The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017241	Rhizobium etli 8C-3, complete genome	4186145	1392695	1477178	4186145	terminase,integrase,head,portal,protease,tail,capsid	Sinorhizobium_phage(60.42%)	95	1392643:1392685	1442624:1442666
1392643:1392685	attL	GTGACGGAATGTAGCGCAGTCTGGTAGCGCACTTGACTGGGGG	NA	NA	NA	NA
WP_074060794.1|1392695_1393853_-|integrase	site-specific integrase	integrase	A0A076G7B8	Sinorhizobium_phage	33.8	7.1e-48
WP_074060795.1|1393702_1394038_-	helix-turn-helix domain-containing protein	NA	A0A076GCY6	Sinorhizobium_phage	37.9	1.4e-09
WP_074060797.1|1394318_1395446_-	DNA polymerase III subunit beta	NA	R9TRR6	Rhizobium_phage	56.1	2.2e-107
WP_074060798.1|1395432_1395852_-	DUF4326 domain-containing protein	NA	A0A291AUQ7	Sinorhizobium_phage	38.9	1.8e-17
WP_074060799.1|1395854_1396808_-	DUF2303 family protein	NA	R9TSA8	Rhizobium_phage	58.7	5.2e-97
WP_074060800.1|1396837_1397179_-	hypothetical protein	NA	R9TQI8	Rhizobium_phage	64.2	1.0e-31
WP_074060801.1|1397197_1397707_-	single-stranded DNA-binding protein	NA	R9TP78	Rhizobium_phage	62.0	2.7e-52
WP_074060802.1|1397706_1398075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074060803.1|1398071_1398770_-	hypothetical protein	NA	R9TQJ1	Rhizobium_phage	55.0	4.1e-59
WP_074060804.1|1398769_1398985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155774417.1|1399059_1399263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074060807.1|1399670_1400303_-	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_081377039.1|1400468_1400672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074060809.1|1400985_1401495_+	hypothetical protein	NA	R9TQJ7	Rhizobium_phage	42.4	1.6e-20
WP_074060810.1|1401499_1401721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377040.1|1401684_1402236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074060812.1|1402288_1402723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074060813.1|1402722_1403250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377041.1|1403253_1403757_+	hypothetical protein	NA	R9TQK2	Rhizobium_phage	40.0	2.4e-13
WP_074060814.1|1403750_1403954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074063114.1|1403980_1405807_+	DNA methyltransferase	NA	A0A291AUL2	Sinorhizobium_phage	69.6	1.1e-247
WP_074060815.1|1405803_1407033_+	hypothetical protein	NA	R9TNC4	Rhizobium_phage	54.3	6.7e-113
WP_074060816.1|1407041_1408865_+	DNA primase	NA	G8DGC0	Emiliania_huxleyi_virus	30.1	1.1e-58
WP_074063115.1|1409178_1409973_+	hypothetical protein	NA	R9TRT9	Rhizobium_phage	41.4	3.3e-49
WP_074060817.1|1410146_1410893_+	hypothetical protein	NA	A0A291AUL1	Sinorhizobium_phage	77.8	1.5e-107
WP_074060818.1|1411053_1411671_+	hypothetical protein	NA	A0A291AUL0	Sinorhizobium_phage	56.4	3.0e-53
WP_074060819.1|1411667_1413710_+|terminase	terminase	terminase	A0A291AUK9	Sinorhizobium_phage	83.3	0.0e+00
WP_074060820.1|1413719_1413956_+|tail	phage tail protein	tail	A0A291AUL5	Sinorhizobium_phage	73.1	9.6e-21
WP_074060821.1|1413952_1415683_+|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	77.7	1.0e-268
WP_074060822.1|1415679_1416570_+	S49 family peptidase	NA	A0A291AUM2	Sinorhizobium_phage	77.5	1.3e-121
WP_074060823.1|1416594_1417167_+	hypothetical protein	NA	A0A291AUL6	Sinorhizobium_phage	66.5	1.7e-31
WP_074060824.1|1417169_1417526_+|head	head decoration protein	head	A0A291AUM0	Sinorhizobium_phage	76.3	1.7e-40
WP_074060825.1|1417554_1418586_+|capsid	major capsid protein	capsid	A0A291AUL7	Sinorhizobium_phage	80.6	8.2e-165
WP_074060826.1|1418651_1419083_+	hypothetical protein	NA	A0A291AUM1	Sinorhizobium_phage	34.9	3.1e-09
WP_074060827.1|1419082_1419442_+	hypothetical protein	NA	A0A291AUL9	Sinorhizobium_phage	54.7	1.2e-22
WP_074060828.1|1419443_1419743_+	hypothetical protein	NA	A0A291AUM3	Sinorhizobium_phage	45.7	3.7e-17
WP_074060829.1|1419744_1420209_+	hypothetical protein	NA	A0A291AUM4	Sinorhizobium_phage	64.7	5.7e-49
WP_074060830.1|1420241_1420652_+|tail	phage tail protein	tail	A0A291AUM5	Sinorhizobium_phage	75.7	3.1e-51
WP_074060831.1|1420665_1421067_+	hypothetical protein	NA	A0A291AUM7	Sinorhizobium_phage	44.3	4.2e-24
WP_155774477.1|1421093_1421306_+|tail	phage tail assembly chaperone	tail	A0A291AUN4	Sinorhizobium_phage	57.4	3.2e-15
WP_074060832.1|1421309_1421615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074060833.1|1421678_1423595_+|tail	tail tape measure protein	tail	A0A291AUM6	Sinorhizobium_phage	41.5	2.7e-121
WP_074060834.1|1423594_1424254_+	hypothetical protein	NA	A0A291AUM9	Sinorhizobium_phage	58.0	1.9e-61
WP_074060835.1|1424243_1424825_+	DUF2163 domain-containing protein	NA	A0A291AUM8	Sinorhizobium_phage	67.0	1.6e-69
WP_074060836.1|1424821_1425226_+	hypothetical protein	NA	A0A291AUN0	Sinorhizobium_phage	59.0	1.9e-37
WP_074060837.1|1425231_1427682_+|tail	phage tail protein	tail	A0A291AUN1	Sinorhizobium_phage	54.9	2.5e-260
WP_074060838.1|1427681_1429238_+	hypothetical protein	NA	A0A2D2W219	Sinorhizobium_phage	34.3	7.2e-64
WP_074060839.1|1429316_1431086_+|tail	tail fiber domain-containing protein	tail	A0A2L2R219	Sinorhizobium_phage	29.1	4.4e-49
WP_074060840.1|1431264_1431765_+	TIGR02594 family protein	NA	A0A0A1IUP1	Pseudomonas_phage	44.2	1.2e-33
WP_074060841.1|1431754_1432042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074060842.1|1432038_1432509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074060843.1|1432607_1432958_+	DUF1515 domain-containing protein	NA	A0A291AUW4	Sinorhizobium_phage	64.1	4.3e-33
WP_074060844.1|1433170_1434061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155774418.1|1434445_1435633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155774478.1|1435641_1436355_-	SOS response-associated peptidase	NA	A0A291AUP1	Sinorhizobium_phage	39.2	1.5e-37
WP_074060846.1|1437044_1437275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074060847.1|1437329_1438376_+	ATP-dependent DNA ligase	NA	A0A068CDF3	Rhizobium_phage	71.4	1.4e-140
WP_074060848.1|1438413_1438929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074060849.1|1438955_1439240_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_074060850.1|1439487_1439895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074060851.1|1440056_1440698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074060852.1|1441598_1441823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074060853.1|1441837_1442344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074060854.1|1443576_1443789_+	hypothetical protein	NA	NA	NA	NA	NA
1442624:1442666	attR	GTGACGGAATGTAGCGCAGTCTGGTAGCGCACTTGACTGGGGG	NA	NA	NA	NA
WP_074060855.1|1444019_1444313_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_074060856.1|1444344_1445595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074060857.1|1445591_1447142_-	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
WP_074060858.1|1447188_1448370_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_022714777.1|1448376_1448952_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_074060859.1|1449146_1451282_+	chain-length determining protein	NA	NA	NA	NA	NA
WP_074060860.1|1451282_1452506_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_074060861.1|1452629_1452839_-	DUF2842 domain-containing protein	NA	NA	NA	NA	NA
WP_074063118.1|1452950_1454054_+	heme A synthase	NA	NA	NA	NA	NA
WP_074060862.1|1454075_1454867_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_074060863.1|1454888_1455821_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_074060864.1|1455870_1456851_-	agmatinase	NA	NA	NA	NA	NA
WP_074060865.1|1456936_1457728_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_039844539.1|1457879_1458341_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_022714787.1|1458417_1458885_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_022714788.1|1458887_1459352_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_074060866.1|1459581_1460007_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_074060867.1|1460081_1460912_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_074060868.1|1461163_1462000_-	EamA family transporter	NA	NA	NA	NA	NA
WP_074060870.1|1462460_1462784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074063119.1|1462881_1463310_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_074060871.1|1463413_1464697_+	O-acetylhomoserine aminocarboxypropyltransferase	NA	A0A0B5JD48	Pandoravirus	26.2	3.8e-18
WP_074060872.1|1464824_1465088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074060873.1|1465417_1466200_+	DUF1194 domain-containing protein	NA	NA	NA	NA	NA
WP_074060874.1|1466217_1467462_-	cytochrome P450	NA	NA	NA	NA	NA
WP_074060875.1|1467513_1468767_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.6	8.8e-12
WP_074060876.1|1469134_1469764_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	58.7	6.1e-62
WP_022714809.1|1470066_1471344_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.6	8.7e-132
WP_074060877.1|1471743_1474161_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	50.0	2.0e-206
WP_074063120.1|1474366_1474642_+	HU family DNA-binding protein	NA	A0A172Q061	Acinetobacter_phage	33.0	4.6e-06
WP_132661245.1|1474967_1477178_+	alkaline phosphatase	NA	M4SLV1	Cyanophage	44.1	1.9e-81
>prophage 2
NZ_CP017241	Rhizobium etli 8C-3, complete genome	4186145	1744035	1756140	4186145	tRNA	uncultured_Mediterranean_phage(90.0%)	12	NA	NA
WP_132552647.1|1744035_1744848_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	37.3	6.3e-35
WP_074061098.1|1744847_1745561_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	47.0	7.4e-40
WP_022715359.1|1745748_1745940_+	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	69.8	2.6e-08
WP_074061099.1|1745990_1746641_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_074061100.1|1746637_1747465_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	45.3	8.3e-51
WP_074061101.1|1747566_1748850_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.4	2.5e-94
WP_074061102.1|1748854_1749622_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	29.6	6.8e-23
WP_074061103.1|1749628_1750282_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	35.2	3.1e-16
WP_074061104.1|1750454_1752047_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I3PV24	Clostridium_phage	30.8	3.9e-12
WP_074061105.1|1752123_1752996_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_022715367.1|1753207_1753555_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	40.2	4.1e-12
WP_074061106.1|1753599_1756140_+	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	46.2	1.5e-58
>prophage 3
NZ_CP017241	Rhizobium etli 8C-3, complete genome	4186145	1912774	1985164	4186145	tRNA,holin,transposase	uncultured_Mediterranean_phage(50.0%)	60	NA	NA
WP_074061232.1|1912774_1913503_+|holin	phosphatidylcholine/phosphatidylserine synthase	holin	NA	NA	NA	NA
WP_074061233.1|1913512_1914493_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_155774482.1|1914544_1916110_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.2	2.9e-20
WP_074061235.1|1916099_1917197_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_074061236.1|1917193_1918111_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_074061237.1|1918159_1919233_+	BMP family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_074061238.1|1919378_1920341_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_074061239.1|1920457_1921981_+	sugar ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.2	3.4e-10
WP_074061240.1|1921977_1922994_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_074061241.1|1922990_1923959_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_074061242.1|1923970_1924723_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_074061243.1|1924799_1926164_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	NA	NA	NA	NA
WP_074061244.1|1926258_1928085_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	40.7	1.1e-108
WP_074061245.1|1928201_1928933_+	DUF502 domain-containing protein	NA	NA	NA	NA	NA
WP_074061246.1|1928888_1930994_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_074063155.1|1931085_1931403_+	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_074061247.1|1931399_1934906_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_074063156.1|1934912_1935584_-	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_074061248.1|1935681_1937484_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_074061249.1|1937754_1938405_+	invasion associated locus B family protein	NA	NA	NA	NA	NA
WP_022715579.1|1938520_1938850_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_022715580.1|1938999_1940409_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_003539626.1|1940469_1940808_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_074061250.1|1941153_1942629_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_074061251.1|1942637_1943444_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_074061252.1|1943491_1946416_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	61.7	0.0e+00
WP_074061253.1|1946666_1947182_+	single-stranded DNA-binding protein	NA	R9TP78	Rhizobium_phage	57.9	5.9e-47
WP_074061254.1|1947495_1948113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377056.1|1948441_1949932_-	chromate efflux transporter	NA	A0A219VHC2	Ochrobactrum_phage	74.7	2.0e-34
WP_074061256.1|1949861_1950674_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_074061257.1|1950816_1951449_-	MarC family protein	NA	NA	NA	NA	NA
WP_074061258.1|1951674_1954461_+	DNA gyrase subunit A	NA	A0A1B1IVS2	uncultured_Mediterranean_phage	42.4	3.0e-76
WP_132552545.1|1954807_1954993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074063157.1|1955461_1955956_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	37.8	4.2e-26
WP_074061259.1|1955983_1956550_+	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	52.0	1.8e-41
WP_074061260.1|1956574_1957084_+	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	59.4	1.2e-44
WP_074061261.1|1957154_1958240_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_074061262.1|1958236_1959367_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	53.2	6.3e-102
WP_074061263.1|1959632_1960061_-	DUF4864 domain-containing protein	NA	NA	NA	NA	NA
WP_074061264.1|1960342_1961554_-	MFS transporter	NA	NA	NA	NA	NA
WP_074061265.1|1961906_1963415_+	adenylate cyclase	NA	NA	NA	NA	NA
WP_074061266.1|1963976_1964393_-	GFA family protein	NA	NA	NA	NA	NA
WP_074061267.1|1964440_1964905_-	polyketide cyclase	NA	NA	NA	NA	NA
WP_074061268.1|1964907_1965222_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_074063158.1|1965547_1966579_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_074061269.1|1967676_1968414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074061271.1|1969284_1969479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074061272.1|1969654_1969909_-	cbb3-type cytochrome oxidase assembly protein CcoS	NA	NA	NA	NA	NA
WP_074061273.1|1969905_1972164_-	cadmium-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	28.1	3.5e-59
WP_074061274.1|1972160_1972988_-	DUF2189 domain-containing protein	NA	NA	NA	NA	NA
WP_074061275.1|1973000_1973192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074061276.1|1973188_1974070_-	cytochrome-c oxidase, cbb3-type subunit III	NA	NA	NA	NA	NA
WP_074061277.1|1974060_1974231_-	cbb3-type cytochrome c oxidase subunit 3	NA	NA	NA	NA	NA
WP_074061278.1|1974248_1975001_-	cytochrome-c oxidase, cbb3-type subunit II	NA	NA	NA	NA	NA
WP_074061279.1|1975005_1976646_-	cytochrome-c oxidase, cbb3-type subunit I	NA	NA	NA	NA	NA
WP_074061280.1|1978274_1979447_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_074061281.1|1979835_1980573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074061282.1|1980579_1981953_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_074061283.1|1982245_1983637_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_074061284.1|1984045_1985164_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP017241	Rhizobium etli 8C-3, complete genome	4186145	2224946	2268383	4186145	terminase,integrase,head,protease,tRNA,tail,capsid	uncultured_Caudovirales_phage(15.38%)	46	2241630:2241646	2266595:2266611
WP_074061480.1|2224946_2225648_+|protease	TIGR02281 family clan AA aspartic protease	protease	NA	NA	NA	NA
WP_074061481.1|2225859_2226183_+	winged helix-turn-helix transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	43.3	2.2e-07
WP_074061482.1|2226179_2226611_+	polyketide cyclase	NA	NA	NA	NA	NA
WP_074061483.1|2226653_2226860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074063193.1|2226865_2227333_+	DUF1801 domain-containing protein	NA	NA	NA	NA	NA
WP_074061484.1|2227362_2227791_+	DUF1801 domain-containing protein	NA	NA	NA	NA	NA
WP_074061485.1|2227887_2228097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074061486.1|2228130_2228358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074061487.1|2228329_2229091_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_074061488.1|2229087_2230014_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	33.3	2.5e-24
WP_074061489.1|2230118_2230940_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_074061490.1|2231267_2231618_-	glyoxalase	NA	NA	NA	NA	NA
WP_074061491.1|2231823_2232159_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_074061492.1|2232420_2232864_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_074061493.1|2233042_2234332_-	extensin family protein	NA	NA	NA	NA	NA
WP_074063194.1|2234442_2236257_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	48.9	8.3e-11
WP_074061494.1|2236553_2236940_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_074061495.1|2236945_2237533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074061496.1|2237699_2238512_-	oxidoreductase	NA	NA	NA	NA	NA
WP_132550576.1|2239238_2239559_-	GYD domain-containing protein	NA	NA	NA	NA	NA
WP_074061499.1|2240144_2241557_+	DUF1254 domain-containing protein	NA	M1H738	Paramecium_bursaria_Chlorella_virus	41.2	1.1e-87
2241630:2241646	attL	CGGATCTCGTTTTCGAG	NA	NA	NA	NA
WP_074061500.1|2241847_2242759_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_074063195.1|2242913_2243612_+	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_074061501.1|2244054_2246061_+	ABC transporter ATP-binding protein/permease	NA	G3M9Y6	Bacillus_virus	30.2	2.3e-14
WP_074061502.1|2246150_2247323_-	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_074061503.1|2247332_2248856_-	DUF1800 domain-containing protein	NA	NA	NA	NA	NA
WP_074061504.1|2248965_2249319_-	DMT family protein	NA	NA	NA	NA	NA
WP_074061505.1|2249460_2249844_-	YciI family protein	NA	NA	NA	NA	NA
WP_132660716.1|2250288_2250663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074063196.1|2250821_2252072_-	MFS transporter	NA	NA	NA	NA	NA
WP_074061507.1|2252257_2252917_-	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_074063197.1|2253138_2256198_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_132550195.1|2256467_2257097_-	J domain-containing protein	NA	A0A0P0YNN4	Yellowstone_lake_phycodnavirus	53.3	2.4e-10
WP_018900054.1|2257843_2258056_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	57.1	3.3e-12
WP_081377062.1|2258121_2259084_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_074061508.1|2259256_2260354_+|integrase	tyrosine-type recombinase/integrase	integrase	I6NSG1	Burkholderia_phage	53.2	1.7e-104
WP_074061509.1|2260485_2260710_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_074061510.1|2260730_2260982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074061511.1|2260962_2262651_+	AAA family ATPase	NA	B4UTY9	Rhizobium_phage	53.1	3.3e-94
WP_081377063.1|2262799_2263258_+	hypothetical protein	NA	A0A2I7QUD6	Vibrio_phage	45.7	1.8e-10
WP_081377064.1|2263248_2264895_+|terminase	terminase large subunit	terminase	Q9MCV7	Escherichia_phage	40.9	1.1e-91
WP_074061513.1|2264908_2265121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074061514.1|2265893_2266325_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_074061515.1|2266411_2267566_+|capsid	phage major capsid protein	capsid	K7XS73	uncultured_Mediterranean_phage	30.6	1.7e-33
2266595:2266611	attR	CTCGAAAACGAGATCCG	NA	NA	NA	NA
WP_074061516.1|2267565_2267844_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_074063201.1|2267843_2268383_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1B2APW1	Phage_Wrath	42.1	5.4e-27
>prophage 5
NZ_CP017241	Rhizobium etli 8C-3, complete genome	4186145	3290957	3329845	4186145	integrase,tail,transposase	Ochrobactrum_phage(38.71%)	51	3287063:3287078	3321984:3321999
3287063:3287078	attL	GCCTTGCTGGGTGACG	NA	NA	NA	NA
WP_074061219.1|3290957_3292472_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_074062312.1|3292738_3292954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377108.1|3293149_3294181_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_074062313.1|3294983_3295481_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_074062314.1|3295640_3295946_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_074062315.1|3296247_3296604_+	hypothetical protein	NA	A0A219VHC3	Ochrobactrum_phage	52.2	3.7e-24
WP_074062316.1|3296603_3297470_+	chromosome partitioning protein ParB	NA	A0A219VHB6	Ochrobactrum_phage	54.3	3.5e-68
WP_074062317.1|3297459_3297921_+	hypothetical protein	NA	A0A219VHC5	Ochrobactrum_phage	53.3	4.3e-41
WP_074062318.1|3297917_3299996_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A219VHD4	Ochrobactrum_phage	62.7	6.7e-174
WP_074062319.1|3300020_3301046_+	AAA family ATPase	NA	A0A219VHC7	Ochrobactrum_phage	54.5	4.3e-97
WP_074062320.1|3301042_3301327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074062321.1|3301323_3301623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074062322.1|3301619_3301910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074062323.1|3301917_3302571_+	DUF3164 family protein	NA	A0A1B0T6L8	Pelagibaca_phage	61.7	1.8e-69
WP_155774466.1|3302617_3303382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074062325.1|3303403_3304054_+	regulatory protein GemA	NA	M4STB3	Rhodobacter_phage	48.1	2.3e-48
WP_074062326.1|3304050_3304287_+	hypothetical protein	NA	A0A219VHD0	Ochrobactrum_phage	64.6	6.7e-14
WP_074062327.1|3304279_3304474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074062328.1|3304470_3304869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074062329.1|3304974_3305691_+	TIGR02594 family protein	NA	A0A0A1IUP1	Pseudomonas_phage	38.3	2.2e-23
WP_074062330.1|3305680_3305953_+	hypothetical protein	NA	A0A219VHD7	Ochrobactrum_phage	40.7	6.1e-11
WP_074062331.1|3305952_3306312_+	hypothetical protein	NA	A0A068CE23	Rhizobium_phage	74.1	3.9e-37
WP_081377109.1|3306325_3306526_+	hypothetical protein	NA	A0A068C9B4	Rhizobium_phage	74.2	9.3e-17
WP_074062332.1|3306522_3306744_+	hypothetical protein	NA	A0A219VHE0	Ochrobactrum_phage	56.9	3.4e-12
WP_074062333.1|3306743_3307106_+	DUF2730 family protein	NA	NA	NA	NA	NA
WP_074062334.1|3307102_3307402_+	hypothetical protein	NA	M4SPS4	Rhodobacter_phage	37.2	2.7e-12
WP_074062335.1|3307403_3307994_+	DUF3486 family protein	NA	M4SNU5	Rhodobacter_phage	56.8	1.6e-48
WP_074062336.1|3307990_3309604_+	hypothetical protein	NA	M4SRU6	Rhodobacter_phage	65.0	4.5e-202
WP_081377110.1|3309597_3311232_+	DUF935 domain-containing protein	NA	A0A219VH73	Ochrobactrum_phage	43.9	8.8e-113
WP_074062337.1|3311235_3312459_+	hypothetical protein	NA	A0A219VH74	Ochrobactrum_phage	38.4	1.9e-72
WP_074062338.1|3312647_3313274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074062339.1|3313278_3314325_-	DUF262 domain-containing protein	NA	A0A0M4RT01	Citrobacter_phage	26.6	1.2e-06
WP_074062340.1|3314376_3314808_-	hypothetical protein	NA	R9TRP2	Rhizobium_phage	34.4	1.8e-12
WP_074062341.1|3315053_3316073_+	hypothetical protein	NA	M4SNT6	Rhodobacter_phage	32.6	3.4e-14
WP_074062342.1|3316100_3316502_+	hypothetical protein	NA	A0A0M4TU84	Ralstonia_phage	44.4	1.2e-18
WP_074062343.1|3316529_3317426_+	hypothetical protein	NA	M4SRT6	Rhodobacter_phage	46.4	3.0e-70
WP_074062344.1|3317536_3317788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074062345.1|3317852_3318311_+	DUF1320 domain-containing protein	NA	NA	NA	NA	NA
WP_074062346.1|3318307_3318787_+	phage morphogenesis protein	NA	M4MB67	Vibrio_phage	34.7	7.5e-12
WP_074062347.1|3318783_3319413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074062348.1|3319405_3319945_+	hypothetical protein	NA	A0A219VHA3	Ochrobactrum_phage	37.0	2.0e-21
WP_074062349.1|3319954_3320164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074062350.1|3320183_3320579_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_081377111.1|3320575_3321451_+	hypothetical protein	NA	A0A219VH98	Ochrobactrum_phage	41.4	1.0e-43
WP_074062351.1|3321450_3322575_+	hypothetical protein	NA	K4I1F8	Acidithiobacillus_phage	34.6	4.3e-18
3321984:3321999	attR	CGTCACCCAGCAAGGC	NA	NA	NA	NA
WP_074062352.1|3322574_3325790_+	DUF4815 domain-containing protein	NA	K4ICQ5	Acidithiobacillus_phage	34.1	2.9e-152
WP_074062353.1|3325799_3326735_+	hypothetical protein	NA	S5YL43	Mycobacterium_phage	58.6	6.8e-17
WP_081377113.1|3326662_3327298_+	DUF4376 domain-containing protein	NA	A0A2L0V114	Agrobacterium_phage	69.2	1.3e-40
WP_074062355.1|3327446_3328703_+|tail	phage tail protein	tail	R4JDM4	Burkholderia_phage	24.1	1.7e-10
WP_074062356.1|3328713_3329259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074062357.1|3329353_3329845_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
>prophage 1
NZ_CP017242	Rhizobium etli 8C-3 plasmid pRsp8C3a, complete sequence	430631	368682	397878	430631	transposase,integrase	Stx2-converting_phage(16.67%)	26	391211:391226	398408:398423
WP_155774529.1|368682_368934_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155774520.1|370112_370358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155774521.1|370890_372435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074063633.1|372528_373095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074063634.1|373475_373904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074063572.1|374633_375359_+	response regulator	NA	NA	NA	NA	NA
WP_074063635.1|375355_375826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155774522.1|376187_376493_+	DUF982 domain-containing protein	NA	NA	NA	NA	NA
WP_074063707.1|376594_377362_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_074062276.1|378372_379971_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	33.3	1.1e-70
WP_074062277.1|380045_380390_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_074062278.1|380386_380773_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_074063637.1|380966_382058_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_155774523.1|382371_382644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377189.1|383308_384268_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_074063640.1|384264_384567_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_155774524.1|384516_385182_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	40.5	1.2e-36
WP_074063641.1|385964_386207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074063642.1|386982_387396_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_074063644.1|389408_390332_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	40.0	2.7e-50
WP_074063708.1|390346_390772_-	MerR family DNA-binding protein	NA	NA	NA	NA	NA
391211:391226	attL	CCCTCAACGTCAAGGC	NA	NA	NA	NA
WP_074063645.1|391481_393923_+	DEAD/DEAH box helicase	NA	A0A2K9R7J3	Dishui_lake_phycodnavirus	28.7	6.3e-30
WP_024318408.1|393959_394259_-	DUF736 domain-containing protein	NA	NA	NA	NA	NA
WP_074063709.1|394757_395966_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1L4BKH1	Thermus_phage	28.8	1.6e-05
WP_074063646.1|395959_396877_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_074063647.1|396873_397878_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2K9VH72	Gordonia_phage	28.3	3.6e-08
398408:398423	attR	CCCTCAACGTCAAGGC	NA	NA	NA	NA
>prophage 1
NZ_CP017243	Rhizobium etli 8C-3 plasmid pRsp8C3b, complete sequence	438379	222730	268543	438379	plate,transposase	Stx2-converting_phage(100.0%)	26	NA	NA
WP_004680429.1|222730_223957_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004680428.1|223920_225807_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004680427.1|225806_226310_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004680426.1|226396_226930_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_004680425.1|227045_228533_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004680424.1|228535_229090_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004680423.1|229125_230118_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_074063719.1|231853_234568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004678823.1|236486_237842_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_018247169.1|237903_239070_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_004678820.1|239069_240359_+	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_004678817.1|240368_243974_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_004678816.1|244059_244248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004678814.1|244270_245887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004678812.1|246065_246233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037117783.1|247373_247583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018247171.1|247579_248590_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_074063735.1|248501_249329_-	radical SAM protein	NA	NA	NA	NA	NA
WP_010032001.1|249653_249857_-	nif-specific regulatory protein,nifA	NA	NA	NA	NA	NA
WP_004678802.1|250555_251443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074063720.1|252842_255521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074063721.1|256648_259117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026188840.1|259799_261215_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_004675971.1|266345_266735_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_018247174.1|266731_267085_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_004675973.1|267154_268543_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	38.0	2.6e-81
