	A8ATD6	Listeria_phage	96.2	2.3e-174
WP_074046924.1|1885064_1885775_-	SAM-dependent DNA methyltransferase	NA	A8ATD5	Listeria_phage	95.4	1.5e-125
WP_074046925.1|1885771_1886707_-	DnaD domain-containing protein	NA	A8ATY7	Listeria_phage	91.0	9.4e-152
WP_074046926.1|1886726_1887542_-	recombinase RecT	NA	Q9T172	Listeria_phage	98.9	5.9e-150
WP_003722563.1|1887544_1888504_-	YqaJ viral recombinase family protein	NA	A8ATY5	Listeria_phage	96.9	1.5e-173
WP_003722564.1|1888738_1888927_-	hypothetical protein	NA	Q9T175	Listeria_phage	82.3	1.8e-22
WP_074046927.1|1889035_1889251_-	hypothetical protein	NA	Q9T176	Listeria_phage	90.1	1.8e-26
WP_074046928.1|1889247_1889781_-	hypothetical protein	NA	A0A059T5F0	Listeria_phage	87.9	6.7e-78
WP_074046929.1|1889903_1890683_-	phage antirepressor Ant	NA	A8ASM6	Listeria_phage	95.7	7.1e-137
WP_003727749.1|1890746_1890989_+	hypothetical protein	NA	A0A059T7Q3	Listeria_phage	100.0	1.8e-38
WP_061109212.1|1891174_1891456_-	hypothetical protein	NA	A8ATX8	Listeria_phage	98.9	2.5e-39
WP_003733686.1|1891481_1891766_-	hypothetical protein	NA	A0A0B5D168	Listeria_phage	85.1	4.5e-41
1891672:1891687	attR	TTTAATGATTTTAAGT	NA	NA	NA	NA
WP_003733687.1|1891777_1891972_-	hypothetical protein	NA	A0A059T6E5	Listeria_phage	95.3	1.4e-25
WP_003722568.1|1891968_1892211_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003722569.1|1892366_1892843_+	helix-turn-helix domain-containing protein	NA	A8ASM2	Listeria_phage	62.0	9.0e-42
WP_020975175.1|1893001_1893169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074046930.1|1893223_1893925_+	hypothetical protein	NA	A0A0B5D125	Listeria_phage	85.8	1.0e-86
WP_003722571.1|1893945_1894626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074046931.1|1894689_1896048_+	recombinase family protein	NA	Q8LTD8	Listeria_phage	98.7	1.1e-254
WP_003741076.1|1896038_1896515_+	competence protein ComK	NA	NA	NA	NA	NA
WP_003739618.1|1896569_1896917_-	helix-turn-helix transcriptional regulator	NA	A0A0A7RTK4	Clostridium_phage	40.7	9.9e-06
>prophage 5
NZ_CP016213	Listeria monocytogenes strain CFSAN029793, complete genome	3030827	2033384	2075835	3030827	terminase,capsid,tail,integrase,holin	Listeria_phage(94.83%)	58	2035085:2035104	2073376:2073395
WP_009927819.1|2033384_2033720_+	DUF898 family protein	NA	S5MNN8	Brevibacillus_phage	64.1	3.6e-21
WP_009927821.1|2033992_2034733_+	hypothetical protein	NA	A8ASM1	Listeria_phage	76.8	2.3e-108
2035085:2035104	attL	TTTGTACTTTATTTGAACTT	NA	NA	NA	NA
WP_052713350.1|2035135_2035339_-	hypothetical protein	NA	A8ATX1	Listeria_phage	85.1	9.1e-28
WP_046336509.1|2035335_2035569_-	hypothetical protein	NA	A0A059T6E1	Listeria_phage	96.1	2.3e-35
WP_003731277.1|2035870_2036104_+	hypothetical protein	NA	A8ATW9	Listeria_phage	100.0	4.3e-13
WP_003731276.1|2036135_2036387_+	hypothetical protein	NA	A8ATW8	Listeria_phage	100.0	2.0e-40
WP_003731275.1|2036387_2036837_+	anti-CRISPR protein AcrIIA1	NA	A8ATW7	Listeria_phage	98.7	2.0e-75
WP_003731274.1|2036861_2037359_+	AP2 domain-containing protein	NA	A8ATW6	Listeria_phage	95.8	1.9e-87
WP_031645777.1|2037451_2037991_-	GNAT family N-acetyltransferase	NA	A0A0B5CYP1	Listeria_phage	79.2	1.5e-77
WP_031645776.1|2037990_2038170_-	hypothetical protein	NA	A0A0B5CU31	Listeria_phage	96.6	3.5e-23
WP_061663760.1|2038409_2039255_-	peptidase M15	NA	A0A059T7Y8	Listeria_phage	95.1	8.3e-139
WP_014929558.1|2039254_2039536_-|holin	phage holin	holin	A8ATW3	Listeria_phage	98.9	6.7e-45
WP_003733957.1|2039535_2039841_-	hypothetical protein	NA	A0A059T5E6	Listeria_phage	100.0	1.8e-43
WP_074046932.1|2039891_2042054_-	hypothetical protein	NA	A8ATW1	Listeria_phage	98.8	0.0e+00
WP_003731724.1|2042066_2043635_-	hypothetical protein	NA	A8ATW0	Listeria_phage	99.6	4.7e-305
WP_074046933.1|2043631_2048422_-|tail	phage tail tape measure protein	tail	A8ATV9	Listeria_phage	96.3	0.0e+00
WP_074046934.1|2048426_2048738_-	hypothetical protein	NA	A0A0B5D116	Listeria_phage	96.7	1.3e-41
WP_047934336.1|2048734_2049166_-	hypothetical protein	NA	A8ATV7	Listeria_phage	98.6	1.8e-73
WP_003733697.1|2049220_2049910_-	Ig domain-containing protein	NA	A8ATV6	Listeria_phage	85.6	2.8e-100
WP_010991155.1|2049914_2050286_-	hypothetical protein	NA	A0A0B5CTY4	Listeria_phage	99.2	5.5e-63
WP_074046935.1|2050282_2050600_-	HK97 gp10 family phage protein	NA	A8ATV4	Listeria_phage	99.0	1.1e-51
WP_074046936.1|2050589_2050955_-	hypothetical protein	NA	A8ATV3	Listeria_phage	98.3	4.9e-64
WP_031644307.1|2050954_2051308_-	hypothetical protein	NA	A8ATV2	Listeria_phage	99.1	3.8e-61
WP_031659979.1|2051483_2052356_-	hypothetical protein	NA	A8ATV0	Listeria_phage	99.3	3.6e-161
WP_046670970.1|2052378_2052933_-	hypothetical protein	NA	A8ATU9	Listeria_phage	98.9	7.4e-88
WP_074046937.1|2053028_2054072_-|capsid	minor capsid protein	capsid	A0A0B5D111	Listeria_phage	98.3	1.3e-197
WP_074046938.1|2054076_2055633_-	hypothetical protein	NA	A8ATU7	Listeria_phage	99.0	5.0e-299
WP_074046939.1|2055647_2056976_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0B5CYJ6	Listeria_phage	86.6	8.5e-231
WP_068996124.1|2056905_2057691_-	TerS	NA	A0A0B5CTX0	Listeria_phage	96.7	4.2e-129
WP_068996231.1|2057730_2057958_-	hypothetical protein	NA	A8AU06	Listeria_phage	96.0	1.1e-32
WP_031643386.1|2058037_2058670_-	hypothetical protein	NA	A8AU05	Listeria_phage	93.3	2.1e-107
WP_074046940.1|2058851_2059286_-	hypothetical protein	NA	A8AU03	Listeria_phage	94.4	2.6e-72
WP_074046941.1|2059425_2059809_-	DUF2481 domain-containing protein	NA	A0A0B5CU14	Listeria_phage	90.6	2.6e-60
WP_074046942.1|2059812_2060217_-	DUF1064 domain-containing protein	NA	A8ASP7	Listeria_phage	88.1	4.0e-59
WP_074046943.1|2060161_2060344_-	hypothetical protein	NA	A8ASP6	Listeria_phage	81.0	3.4e-18
WP_074046944.1|2060362_2060845_-	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	93.1	1.9e-76
WP_074046945.1|2060844_2061246_-	hypothetical protein	NA	A8ATZ6	Listeria_phage	75.2	3.8e-49
WP_074046946.1|2061242_2061626_-	DUF1642 domain-containing protein	NA	Q8W5X2	Listeria_phage	93.0	2.3e-32
WP_074046881.1|2061871_2062387_-	hypothetical protein	NA	A8ATD7	Listeria_phage	39.6	1.1e-21
WP_074046880.1|2062398_2063343_-|integrase	site-specific integrase	integrase	A8ATD6	Listeria_phage	98.1	5.0e-177
WP_074046970.1|2063353_2064067_-	SAM-dependent DNA methyltransferase	NA	A8ATD5	Listeria_phage	97.0	5.5e-128
WP_074046879.1|2064087_2064339_-	hypothetical protein	NA	Q8W5X5	Listeria_phage	90.4	3.4e-32
WP_074046948.1|2064335_2065244_-	DnaD domain-containing protein	NA	A0A0B5D175	Listeria_phage	90.8	1.8e-139
WP_031668129.1|2065263_2066079_-	recombinase RecT	NA	Q9T172	Listeria_phage	98.9	1.7e-149
WP_077947935.1|2066081_2067041_-	YqaJ viral recombinase family protein	NA	A0A0B5D133	Listeria_phage	96.6	3.4e-173
WP_074046949.1|2067276_2067465_-	hypothetical protein	NA	Q9T175	Listeria_phage	77.4	5.9e-21
WP_003731810.1|2067573_2067810_-	DUF771 domain-containing protein	NA	A8ATY2	Listeria_phage	100.0	1.9e-40
WP_015987420.1|2067815_2068340_-	hypothetical protein	NA	A8ATY1	Listeria_phage	100.0	6.3e-89
WP_015987419.1|2068461_2069235_-	phage repressor protein/antirepressor Ant	NA	A8ATY0	Listeria_phage	100.0	1.1e-140
WP_003731222.1|2069818_2070172_-	hypothetical protein	NA	A8ATX8	Listeria_phage	100.0	9.9e-54
WP_015987418.1|2070168_2070405_-	hypothetical protein	NA	A8ATX7	Listeria_phage	100.0	1.1e-37
WP_003731220.1|2070408_2070660_-	helix-turn-helix transcriptional regulator	NA	A8ATX6	Listeria_phage	100.0	7.6e-40
WP_015987417.1|2070808_2071117_+	helix-turn-helix transcriptional regulator	NA	A8ATX5	Listeria_phage	100.0	9.3e-48
WP_003731218.1|2071148_2071640_+	hypothetical protein	NA	A8ATX4	Listeria_phage	100.0	2.6e-92
WP_003731217.1|2071666_2072176_+	hypothetical protein	NA	A8ATX3	Listeria_phage	100.0	2.6e-87
WP_003731216.1|2072239_2073370_+|integrase	site-specific integrase	integrase	A8ATX2	Listeria_phage	100.0	9.8e-212
WP_009927822.1|2073645_2075082_-	chitin-binding protein/carbohydrate-binding protein	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	37.8	3.6e-25
2073376:2073395	attR	TTTGTACTTTATTTGAACTT	NA	NA	NA	NA
WP_003722600.1|2075238_2075835_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.4	6.6e-58
>prophage 6
NZ_CP016213	Listeria monocytogenes strain CFSAN029793, complete genome	3030827	2079753	2087595	3030827		Streptococcus_phage(50.0%)	7	NA	NA
WP_003725407.1|2079753_2080725_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.4	5.2e-52
WP_003731212.1|2080732_2081701_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	43.6	1.8e-68
WP_003722606.1|2081702_2082578_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.7	1.9e-08
WP_003725409.1|2082685_2084416_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	53.1	9.5e-174
WP_009918600.1|2084457_2085519_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_009918601.1|2085535_2086519_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.7	3.1e-52
WP_003722610.1|2086635_2087595_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.7	2.0e-88
>prophage 7
NZ_CP016213	Listeria monocytogenes strain CFSAN029793, complete genome	3030827	2604324	2610851	3030827	tail	Listeria_phage(33.33%)	10	NA	NA
WP_003728215.1|2604324_2604777_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A059T7S0	Listeria_phage	47.9	4.0e-31
WP_003721740.1|2604782_2605118_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JAR9	uncultured_Caudovirales_phage	52.5	4.0e-20
WP_009927883.1|2605334_2605763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003731177.1|2605774_2606191_+	hypothetical protein	NA	A8ASQ1	Listeria_phage	37.9	6.5e-20
WP_003728212.1|2606470_2606860_+	DUF5072 domain-containing protein	NA	NA	NA	NA	NA
WP_003721744.1|2606872_2607385_+|tail	phage major tail protein, TP901-1 family	tail	A0A097PBF4	Streptococcus_pyogenes_phage	62.7	1.2e-47
WP_003721745.1|2607432_2607735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003740367.1|2607776_2608181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074046956.1|2608167_2610036_+	hypothetical protein	NA	A0A097PAU2	Streptococcus_pyogenes_phage	45.8	4.5e-20
WP_003734720.1|2610032_2610851_+|tail	phage tail family protein	tail	A0A060AFE1	Staphylococcus_phage	35.0	7.2e-39
